Starting /dee2/code/volunteer_pipeline.sh SRR7170692 current disk space = 3088673996800 free memory = 1475885416 SRR7170692 SRAfilesize 0cbbbc2bb9415a1c024a21ca595ccdda SRR7170692.sra SRR7170692.sra file validated SRR7170692 is paired end SRR7170692 is conventional basespace SRR7170692 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170692_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.837 18.0 18.0 32.0 18.0 33.0 2 29.4125 31.0 28.0 33.0 25.0 33.0 3 31.41075 33.0 31.0 33.0 29.0 33.0 4 32.40775 33.0 33.0 33.0 31.0 34.0 5 32.88675 33.0 33.0 34.0 32.0 34.0 6 36.96925 38.0 37.0 38.0 35.0 38.0 7 37.222 38.0 38.0 38.0 36.0 38.0 8 37.42375 38.0 38.0 38.0 37.0 38.0 9 37.47275 38.0 38.0 38.0 37.0 38.0 10-14 37.480850000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.501400000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.58055 38.0 38.0 38.0 38.0 38.0 25-29 37.556799999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.53305 38.0 38.0 38.0 38.0 38.0 35-39 37.5415 38.0 38.0 38.0 38.0 38.0 40-44 37.46275 38.0 38.0 38.0 37.6 38.0 45-49 37.4334 38.0 38.0 38.0 37.4 38.0 50-54 37.36725 38.0 38.0 38.0 37.0 38.0 55-59 37.36039999999999 38.0 38.0 38.0 37.0 38.0 60-64 37.33175 38.0 38.0 38.0 37.0 38.0 65-69 37.24059999999999 38.0 38.0 38.0 36.6 38.0 70-74 37.22044999999999 38.0 38.0 38.0 36.2 38.0 75-79 37.0118 38.0 38.0 38.0 36.0 38.0 80-84 36.986399999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.91655 38.0 38.0 38.0 35.8 38.0 90-94 36.766450000000006 38.0 38.0 38.0 35.4 38.0 95-99 36.6009 38.0 38.0 38.0 34.8 38.0 100-104 36.47959999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.42700000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.2544 38.0 38.0 38.0 34.0 38.0 115-119 35.9913 38.0 37.0 38.0 33.2 38.0 120-124 35.83460000000001 38.0 37.0 38.0 32.6 38.0 125-129 35.842150000000004 38.0 36.8 38.0 32.6 38.0 130-134 35.478699999999996 38.0 36.0 38.0 31.2 38.0 135-139 35.34485 38.0 36.0 38.0 31.0 38.0 140-144 34.74255000000001 38.0 34.8 38.0 28.0 38.0 145-149 34.0644 38.0 33.6 38.0 25.6 38.0 150-151 29.98525 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 2.0 14 2.0 15 0.0 16 3.0 17 1.0 18 7.0 19 7.0 20 6.0 21 5.0 22 2.0 23 3.0 24 5.0 25 4.0 26 12.0 27 12.0 28 17.0 29 25.0 30 31.0 31 41.0 32 65.0 33 93.0 34 135.0 35 262.0 36 770.0 37 2486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.01619843077702 20.956719817767656 12.984054669703873 30.043027081751454 2 18.95 25.224999999999998 37.925 17.9 3 15.950000000000001 32.275 29.2 22.575 4 20.1 35.449999999999996 24.275 20.175 5 19.949874686716793 38.095238095238095 23.784461152882205 18.170426065162907 6 16.825000000000003 35.9 25.85 21.425 7 12.725 20.75 45.175 21.349999999999998 8 18.025 23.225 27.875 30.875000000000004 9 17.424999999999997 22.725 30.375000000000004 29.475 10-14 18.765 30.285 26.755000000000003 24.195 15-19 19.655 30.064999999999998 27.175 23.105 20-24 19.175 29.98 27.839999999999996 23.005 25-29 19.645000000000003 29.725 27.43 23.200000000000003 30-34 18.935 29.445 28.110000000000003 23.51 35-39 19.564999999999998 30.17 27.015 23.25 40-44 19.725 29.775000000000002 27.095000000000002 23.405 45-49 20.055 29.57 26.695 23.68 50-54 19.695 28.88 27.63 23.794999999999998 55-59 19.49 28.7 27.52 24.29 60-64 19.615 29.09 27.515 23.78 65-69 19.515 29.24 27.52 23.724999999999998 70-74 19.68 28.73 27.32 24.27 75-79 19.8 28.895 27.224999999999998 24.08 80-84 