Starting /dee2/code/volunteer_pipeline.sh SRR7170693 current disk space = 3088724717568 free memory = 1412317964 SRR7170693 SRAfilesize 97d740c0635c53039c8e9d47526eee6e SRR7170693.sra SRR7170693.sra file validated SRR7170693 is paired end SRR7170693 is conventional basespace SRR7170693 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170693_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.92 27.0 18.0 32.0 18.0 33.0 2 31.0665 31.0 30.0 33.0 27.0 33.0 3 31.80175 33.0 31.0 33.0 29.0 33.0 4 32.5815 33.0 33.0 33.0 32.0 34.0 5 33.02925 33.0 33.0 34.0 32.0 34.0 6 37.273 38.0 38.0 38.0 36.0 38.0 7 37.46925 38.0 38.0 38.0 37.0 38.0 8 37.44525 38.0 38.0 38.0 37.0 38.0 9 37.442 38.0 38.0 38.0 37.0 38.0 10-14 37.44095 38.0 38.0 38.0 37.0 38.0 15-19 37.359750000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.4644 38.0 38.0 38.0 37.2 38.0 25-29 37.4405 38.0 38.0 38.0 37.6 38.0 30-34 37.41445 38.0 38.0 38.0 37.2 38.0 35-39 37.37235 38.0 38.0 38.0 37.0 38.0 40-44 37.301550000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.35905 38.0 38.0 38.0 37.0 38.0 50-54 37.23735 38.0 38.0 38.0 36.8 38.0 55-59 37.1201 38.0 38.0 38.0 36.0 38.0 60-64 37.10395 38.0 38.0 38.0 36.2 38.0 65-69 37.03830000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.9519 38.0 38.0 38.0 35.6 38.0 75-79 36.8695 38.0 38.0 38.0 35.2 38.0 80-84 36.717 38.0 38.0 38.0 35.0 38.0 85-89 36.5966 38.0 38.0 38.0 34.4 38.0 90-94 36.47345 38.0 38.0 38.0 34.0 38.0 95-99 36.38675 38.0 38.0 38.0 34.0 38.0 100-104 36.106399999999994 38.0 37.2 38.0 33.6 38.0 105-109 35.99385 38.0 37.0 38.0 33.0 38.0 110-114 35.797000000000004 38.0 37.0 38.0 31.8 38.0 115-119 35.51075 38.0 36.2 38.0 30.6 38.0 120-124 35.379450000000006 38.0 36.0 38.0 30.0 38.0 125-129 35.312400000000004 38.0 36.0 38.0 29.6 38.0 130-134 35.0533 38.0 35.6 38.0 28.6 38.0 135-139 34.53165 38.0 34.4 38.0 26.6 38.0 140-144 33.69305000000001 38.0 33.4 38.0 22.2 38.0 145-149 33.23095 38.0 33.0 38.0 19.4 38.0 150-151 28.634625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 3.0 18 8.0 19 11.0 20 4.0 21 7.0 22 6.0 23 5.0 24 7.0 25 9.0 26 10.0 27 15.0 28 18.0 29 31.0 30 41.0 31 49.0 32 76.0 33 131.0 34 197.0 35 336.0 36 899.0 37 2124.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.53993365654504 18.550650676192905 16.101046185251338 28.808369482010715 2 20.275000000000002 24.25 36.199999999999996 19.275000000000002 3 17.549999999999997 31.15 27.625 23.674999999999997 4 20.150000000000002 38.25 22.475 19.125 5 20.340255191393545 37.928446334751065 22.54190642982237 19.189392044033024 6 17.375 36.225 25.0 21.4 7 11.625 21.125 45.25 22.0 8 18.15 21.2 27.175 33.475 9 18.4 23.35 29.875 28.375 10-14 19.040000000000003 30.335 26.795 23.830000000000002 15-19 19.575 28.884999999999998 27.500000000000004 24.04 20-24 19.27 29.349999999999998 27.735 23.645 25-29 19.53 29.270000000000003 27.955000000000002 23.244999999999997 30-34 20.255000000000003 29.345 27.450000000000003 22.95 35-39 19.375 28.82 27.79 24.015 40-44 19.825 29.459999999999997 27.400000000000002 23.315 45-49 19.875 28.01 27.644999999999996 24.47 50-54 19.78 29.12 27.785 23.315 55-59 19.57 28.685 27.755000000000003 23.990000000000002 60-64 19.56 28.675 28.525 23.24 65-69 19.68 28.73 28.084999999999997 23.505000000000003 70-74 19.865 28.655 28.050000000000004 23.43 75-79 19.580000000000002 29.145 27.900000000000002 23.375 80-84 