Starting /dee2/code/volunteer_pipeline.sh SRR7170694 current disk space = 3088859910144 free memory = 1415300252 SRR7170694 SRAfilesize ca9ccee7b2b18e03fb4e9ba881ca2986 SRR7170694.sra SRR7170694.sra file validated SRR7170694 is paired end SRR7170694 is conventional basespace SRR7170694 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170694_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.72875 18.0 18.0 18.0 18.0 32.0 2 26.71025 27.0 25.0 29.0 18.0 31.0 3 28.05475 29.0 27.0 31.0 18.0 33.0 4 30.80875 31.0 30.0 33.0 28.0 33.0 5 31.827 33.0 32.0 33.0 31.0 33.0 6 35.759 37.0 36.0 38.0 31.0 38.0 7 36.6205 38.0 37.0 38.0 34.0 38.0 8 37.16175 38.0 38.0 38.0 36.0 38.0 9 37.4125 38.0 38.0 38.0 37.0 38.0 10-14 37.40625 38.0 38.0 38.0 37.0 38.0 15-19 37.4583 38.0 38.0 38.0 37.0 38.0 20-24 37.5533 38.0 38.0 38.0 37.8 38.0 25-29 37.56365 38.0 38.0 38.0 38.0 38.0 30-34 37.525 38.0 38.0 38.0 38.0 38.0 35-39 37.5131 38.0 38.0 38.0 37.8 38.0 40-44 37.42985 38.0 38.0 38.0 37.4 38.0 45-49 37.39489999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.2671 38.0 38.0 38.0 36.8 38.0 55-59 37.1483 38.0 38.0 38.0 36.2 38.0 60-64 37.105 38.0 38.0 38.0 36.0 38.0 65-69 37.06045 38.0 38.0 38.0 36.0 38.0 70-74 36.97090000000001 38.0 38.0 38.0 35.8 38.0 75-79 36.69304999999999 38.0 38.0 38.0 34.8 38.0 80-84 36.665800000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.54265 38.0 38.0 38.0 34.4 38.0 90-94 36.451100000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.3134 38.0 37.6 38.0 34.0 38.0 100-104 36.11735 38.0 37.4 38.0 33.6 38.0 105-109 36.023199999999996 38.0 37.0 38.0 33.2 38.0 110-114 35.857549999999996 38.0 37.0 38.0 32.4 38.0 115-119 35.54545 38.0 36.2 38.0 31.0 38.0 120-124 35.2781 38.0 36.0 38.0 29.2 38.0 125-129 35.157849999999996 38.0 35.8 38.0 28.6 38.0 130-134 34.88095 38.0 35.0 38.0 27.8 38.0 135-139 34.6456 38.0 35.0 38.0 27.6 38.0 140-144 34.13805000000001 38.0 34.6 38.0 24.4 38.0 145-149 33.369350000000004 38.0 33.0 38.0 22.2 38.0 150-151 28.799999999999997 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 2.0 15 3.0 16 2.0 17 2.0 18 4.0 19 21.0 20 4.0 21 4.0 22 3.0 23 8.0 24 9.0 25 14.0 26 12.0 27 17.0 28 24.0 29 27.0 30 30.0 31 48.0 32 84.0 33 121.0 34 181.0 35 374.0 36 1087.0 37 1915.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.200101574403252 32.32605383443372 12.798374809547994 30.675469781615032 2 18.625 26.35 38.800000000000004 16.225 3 16.650000000000002 30.625000000000004 29.475 23.25 4 20.150000000000002 37.425000000000004 23.200000000000003 19.225 5 20.480721081622434 38.43264897346019 23.73560340510766 17.351026539809713 6 15.575 35.525 26.075 22.825 7 12.225 20.45 46.125 21.2 8 17.849999999999998 21.5 28.050000000000004 32.6 9 17.224999999999998 23.225 30.375000000000004 29.175 10-14 18.93 30.805 25.97 24.295 15-19 18.75 29.715000000000003 27.21 24.325 20-24 19.685 29.54 27.27 23.505000000000003 25-29 19.595000000000002 29.165000000000003 27.235 24.005000000000003 30-34 19.634999999999998 29.360000000000003 27.12 23.885 35-39 19.689999999999998 28.93 27.500000000000004 23.880000000000003 40-44 19.74 29.535 27.229999999999997 23.494999999999997 45-49 19.564999999999998 29.095 27.04 24.3 50-54 19.86 29.270000000000003 26.965 23.905 55-59 19.470000000000002 28.53 27.555000000000003 24.445 60-64 20.09 28.46 27.58 23.87 65-69 19.955000000000002 29.465000000000003 27.21 23.369999999999997 70-74 19.655 29.65 27.215 23.48 75-79 19.744999999999997 29.085 27.095000000000002 