19.900000000000002 28.675 27.505000000000003 23.919999999999998 85-89 20.305 28.71 27.305 23.68 90-94 19.67 29.060000000000002 27.134999999999998 24.135 95-99 20.119999999999997 28.705000000000002 27.61 23.565 100-104 20.14 28.67 27.99 23.200000000000003 105-109 20.09 28.555000000000003 27.485 23.87 110-114 20.665 28.29 27.66 23.385 115-119 20.145 28.744999999999997 27.395000000000003 23.715 120-124 20.395 28.515 27.195000000000004 23.895 125-129 20.745 28.27 26.915 24.07 130-134 20.44 28.610000000000003 26.865 24.085 135-139 19.79 28.439999999999998 27.29 24.48 140-144 20.605 27.525 27.334999999999997 24.535 145-149 20.345 28.04 27.500000000000004 24.115000000000002 150-151 20.20517953209058 28.424871762792442 26.473164018516204 24.896784686600775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 2.5 23 4.5 24 4.5 25 7.5 26 9.5 27 8.5 28 14.0 29 23.0 30 29.0 31 39.0 32 51.5 33 56.0 34 70.5 35 111.5 36 133.5 37 141.0 38 150.5 39 168.5 40 190.5 41 216.0 42 231.5 43 229.0 44 241.0 45 244.5 46 231.0 47 220.0 48 196.5 49 181.0 50 166.0 51 132.5 52 105.0 53 88.5 54 74.5 55 60.0 56 49.5 57 36.0 58 24.5 59 15.0 60 11.0 61 9.5 62 5.5 63 2.5 64 3.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.77800407331976 97.0 2 0.840122199592668 1.6500000000000001 3 0.30549898167006106 0.8999999999999999 4 0.05091649694501018 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02545824847250509 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 10 0.25 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9125 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6125 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.2 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.6 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.6875 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138-139 6.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGCACC 10 0.006577216 146.82278 1 TTGAGGT 10 0.006832588 144.9875 7 >>END_MODULE SRR7170692 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170692_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70925 33.0 33.0 34.0 32.0 34.0 2 32.81675 33.0 33.0 34.0 32.0 34.0 3 32.93325 34.0 33.0 34.0 32.0 34.0 4 32.874 34.0 33.0 34.0 32.0 34.0 5 32.7825 33.0 33.0 34.0 32.0 34.0 6 36.97425 38.0 38.0 38.0 36.0 38.0 7 37.00325 38.0 38.0 38.0 36.0 38.0 8 37.04575 38.0 38.0 38.0 37.0 38.0 9 36.973 38.0 38.0 38.0 36.0 38.0 10-14 36.9774 38.0 38.0 38.0 36.2 38.0 15-19 36.929700000000004 38.0 38.0 38.0 36.4 38.0 20-24 36.97245 38.0 38.0 38.0 36.4 38.0 25-29 36.9969 38.0 38.0 38.0 36.8 38.0 30-34 36.9205 38.0 38.0 38.0 36.4 38.0 35-39 36.955949999999994 38.0 38.0 38.0 36.8 38.0 40-44 36.92855 38.0 38.0 38.0 36.6 38.0 45-49 36.8729 38.0 38.0 38.0 36.2 38.0 50-54 36.819 38.0 38.0 38.0 36.0 38.0 55-59 36.7923 38.0 38.0 38.0 36.0 38.0 60-64 36.77945 38.0 38.0 38.0 36.0 38.0 65-69 36.77460000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.75485 38.0 38.0 38.0 36.0 38.0 75-79 36.591750000000005 38.0 38.0 38.0 35.6 38.0 80-84 36.46995 38.0 38.0 38.0 35.2 38.0 85-89 36.41525 38.0 38.0 38.0 35.0 38.0 90-94 36.3485 38.0 38.0 38.0 35.0 38.0 95-99 36.2337 38.0 38.0 38.0 34.0 38.0 100-104 36.11104999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.03125 38.0 38.0 38.0 34.0 38.0 110-114 35.7943 38.0 37.6 38.0 33.4 38.0 115-119 35.61365000000001 38.0 37.0 38.0 32.2 38.0 120-124 35.55265000000001 38.0 37.0 38.0 32.0 38.0 125-129 35.15045 