19.975 28.665000000000003 27.91 23.45 85-89 19.98 28.444999999999997 27.98 23.595 90-94 19.744999999999997 28.815 27.72 23.72 95-99 20.32 28.315 27.544999999999998 23.82 100-104 20.05 28.605000000000004 27.36 23.985 105-109 19.580000000000002 28.854999999999997 27.51 24.055 110-114 20.085 28.735 27.275 23.905 115-119 20.77 28.560000000000002 26.83 23.84 120-124 20.75 28.53 27.455000000000002 23.265 125-129 20.365 28.985 27.29 23.36 130-134 20.244999999999997 28.599999999999998 27.534999999999997 23.62 135-139 20.5 27.810000000000002 27.134999999999998 24.555 140-144 20.23 28.48 27.825 23.465 145-149 20.93 28.655 26.58 23.835 150-151 19.400000000000002 29.299999999999997 27.0 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 1.5 9 2.0 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 1.5 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 3.0 25 6.5 26 7.5 27 8.5 28 17.0 29 24.0 30 30.0 31 40.5 32 41.5 33 50.0 34 69.0 35 87.0 36 109.0 37 121.0 38 136.5 39 159.0 40 194.5 41 232.5 42 258.5 43 254.0 44 247.0 45 257.5 46 246.0 47 229.5 48 221.5 49 191.0 50 159.0 51 128.5 52 97.5 53 90.5 54 75.0 55 48.0 56 34.0 57 33.0 58 26.5 59 17.5 60 9.0 61 7.0 62 4.5 63 1.0 64 1.0 65 1.5 66 1.0 67 2.0 68 3.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29275069461985 98.275 2 0.6062136903258398 1.2 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025258903763576663 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 12 0.3 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6375 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.9125000000000001 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 1.925 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.65 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.2125 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170693 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170693_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79325 33.0 33.0 34.0 32.0 34.0 2 32.87525 33.0 33.0 34.0 32.0 34.0 3 32.87575 34.0 33.0 34.0 32.0 34.0 4 32.78625 34.0 33.0 34.0 32.0 34.0 5 32.80975 34.0 33.0 34.0 32.0 34.0 6 36.9215 38.0 38.0 38.0 36.0 38.0 7 36.9815 38.0 38.0 38.0 37.0 38.0 8 37.04575 38.0 38.0 38.0 36.0 38.0 9 37.0795 38.0 38.0 38.0 37.0 38.0 10-14 36.98550000000001 38.0 38.0 38.0 36.6 38.0 15-19 36.9726 38.0 38.0 38.0 37.0 38.0 20-24 36.9652 38.0 38.0 38.0 36.8 38.0 25-29 36.89705 38.0 38.0 38.0 36.2 38.0 30-34 36.84495 38.0 38.0 38.0 36.2 38.0 35-39 36.829150000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.865 38.0 38.0 38.0 36.6 38.0 45-49 36.783249999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.70235 38.0 38.0 38.0 36.0 38.0 55-59 36.679449999999996 38.0 38.0 38.0 35.6 38.0 60-64 36.627050000000004 38.0 38.0 38.0 35.6 38.0 65-69 36.57815000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.54475 38.0 38.0 38.0 35.0 38.0 75-79 36.45575 38.0 38.0 38.0 35.0 38.0 80-84 36.315099999999994 38.0 38.0 38.0 34.6 38.0 85-89 36.2661 38.0 38.0 38.0 34.4 38.0 90-94 36.15255 38.0 38.0 38.0 34.0 38.0 95-99 35.9901 38.0 38.0 38.0 33.8 38.0 100-104 35.897450000000006 38.0 38.0 38.0 33.4 38.0 105-109 35.808749999999996 38.0 37.6 38.0 33.2 38.0 110-114 35.44275 38.0 37.0 38.0 31.4 38.0 115-119 35.306 38.0 37.0 38.0 30.2 38.0 120-124 35.2325 38.0 36.8 38.0 30.6 38.0 125-129 34.9427 38.0 36.0 38.0 28.6 38.0 130-134 34.35510000000001 38.0 