24.075 80-84 19.869999999999997 29.175 26.779999999999998 24.175 85-89 20.635 29.325000000000003 26.71 23.330000000000002 90-94 19.375 29.065 27.694999999999997 23.865 95-99 20.325 28.27 27.474999999999998 23.93 100-104 20.07 28.025 27.595 24.310000000000002 105-109 20.415 28.235 27.08 24.27 110-114 20.125 28.165000000000003 27.855 23.855 115-119 21.029999999999998 28.244999999999997 27.310000000000002 23.415 120-124 21.099999999999998 28.28 26.755000000000003 23.865 125-129 20.405 28.52 27.025 24.05 130-134 20.46 28.78 26.445 24.315 135-139 20.335 28.189999999999998 27.200000000000003 24.275 140-144 20.28 28.084999999999997 27.089999999999996 24.545 145-149 19.865 28.375 27.855 23.905 150-151 20.91511438929866 28.19102387798475 26.62832854106763 24.265533191648956 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 2.0 18 1.0 19 0.5 20 0.5 21 1.5 22 3.0 23 4.0 24 5.5 25 7.5 26 8.0 27 10.0 28 17.5 29 26.5 30 31.5 31 37.5 32 49.5 33 62.5 34 77.5 35 103.5 36 117.5 37 129.5 38 156.5 39 172.5 40 178.5 41 191.0 42 222.5 43 236.0 44 223.0 45 218.5 46 223.0 47 216.0 48 210.0 49 207.5 50 176.5 51 138.0 52 118.0 53 93.0 54 77.0 55 64.5 56 50.5 57 47.5 58 28.5 59 13.0 60 12.5 61 9.5 62 5.5 63 3.0 64 2.0 65 2.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.82499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.56887298747765 96.42500000000001 2 1.098901098901099 2.15 3 0.20444671607462306 0.6 4 0.051111679018655765 0.2 5 0.025555839509327882 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025555839509327882 0.2 9 0.0 0.0 >10 0.025555839509327882 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 12 0.3 TruSeq Adapter, Index 13 (97% over 38bp) AATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 8 0.2 TruSeq Adapter, Index 27 (97% over 37bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.42500000000000004 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.85 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.7999999999999998 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.9124999999999996 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 4.0875 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.824999999999999 0.0 0.0 0.0 0.0 132-133 5.2625 0.0 0.0 0.0 0.0 134-135 5.55 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCGGA 10 0.006577216 146.82278 1 >>END_MODULE SRR7170694 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170694_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8065 33.0 33.0 34.0 32.0 34.0 2 32.906 34.0 33.0 34.0 32.0 34.0 3 32.90675 34.0 33.0 34.0 32.0 34.0 4 32.85325 34.0 33.0 34.0 32.0 34.0 5 32.87475 34.0 33.0 34.0 32.0 34.0 6 37.0065 38.0 38.0 38.0 37.0 38.0 7 37.1125 38.0 38.0 38.0 37.0 38.0 8 37.1125 38.0 38.0 38.0 37.0 38.0 9 37.10775 38.0 38.0 38.0 37.0 38.0 10-14 37.13785 38.0 38.0 38.0 37.0 38.0 15-19 37.10655 38.0 38.0 38.0 37.0 38.0 20-24 37.065099999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.058499999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.01325 38.0 38.0 38.0 36.6 38.0 35-39 37.021049999999995 38.0 38.0 38.0 36.8 38.0 40-44 36.97195 38.0 38.0 38.0 36.6 38.0 45-49 36.970150000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.88715 38.0 38.0 38.0 36.0 38.0 55-59 36.78995 38.0 38.0 38.0 36.0 38.0 60-64 36.80105 38.0 38.0 38.0 36.0 38.0 65-69 36.78215 38.0 38.0 38.0 35.8 38.0 70-74 36.75815 38.0 38.0 38.0 35.8 38.0 75-79 36.738600000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.45885 