38.0 36.2 38.0 29.8 38.0 130-134 34.75175 38.0 36.0 38.0 27.6 38.0 135-139 34.472300000000004 38.0 36.0 38.0 27.0 38.0 140-144 34.05825 38.0 34.4 38.0 24.6 38.0 145-149 33.41945 38.0 33.6 38.0 20.6 38.0 150-151 28.067375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 9.0 4 4.0 5 3.0 6 5.0 7 3.0 8 1.0 9 4.0 10 3.0 11 7.0 12 1.0 13 1.0 14 4.0 15 3.0 16 6.0 17 4.0 18 7.0 19 3.0 20 9.0 21 8.0 22 7.0 23 2.0 24 9.0 25 11.0 26 26.0 27 15.0 28 23.0 29 33.0 30 37.0 31 46.0 32 52.0 33 96.0 34 147.0 35 243.0 36 582.0 37 2578.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.3 16.925 14.524999999999999 26.25 2 24.8 22.7 35.325 17.175 3 20.45 26.575 33.525 19.45 4 24.45 35.275 21.325 18.95 5 23.35 38.025 20.525 18.099999999999998 6 17.8 37.75 25.35 19.1 7 17.675 16.2 42.725 23.400000000000002 8 19.15 23.625 26.525 30.7 9 22.725 24.8 26.924999999999997 25.55 10-14 23.150000000000002 28.499999999999996 26.979999999999997 21.37 15-19 23.645 27.425 28.044999999999998 20.885 20-24 23.205000000000002 28.54 28.095 20.16 25-29 23.16 28.16 27.860000000000003 20.82 30-34 22.805 28.035 28.360000000000003 20.8 35-39 23.915 27.93 27.445000000000004 20.71 40-44 23.599999999999998 27.685 28.194999999999997 20.52 45-49 23.474999999999998 27.965 27.889999999999997 20.669999999999998 50-54 23.5 27.505000000000003 28.310000000000002 20.685000000000002 55-59 23.27 28.26 27.689999999999998 20.78 60-64 23.89 27.32 27.894999999999996 20.895 65-69 23.265 27.384999999999998 27.939999999999998 21.41 70-74 23.815 27.99 27.365000000000002 20.830000000000002 75-79 23.485 28.294999999999998 26.884999999999998 21.335 80-84 23.885 28.475 27.26 20.380000000000003 85-89 24.044999999999998 27.47 28.035 20.45 90-94 24.04 28.21 27.52 20.23 95-99 24.099999999999998 27.334999999999997 28.349999999999998 20.215 100-104 24.625 26.755000000000003 28.15 20.47 105-109 24.21 27.689999999999998 27.425 20.674999999999997 110-114 24.365000000000002 28.499999999999996 26.924999999999997 20.21 115-119 24.435000000000002 27.655 27.200000000000003 20.71 120-124 24.7 27.3 27.744999999999997 20.255000000000003 125-129 24.08 28.37 27.325 20.225 130-134 24.545 27.985 27.694999999999997 19.775000000000002 135-139 24.535 27.675 28.015 19.775000000000002 140-144 24.465 27.37 27.860000000000003 20.305 145-149 24.6 28.185 27.229999999999997 19.985 150-151 25.82541270635318 26.91345672836418 28.31415707853927 18.94697348674337 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 0.5 23 2.5 24 3.5 25 4.5 26 6.0 27 4.5 28 8.0 29 14.5 30 14.0 31 19.5 32 28.5 33 39.0 34 58.5 35 64.0 36 73.5 37 103.5 38 137.0 39 153.0 40 167.0 41 204.5 42 230.0 43 261.5 44 288.5 45 275.0 46 241.5 47 232.0 48 239.5 49 219.5 50 167.5 51 129.5 52 121.5 53 116.5 54 104.5 55 81.0 56 58.5 57 36.5 58 21.0 59 16.0 60 15.5 61 10.5 62 6.5 63 5.5 64 4.0 65 2.0 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.725 #Duplication Level Percentage of deduplicated Percentage of total 1 98.5929905346636 96.35000000000001 2 1.0488616014325916 2.0500000000000003 3 0.15349194167306215 0.44999999999999996 4 0.07674597083653108 0.3 5 0.051163980557687394 0.25 6 0.025581990278843697 0.15 7 0.025581990278843697 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025581990278843697 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 11 0.27499999999999997 Illumina Single End PCR Primer 1 (96% over 32bp) CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAA 7 0.17500000000000002 No Hit TTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACC 6 0.15 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit CACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5375000000000001 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.725 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.825 0.0 0.0 0.0 0.0 110-111 2.1 0.0 0.0 0.0 0.0 112-113 2.325 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.8625 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.925 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.575 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGAGC 10 0.006830828 145.0 7 TGTGTGC 10 0.006830828 145.0 145 >>END_MODULE Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772066 spots for SRR7170692.sra Written 772066 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra Read 772050 spots for SRR7170692.sra Written 772050 spots for SRR7170692.sra SRR ids: ['SRR7170692.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mbg_780y SRR7170692.sra spots: 15441016 blocks: [[1, 772050], [772051, 1544100], [1544101, 2316150], [2316151, 3088200], [3088201, 3860250], [3860251, 4632300], [4632301, 5404350], [5404351, 6176400], [6176401, 6948450], [6948451, 7720500], [7720501, 8492550], [8492551, 9264600], [9264601, 10036650], [10036651, 10808700], [10808701, 11580750], [11580751, 12352800], [12352801, 13124850], [13124851, 13896900], [13896901, 14668950], [14668951, 15441016]] SRR7170692 file size 5210753 SRR7170692 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170692 SRR7170692_1.fastq SRR7170692_2.fastq Input file: SRR7170692_1.fastq Paired file: SRR7170692_2.fastq trimmed: SRR7170692-trimmed-pair1.fastq, SRR7170692-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:19:21 2025 >> started Thu Feb 13 17:19:38 2025 >> done (16.771s) 15441016 read pairs processed; of these: 20740 ( 0.13%) short read pairs filtered out after trimming by size control 74896 ( 0.49%) empty read pairs filtered out after trimming by size control 15345380 (99.38%) read pairs available; of these: 7681194 (50.06%) trimmed read pairs available after processing 7664186 (49.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 15 0.00% 20 7 0.00% 21 8 0.00% 22 9 0.00% 23 14 0.00% 24 15 0.00% 25 15 0.00% 26 16 0.00% 27 17 0.00% 28 11 0.00% 29 17 0.00% 30 15 0.00% 31 30 0.00% 32 23 0.00% 33 20 0.00% 34 18 0.00% 35 19 0.00% 36 20 0.00% 37 27 0.00% 38 45 0.00% 39 33 0.00% 40 45 0.00% 41 52 0.00% 42 59 0.00% 43 63 0.00% 44 86 0.00% 45 87 0.00% 46 93 0.00% 47 136 0.00% 48 146 0.00% 49 174 0.00% 50 161 0.00% 51 212 0.00% 52 253 0.00% 53 236 0.00% 54 245 0.00% 55 265 0.00% 56 275 0.00% 57 368 0.00% 58 366 0.00% 59 459 0.00% 60 520 0.00% 61 543 0.00% 62 592 0.00% 63 695 0.00% 64 765 0.00% 65 824 0.01% 66 841 0.01% 67 894 0.01% 68 992 0.01% 69 1070 0.01% 70 1322 0.01% 71 1532 0.01% 72 1926 0.01% 73 2089 0.01% 74 2576 0.02% 75 3938 0.03% 76 8710 0.06% 77 7696 0.05% 78 3884 0.03% 79 3635 0.02% 80 3837 0.03% 81 4361 0.03% 82 4684 0.03% 83 5134 0.03% 84 6837 0.04% 85 7433 0.05% 86 7931 0.05% 87 8152 0.05% 88 8353 0.05% 89 8771 0.06% 90 9286 0.06% 91 9968 0.06% 92 10662 0.07% 93 11503 0.07% 94 12033 0.08% 95 12711 0.08% 96 12961 0.08% 97 13045 0.09% 98 13285 0.09% 99 13783 0.09% 100 14273 0.09% 101 15192 0.10% 102 16344 0.11% 103 17481 0.11% 104 18019 0.12% 105 18968 0.12% 106 19355 0.13% 107 19415 0.13% 108 19845 0.13% 