35.2 38.0 25.2 38.0 135-139 34.00055 38.0 33.2 38.0 24.4 38.0 140-144 33.31925 38.0 33.0 38.0 20.6 38.0 145-149 32.2123 38.0 33.0 38.0 10.6 38.0 150-151 26.525750000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 8.0 4 5.0 5 2.0 6 5.0 7 2.0 8 2.0 9 0.0 10 5.0 11 2.0 12 4.0 13 4.0 14 3.0 15 5.0 16 9.0 17 7.0 18 5.0 19 16.0 20 6.0 21 5.0 22 7.0 23 9.0 24 15.0 25 11.0 26 14.0 27 20.0 28 25.0 29 33.0 30 46.0 31 41.0 32 77.0 33 89.0 34 158.0 35 295.0 36 707.0 37 2344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 16.150000000000002 17.25 25.924999999999997 2 25.525 21.45 34.050000000000004 18.975 3 20.5 26.75 32.725 20.025000000000002 4 24.925 33.25 22.5 19.325 5 24.099999999999998 36.025 20.875 19.0 6 17.349999999999998 38.574999999999996 23.175 20.9 7 17.849999999999998 16.675 44.425 21.05 8 20.8 22.675 26.0 30.525000000000002 9 21.925 24.025 28.599999999999998 25.45 10-14 22.62 28.7 27.185 21.495 15-19 23.315 28.225 27.82 20.64 20-24 23.200000000000003 28.915000000000003 27.325 20.560000000000002 25-29 23.755000000000003 27.944999999999997 28.08 20.22 30-34 23.205000000000002 27.67 28.37 20.755000000000003 35-39 22.86114305715286 28.421421071053555 28.24641232061603 20.47102355117756 40-44 23.556177808890443 28.026401320066004 28.151407570378517 20.266013300665033 45-49 23.25 27.77 28.225 20.755000000000003 50-54 23.369999999999997 27.665 27.965 21.0 55-59 23.395 28.134999999999998 27.450000000000003 21.02 60-64 23.325000000000003 27.389999999999997 28.499999999999996 20.785 65-69 23.23 27.395000000000003 28.7 20.674999999999997 70-74 23.665 28.015 27.905 20.415 75-79 23.400000000000002 28.02 27.49 21.09 80-84 23.79 28.625 27.79 19.794999999999998 85-89 23.39 27.61 28.035 20.965 90-94 23.830000000000002 28.02 27.87 20.28 95-99 23.62 28.26 27.800000000000004 20.32 100-104 23.835 27.655 27.994999999999997 20.515 105-109 23.945 28.62 27.705000000000002 19.73 110-114 23.595 27.689999999999998 28.044999999999998 20.669999999999998 115-119 24.455 27.875 27.775 19.895 120-124 24.47 27.825 27.965 19.74 125-129 24.055 27.79 28.29 19.865 130-134 23.93 28.194999999999997 28.1 19.775000000000002 135-139 24.635 27.83 28.16 19.375 140-144 24.755 27.51 27.445000000000004 20.29 145-149 24.865000000000002 28.125 27.185 19.825 150-151 24.425 27.737499999999997 27.712500000000002 20.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 3.5 26 5.0 27 7.0 28 10.5 29 14.0 30 16.5 31 18.5 32 32.0 33 42.0 34 44.5 35 66.0 36 88.0 37 100.5 38 119.0 39 156.0 40 197.5 41 224.5 42 251.5 43 280.0 44 279.5 45 274.5 46 262.0 47 242.0 48 228.0 49 193.5 50 162.0 51 141.5 52 115.5 53 94.5 54 85.0 55 65.5 56 44.0 57 37.0 58 29.5 59 17.5 60 12.0 61 11.0 62 9.5 63 5.5 64 2.5 65 0.5 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41919191919192 98.425 2 0.4292929292929293 0.8500000000000001 3 0.07575757575757576 0.22499999999999998 4 0.050505050505050504 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025252525252525252 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 12 0.3 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0125 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.037500000000000006 0.025 0.0 0.0 0.0 74-75 0.0625 0.025 0.0 0.0 0.0 76-77 0.075 0.025 0.0 0.0 0.0 78-79 0.1 0.025 0.0 0.0 0.0 80-81 0.1 0.025 0.0 0.0 0.0 82-83 0.15 0.025 0.0 0.0 0.0 84-85 0.2125 0.025 0.0 0.0 0.0 86-87 0.3 0.025 0.0 