38.0 38.0 38.0 35.0 38.0 85-89 36.4339 38.0 38.0 38.0 34.8 38.0 90-94 36.33 38.0 38.0 38.0 34.4 38.0 95-99 36.2487 38.0 38.0 38.0 34.0 38.0 100-104 36.0267 38.0 38.0 38.0 34.0 38.0 105-109 35.9533 38.0 38.0 38.0 33.6 38.0 110-114 35.771 38.0 37.6 38.0 32.6 38.0 115-119 35.440200000000004 38.0 37.0 38.0 31.0 38.0 120-124 35.418549999999996 38.0 36.8 38.0 31.0 38.0 125-129 35.06365 38.0 36.0 38.0 29.2 38.0 130-134 34.6592 38.0 35.6 38.0 27.6 38.0 135-139 34.277550000000005 38.0 34.0 38.0 26.4 38.0 140-144 33.82395 38.0 33.2 38.0 23.0 38.0 145-149 32.97685 38.0 33.0 38.0 17.6 38.0 150-151 27.799999999999997 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 2.0 5 0.0 6 2.0 7 5.0 8 2.0 9 1.0 10 0.0 11 1.0 12 3.0 13 4.0 14 5.0 15 5.0 16 6.0 17 5.0 18 4.0 19 9.0 20 12.0 21 9.0 22 3.0 23 6.0 24 16.0 25 17.0 26 9.0 27 22.0 28 27.0 29 37.0 30 33.0 31 56.0 32 62.0 33 95.0 34 151.0 35 264.0 36 647.0 37 2467.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.375 15.299999999999999 15.825 31.5 2 23.400000000000002 22.775000000000002 36.425000000000004 17.4 3 20.275000000000002 25.650000000000002 33.300000000000004 20.775 4 24.725 34.275 19.875 21.125 5 24.025 37.974999999999994 20.525 17.474999999999998 6 19.875 37.775 22.45 19.900000000000002 7 16.725 16.2 45.324999999999996 21.75 8 19.425 23.474999999999998 26.450000000000003 30.65 9 23.1 23.575 29.4 23.925 10-14 22.994999999999997 28.335 26.834999999999997 21.834999999999997 15-19 23.31 27.005000000000003 28.34 21.345 20-24 23.305 27.860000000000003 28.044999999999998 20.79 25-29 23.72 28.175 27.400000000000002 20.705000000000002 30-34 23.465 28.13 28.04 20.365 35-39 22.93 27.925 28.01 21.135 40-44 23.74 27.525 27.67 21.065 45-49 23.799999999999997 27.615000000000002 27.855 20.73 50-54 23.435 27.034999999999997 28.470000000000002 21.060000000000002 55-59 23.71 27.515 27.445000000000004 21.33 60-64 22.975 27.74 27.875 21.41 65-69 23.585 27.26 28.199999999999996 20.955 70-74 23.635 28.294999999999998 26.810000000000002 21.26 75-79 23.735 28.155 27.715 20.395 80-84 23.93 28.975 26.375 20.72 85-89 23.965 28.110000000000003 27.139999999999997 20.785 90-94 24.09 27.715 27.505000000000003 20.69 95-99 24.07 27.655 27.465 20.810000000000002 100-104 23.955000000000002 27.615000000000002 27.584999999999997 20.845 105-109 23.815 28.01 27.765 20.41 110-114 23.685000000000002 27.565 27.85 20.9 115-119 24.285 27.900000000000002 27.345000000000002 20.47 120-124 24.355 27.750000000000004 27.465 20.43 125-129 24.745 27.36 28.15 19.744999999999997 130-134 24.755 27.875 27.355 20.015 135-139 25.05 27.435 27.500000000000004 20.015 140-144 24.39 27.985 27.785 19.84 145-149 25.490000000000002 26.979999999999997 27.57 19.96 150-151 25.412499999999998 27.0125 28.225 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.0 15 2.0 16 1.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.5 23 2.5 24 3.0 25 3.5 26 5.5 27 8.0 28 10.0 29 13.0 30 13.5 31 20.5 32 27.5 33 36.0 34 43.0 35 58.0 36 87.5 37 103.5 38 130.5 39 151.0 40 176.0 41 208.5 42 223.5 43 254.0 44 268.5 45 259.0 46 244.0 47 211.5 48 206.0 49 209.0 50 177.0 51 157.5 52 151.5 53 121.5 54 98.5 55 85.5 56 63.5 57 49.0 58 35.0 59 24.5 60 15.5 61 10.0 62 8.0 63 7.0 64 6.0 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.95 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2723053120165 95.275 2 1.1346054667354306 2.1999999999999997 3 0.36101083032490977 1.05 4 0.1031459515214028 0.4 5 0.0257864878803507 