109 20386 0.13% 110 21028 0.14% 111 21478 0.14% 112 23013 0.15% 113 24286 0.16% 114 25040 0.16% 115 25683 0.17% 116 26141 0.17% 117 26586 0.17% 118 26662 0.17% 119 27237 0.18% 120 28219 0.18% 121 28920 0.19% 122 29847 0.19% 123 31468 0.21% 124 32864 0.21% 125 33923 0.22% 126 35001 0.23% 127 35950 0.23% 128 36735 0.24% 129 38221 0.25% 130 39225 0.26% 131 40669 0.27% 132 42606 0.28% 133 45464 0.30% 134 48349 0.32% 135 50843 0.33% 136 53940 0.35% 137 57075 0.37% 138 60470 0.39% 139 65528 0.43% 140 70949 0.46% 141 79107 0.52% 142 89619 0.58% 143 101820 0.66% 144 117395 0.77% 145 143110 0.93% 146 182297 1.19% 147 253355 1.65% 148 393263 2.56% 149 781925 5.10% 150 3972648 25.89% 151 7664186 49.94% 15345380 reads passed initial QC criterion=sequence-density sequence-density=1.58 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=22 prefix-density=1.43 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=24.25 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=6.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=13 prefix-density=0.92 prefix-fanout=2.4 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.20 sequence-density-rank=21 fanout-score=12.64 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=5.0 sequence=AGCAATGGCAGCA SRR7170692 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:20:23 Started mapping on | Feb 13 17:20:23 Finished on | Feb 13 17:22:13 Mapping speed, Million of reads per hour | 502.21 Number of input reads | 15345380 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14279409 Uniquely mapped reads % | 93.05% Average mapped length | 293.49 Number of splices: Total | 13569599 Number of splices: Annotated (sjdb) | 13272946 Number of splices: GT/AG | 13321391 Number of splices: GC/AG | 194072 Number of splices: AT/AC | 10610 Number of splices: Non-canonical | 43526 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396326 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 21519 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.16% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 692373 692373 692373 N_multimapping 396326 396326 396326 N_noFeature 450029 13876007 537268 N_ambiguous 419944 1139 103249 UnstrandedReadsAssigned:13409436 PositiveStrandReadsAssigned:402263 NegativeStrandReadsAssigned:13638892 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170692 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170692-trimmed-pair1.fastq SRR7170692-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,345,380 reads, 13,500,195 reads pseudoaligned [quant] estimated average fragment length: 258.955 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52401 SRR7170692.ke.tsv 34699 SRR7170692.se.tsv 87100 total ==> SRR7170692.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.05 679 19.3372 Potri.005G024800.1.v4.1 1035 777.045 378 24.3834 Potri.004G059700.1.v4.1 961 703.11 22 1.56837 Potri.007G009000.2.v4.1 1416 1158.05 0 0 Potri.003G141000.2.v4.1 2943 2685.05 716 13.3663 Potri.016G087400.1.v4.1 270 78.2784 1193 763.918 Potri.015G069301.1.v4.1 564 313.419 0 0 Potri.010G195200.1.v4.1 1773 1515.05 158 5.22733 Potri.012G127500.1.v4.1 977 719.075 326 22.7243 ==> SRR7170692.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 795 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 454 Potri.001G212900.v4.1 34 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170692 completed mapping pipeline successfully