0.0 0.0 88-89 0.3375 0.025 0.0 0.0 0.0 90-91 0.3875 0.025 0.0 0.0 0.0 92-93 0.475 0.025 0.0 0.0 0.0 94-95 0.5875 0.025 0.0 0.0 0.0 96-97 0.7250000000000001 0.025 0.0 0.0 0.0 98-99 0.8625 0.025 0.0 0.0 0.0 100-101 1.0125 0.025 0.0 0.0 0.0 102-103 1.2000000000000002 0.025 0.0 0.0 0.0 104-105 1.3375 0.025 0.0 0.0 0.0 106-107 1.525 0.025 0.0 0.0 0.0 108-109 1.7125 0.025 0.0 0.0 0.0 110-111 1.875 0.025 0.0 0.0 0.0 112-113 2.0375 0.025 0.0 0.0 0.0 114-115 2.25 0.025 0.0 0.0 0.0 116-117 2.4375 0.025 0.0 0.0 0.0 118-119 2.6500000000000004 0.025 0.0 0.0 0.0 120-121 2.8625 0.025 0.0 0.0 0.0 122-123 3.0125 0.025 0.0 0.0 0.0 124-125 3.375 0.025 0.0 0.0 0.0 126-127 3.6624999999999996 0.025 0.0 0.0 0.0 128-129 3.975 0.025 0.0 0.0 0.0 130-131 4.3125 0.025 0.0 0.0 0.0 132-133 4.65 0.025 0.0 0.0 0.0 134-135 5.1 0.025 0.0 0.0 0.0 136-137 5.387499999999999 0.025 0.0 0.0 0.0 138-139 5.7125 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTAT 10 0.006830828 145.0 1 >>END_MODULE Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731756 spots for SRR7170693.sra Written 731756 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra Read 731755 spots for SRR7170693.sra Written 731755 spots for SRR7170693.sra SRR ids: ['SRR7170693.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nsq56htu SRR7170693.sra spots: 14635101 blocks: [[1, 731755], [731756, 1463510], [1463511, 2195265], [2195266, 2927020], [2927021, 3658775], [3658776, 4390530], [4390531, 5122285], [5122286, 5854040], [5854041, 6585795], [6585796, 7317550], [7317551, 8049305], [8049306, 8781060], [8781061, 9512815], [9512816, 10244570], [10244571, 10976325], [10976326, 11708080], [11708081, 12439835], [12439836, 13171590], [13171591, 13903345], [13903346, 14635101]] SRR7170693 file size 4937655 SRR7170693 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170693 SRR7170693_1.fastq SRR7170693_2.fastq Input file: SRR7170693_1.fastq Paired file: SRR7170693_2.fastq trimmed: SRR7170693-trimmed-pair1.fastq, SRR7170693-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:02:25 2025 >> started Thu Feb 13 17:02:43 2025 >> done (17.444s) 14635101 read pairs processed; of these: 20922 ( 0.14%) short read pairs filtered out after trimming by size control 49055 ( 0.34%) empty read pairs filtered out after trimming by size control 14565124 (99.52%) read pairs available; of these: 7882437 (54.12%) trimmed read pairs available after processing 6682687 (45.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 8 0.00% 20 11 0.00% 21 9 0.00% 22 8 0.00% 23 14 0.00% 24 9 0.00% 25 8 0.00% 26 20 0.00% 27 18 0.00% 28 11 0.00% 29 14 0.00% 30 7 0.00% 31 10 0.00% 32 9 0.00% 33 14 0.00% 34 15 0.00% 35 3 0.00% 36 17 0.00% 37 18 0.00% 38 19 0.00% 39 33 0.00% 40 27 0.00% 41 29 0.00% 42 24 0.00% 43 32 0.00% 44 28 0.00% 45 52 0.00% 46 55 0.00% 47 65 0.00% 48 82 0.00% 49 68 0.00% 50 87 0.00% 51 103 0.00% 52 102 0.00% 53 118 0.00% 54 128 0.00% 55 136 0.00% 56 134 0.00% 57 191 0.00% 58 207 0.00% 59 232 0.00% 60 263 0.00% 61 343 0.00% 62 326 0.00% 63 363 0.00% 64 414 0.00% 65 466 0.00% 66 462 0.00% 67 596 0.00% 68 593 0.00% 69 763 0.01% 70 815 0.01% 71 945 0.01% 72 1062 0.01% 73 1245 0.01% 74 1424 0.01% 75 1744 0.01% 76 2326 0.02% 77 2428 0.02% 78 2186 0.02% 79 2267 0.02% 80 2554 0.02% 81 2872 0.02% 82 3267 0.02% 83 3805 0.03% 84 4893 0.03% 85 5661 0.04% 86 6337 0.04% 87 6592 0.05% 88 6515 0.04% 89 