0.125 6 0.0515729757607014 0.3 7 0.0257864878803507 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0257864878803507 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 19 0.475 Illumina Single End PCR Primer 1 (96% over 32bp) CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 7 0.17500000000000002 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.8250000000000002 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.2874999999999996 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.7750000000000004 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.625 0.0 0.0 0.0 0.0 136-137 5.887499999999999 0.0 0.0 0.0 0.0 138-139 6.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACTT 10 0.006830828 145.0 7 AATTATG 10 0.006830828 145.0 4 ATTGAAC 10 0.006830828 145.0 6 TCCAAGT 10 0.006830828 145.0 9 GCCAACT 10 0.006830828 145.0 6 TACTCCA 10 0.006830828 145.0 6 ATTCATA 10 0.006830828 145.0 1 TCATACT 10 0.006830828 145.0 3 AAAAAAA 155 2.875396E-4 9.354838 70-74 >>END_MODULE Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632665 spots for SRR7170694.sra Written 632665 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra Read 632664 spots for SRR7170694.sra Written 632664 spots for SRR7170694.sra SRR ids: ['SRR7170694.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_spb3_sjs SRR7170694.sra spots: 12653281 blocks: [[1, 632664], [632665, 1265328], [1265329, 1897992], [1897993, 2530656], [2530657, 3163320], [3163321, 3795984], [3795985, 4428648], [4428649, 5061312], [5061313, 5693976], [5693977, 6326640], [6326641, 6959304], [6959305, 7591968], [7591969, 8224632], [8224633, 8857296], [8857297, 9489960], [9489961, 10122624], [10122625, 10755288], [10755289, 11387952], [11387953, 12020616], [12020617, 12653281]] SRR7170694 file size 4266081 SRR7170694 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170694 SRR7170694_1.fastq SRR7170694_2.fastq Input file: SRR7170694_1.fastq Paired file: SRR7170694_2.fastq trimmed: SRR7170694-trimmed-pair1.fastq, SRR7170694-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:44:35 2025 >> started Thu Feb 13 16:44:57 2025 >> done (21.929s) 12653281 read pairs processed; of these: 8521 ( 0.07%) short read pairs filtered out after trimming by size control 76907 ( 0.61%) empty read pairs filtered out after trimming by size control 12567853 (99.32%) read pairs available; of these: 6339544 (50.44%) trimmed read pairs available after processing 6228309 (49.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 5 0.00% 21 2 0.00% 22 9 0.00% 23 9 0.00% 24 9 0.00% 25 4 0.00% 26 6 0.00% 27 11 0.00% 28 5 0.00% 29 14 0.00% 30 10 0.00% 31 104 0.00% 32 15 0.00% 33 17 0.00% 34 8 0.00% 35 19 0.00% 36 12 0.00% 37 33 0.00% 38 26 0.00% 39 22 0.00% 40 24 0.00% 41 44 0.00% 42 33 0.00% 43 34 0.00% 44 42 0.00% 45 47 0.00% 46 57 0.00% 47 49 0.00% 48 80 0.00% 49 97 0.00% 50 82 0.00% 51 110 0.00% 52 113 0.00% 53 127 0.00% 54 117 0.00% 55 140 0.00% 56 163 0.00% 57 189 0.00% 58 181 0.00% 59 188 0.00% 60 231 0.00% 61 288 0.00% 62 298 0.00% 63 425 0.00% 64 385 0.00% 65 496 0.00% 66 440 0.00% 67 532 0.00% 68 569 0.00% 69 635 0.01% 70 733 0.01% 71 853 0.01% 72 1099 0.01% 73 1157 0.01% 74 1386 0.01% 75 1707 0.01% 76 3142 0.03% 77 3330 0.03% 78 2106 0.02% 79 2187 0.02% 80 2253 0.02% 81 2516 0.02% 82 2905 0.02% 83 3300 0.03% 84 4162 0.03% 85 4507 0.04% 86 4698 0.04% 87 4959 0.04% 88 5255 0.04% 89 5546 0.04% 90 5988 0.05% 91 6538 0.05% 92 6930 0.06% 93 7590 0.06% 94 7846 0.06% 95 