7072 0.05% 90 7339 0.05% 91 7826 0.05% 92 8163 0.06% 93 9027 0.06% 94 9460 0.06% 95 10064 0.07% 96 10414 0.07% 97 10625 0.07% 98 11353 0.08% 99 11495 0.08% 100 12325 0.08% 101 12719 0.09% 102 13642 0.09% 103 14258 0.10% 104 15048 0.10% 105 15788 0.11% 106 16740 0.11% 107 16862 0.12% 108 17249 0.12% 109 18195 0.12% 110 18943 0.13% 111 19811 0.14% 112 20810 0.14% 113 21564 0.15% 114 22260 0.15% 115 22735 0.16% 116 23507 0.16% 117 23912 0.16% 118 24664 0.17% 119 25228 0.17% 120 26457 0.18% 121 27428 0.19% 122 28316 0.19% 123 30116 0.21% 124 30717 0.21% 125 32171 0.22% 126 33401 0.23% 127 34710 0.24% 128 36148 0.25% 129 37556 0.26% 130 39179 0.27% 131 40894 0.28% 132 43495 0.30% 133 46473 0.32% 134 49156 0.34% 135 52203 0.36% 136 55754 0.38% 137 60466 0.42% 138 64805 0.44% 139 71251 0.49% 140 78755 0.54% 141 87916 0.60% 142 98397 0.68% 143 115089 0.79% 144 135887 0.93% 145 168585 1.16% 146 214236 1.47% 147 296517 2.04% 148 464298 3.19% 149 931597 6.40% 150 3905650 26.82% 151 6682687 45.88% 14565124 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=25.19 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=GATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTT criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=1.03 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=78.82 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170693 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:03:31 Started mapping on | Feb 13 17:03:31 Finished on | Feb 13 17:05:25 Mapping speed, Million of reads per hour | 459.95 Number of input reads | 14565124 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13507626 Uniquely mapped reads % | 92.74% Average mapped length | 293.54 Number of splices: Total | 13343692 Number of splices: Annotated (sjdb) | 13006037 Number of splices: GT/AG | 13104080 Number of splices: GC/AG | 185842 Number of splices: AT/AC | 8917 Number of splices: Non-canonical | 44853 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416998 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 26661 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 659908 659908 659908 N_multimapping 416998 416998 416998 N_noFeature 493526 13242907 574062 N_ambiguous 299773 1025 115047 UnstrandedReadsAssigned:12714327 PositiveStrandReadsAssigned:263694 NegativeStrandReadsAssigned:12818517 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170693 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170693-trimmed-pair1.fastq SRR7170693-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,565,124 reads, 12,751,793 reads pseudoaligned [quant] estimated average fragment length: 263.319 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7170693.ke.tsv 34699 SRR7170693.se.tsv 87100 total ==> SRR7170693.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.68 842 30.1527 Potri.005G024800.1.v4.1 1035 772.681 303 24.6548 Potri.004G059700.1.v4.1 961 698.772 9 0.809778 Potri.007G009000.2.v4.1 1416 1153.68 0 0 Potri.003G141000.2.v4.1 2943 2680.68 868 20.3579 Potri.016G087400.1.v4.1 270 77.6536 1271 1029.07 Potri.015G069301.1.v4.1 564 310.37 0 0 Potri.010G195200.1.v4.1 1773 1510.68 261 10.8624 Potri.012G127500.1.v4.1 977 714.725 161 14.1627 ==> SRR7170693.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 930 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR7170693 completed mapping pipeline successfully