8513 0.07% 96 8870 0.07% 97 9274 0.07% 98 9596 0.08% 99 9814 0.08% 100 10271 0.08% 101 10994 0.09% 102 11650 0.09% 103 12552 0.10% 104 13154 0.10% 105 13921 0.11% 106 14378 0.11% 107 14491 0.12% 108 14891 0.12% 109 15271 0.12% 110 15952 0.13% 111 16430 0.13% 112 17352 0.14% 113 18470 0.15% 114 19413 0.15% 115 19580 0.16% 116 20117 0.16% 117 20555 0.16% 118 21144 0.17% 119 21493 0.17% 120 22268 0.18% 121 22895 0.18% 122 23867 0.19% 123 25106 0.20% 124 26108 0.21% 125 26722 0.21% 126 28200 0.22% 127 28658 0.23% 128 30033 0.24% 129 30586 0.24% 130 31915 0.25% 131 33329 0.27% 132 34781 0.28% 133 36947 0.29% 134 39119 0.31% 135 41180 0.33% 136 44668 0.36% 137 47584 0.38% 138 50680 0.40% 139 54930 0.44% 140 59883 0.48% 141 66595 0.53% 142 74266 0.59% 143 86957 0.69% 144 101988 0.81% 145 124355 0.99% 146 157709 1.25% 147 216521 1.72% 148 340816 2.71% 149 694972 5.53% 150 3268501 26.01% 151 6228309 49.56% 12567853 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=13 prefix-density=0.75 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=27.50 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=17 prefix-density=0.58 prefix-fanout=2.1 sequence=AATGACATTACTTCCATTGCAAGCAATGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=45.93 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT SRR7170694 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:45:53 Started mapping on | Feb 13 16:45:53 Finished on | Feb 13 16:48:27 Mapping speed, Million of reads per hour | 293.79 Number of input reads | 12567853 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11628984 Uniquely mapped reads % | 92.53% Average mapped length | 294.17 Number of splices: Total | 10855898 Number of splices: Annotated (sjdb) | 10612947 Number of splices: GT/AG | 10645842 Number of splices: GC/AG | 168221 Number of splices: AT/AC | 8834 Number of splices: Non-canonical | 33001 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332270 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 24269 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.57% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 615843 615843 615843 N_multimapping 332270 332270 332270 N_noFeature 351179 11294970 413452 N_ambiguous 354301 801 82170 UnstrandedReadsAssigned:10923504 PositiveStrandReadsAssigned:333213 NegativeStrandReadsAssigned:11133362 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170694 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170694-trimmed-pair1.fastq SRR7170694-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,567,853 reads, 11,029,674 reads pseudoaligned [quant] estimated average fragment length: 257.271 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR7170694.ke.tsv 34699 SRR7170694.se.tsv 87100 total ==> SRR7170694.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.73 370 12.4907 Potri.005G024800.1.v4.1 1035 778.729 275 21.0024 Potri.004G059700.1.v4.1 961 704.792 8 0.675074 Potri.007G009000.2.v4.1 1416 1159.73 0 0 Potri.003G141000.2.v4.1 2943 2686.73 498.393 11.0324 Potri.016G087400.1.v4.1 270 77.1848 675.655 520.614 Potri.015G069301.1.v4.1 564 314.04 0 0 Potri.010G195200.1.v4.1 1773 1516.73 8 0.313693 Potri.012G127500.1.v4.1 977 720.769 121 9.98416 ==> SRR7170694.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 750 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 365 Potri.001G212900.v4.1 162 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170694 completed mapping pipeline successfully