Starting /dee2/code/volunteer_pipeline.sh SRR7170695 current disk space = 3088788336640 free memory = 1450042468 SRR7170695 SRAfilesize 6a2de35fc4575a04339f96fc3c31a31b SRR7170695.sra SRR7170695.sra file validated SRR7170695 is paired end SRR7170695 is conventional basespace SRR7170695 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170695_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.33875 18.0 18.0 31.0 18.0 33.0 2 29.27225 30.0 27.0 33.0 25.0 33.0 3 31.29425 33.0 31.0 33.0 28.0 33.0 4 32.38925 33.0 33.0 33.0 31.0 34.0 5 32.8195 33.0 33.0 34.0 32.0 34.0 6 36.92425 38.0 37.0 38.0 35.0 38.0 7 37.2705 38.0 38.0 38.0 36.0 38.0 8 37.39225 38.0 38.0 38.0 37.0 38.0 9 37.4485 38.0 38.0 38.0 37.0 38.0 10-14 37.420100000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.432599999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.5749 38.0 38.0 38.0 37.8 38.0 25-29 37.51925 38.0 38.0 38.0 38.0 38.0 30-34 37.502599999999994 38.0 38.0 38.0 38.0 38.0 35-39 37.50785 38.0 38.0 38.0 37.6 38.0 40-44 37.43795 38.0 38.0 38.0 37.0 38.0 45-49 37.4262 38.0 38.0 38.0 37.0 38.0 50-54 37.31464999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.28190000000001 38.0 38.0 38.0 37.0 38.0 60-64 37.23355 38.0 38.0 38.0 36.6 38.0 65-69 37.208999999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.1108 38.0 38.0 38.0 36.0 38.0 75-79 37.0019 38.0 38.0 38.0 36.0 38.0 80-84 36.972249999999995 38.0 38.0 38.0 35.8 38.0 85-89 36.959500000000006 38.0 38.0 38.0 35.8 38.0 90-94 36.77329999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.6428 38.0 38.0 38.0 34.2 38.0 100-104 36.46505 38.0 38.0 38.0 34.0 38.0 105-109 36.45195 38.0 38.0 38.0 34.0 38.0 110-114 36.2429 38.0 37.2 38.0 33.8 38.0 115-119 35.89104999999999 38.0 37.0 38.0 32.0 38.0 120-124 35.8717 38.0 37.0 38.0 32.2 38.0 125-129 35.6773 38.0 36.4 38.0 31.6 38.0 130-134 35.492549999999994 38.0 36.0 38.0 31.0 38.0 135-139 35.29835 38.0 36.0 38.0 30.6 38.0 140-144 34.60745 38.0 34.2 38.0 27.6 38.0 145-149 33.8635 38.0 33.6 38.0 23.8 38.0 150-151 29.91825 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 2.0 16 1.0 17 0.0 18 1.0 19 3.0 20 1.0 21 7.0 22 6.0 23 5.0 24 4.0 25 8.0 26 16.0 27 16.0 28 20.0 29 26.0 30 38.0 31 57.0 32 73.0 33 98.0 34 151.0 35 279.0 36 781.0 37 2403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.57985757884028 21.05798575788403 12.512716174974567 30.849440488301116 2 20.325 24.9 37.775 17.0 3 16.525000000000002 32.475 27.700000000000003 23.3 4 20.825 37.5 21.875 19.8 5 18.521303258145362 37.142857142857146 24.210526315789473 20.125313283208023 6 17.0 35.4 25.650000000000002 21.95 7 12.625 19.725 46.85 20.8 8 17.775 20.849999999999998 27.975 33.4 9 16.5 23.175 30.275000000000002 30.049999999999997 10-14 19.675 29.38 26.669999999999998 24.275 15-19 19.49 27.845 28.265 24.4 20-24 19.93 28.244999999999997 28.22 23.605 25-29 20.21 28.384999999999998 27.87 23.535 30-34 19.650000000000002 28.715000000000003 27.71 23.925 35-39 20.035 28.815 27.884999999999998 23.265 40-44 19.605 28.92 27.92 23.555 45-49 19.814999999999998 28.525 27.639999999999997 24.02 50-54 19.735 28.465 27.905 23.895 55-59 20.145 28.535 27.825 23.494999999999997 60-64 19.405 28.395 28.144999999999996 24.055 65-69 20.105 28.025 27.93 23.94 70-74 19.935 28.084999999999997 27.975 24.005000000000003 75-79 20.215 28.125 27.944999999999997 23.715 80-84 20.3 27.72 27.445000000000004 24.535 85-89 20.28 28.46 27.839999999999996 23.419999999999998 90-94 19.919999999999998 28.494999999999997 28.075 23.51 95-99 19.805 28.52 27.61 24.065 100-104 20.435 27.825 27.665 24.075 105-109 20.41 28.475 27.195000000000004 23.919999999999998 110-114 20.544999999999998 28.58 27.32 23.555 115-119 20.39 28.29 27.77 23.549999999999997 120-124 20.810000000000002 28.165000000000003 27.639999999999997 23.385 125-129 20.69 28.1 27.150000000000002 24.060000000000002 130-134 20.630000000000003 27.815 27.944999999999997 23.61 135-139 20.905 28.28 27.075 23.74 140-144 20.47 27.665 27.3 24.565 145-149 21.02 28.405 27.139999999999997 23.435 150-151 21.676047529706068 29.155722326454033 26.42901813633521 22.73921200750469 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.0 21 2.0 22 2.5 23 3.5 24 4.5 25 5.5 26 6.0 27 6.5 28 10.5 29 19.0 30 26.5 31 31.0 32 37.5 33 50.5 34 68.0 35 81.0 36 101.0 37 121.5 38 143.0 39 171.0 40 188.5 41 211.5 42 233.5 43 246.0 44 255.5 45 255.0 46 252.0 47 237.0 48 214.0 49 199.0 50 176.5 51 143.5 52 115.0 53 92.5 54 76.5 55 66.0 56 45.0 57 26.5 58 17.5 59 13.5 60 12.0 61 9.0 62 7.0 63 4.0 64 3.0 65 2.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98836621143147 97.85000000000001 2 0.8851795649974709 1.7500000000000002 3 0.10116337885685382 0.3 4 0.025290844714213456 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 1.9125 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.45 0.0 0.0 0.0 0.0 128-129 2.6625 0.0 0.0 0.0 0.0 130-131 2.9749999999999996 0.0 0.0 0.0 0.0 132-133 3.15 0.0 0.0 0.0 0.0 134-135 3.3499999999999996 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 3.8499999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTCA 10 0.0065959026 146.68355 145 TTGAAAC 10 0.0068519996 144.85 6 >>END_MODULE SRR7170695 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170695_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64475 33.0 33.0 34.0 32.0 34.0 2 32.8145 33.0 33.0 34.0 32.0 34.0 3 32.85375 34.0 33.0 34.0 32.0 34.0 4 32.741 34.0 33.0 34.0 32.0 34.0 5 32.765 34.0 33.0 34.0 32.0 34.0 6 37.02025 38.0 38.0 38.0 36.0 38.0 7 36.95225 38.0 38.0 38.0 36.0 38.0 8 37.01525 38.0 38.0 38.0 36.0 38.0 9 36.97825 38.0 38.0 38.0 36.0 38.0 10-14 36.970600000000005 38.0 38.0 38.0 36.2 38.0 15-19 36.9058 38.0 38.0 38.0 36.2 38.0 20-24 36.90069999999999 38.0 38.0 38.0 36.2 38.0 25-29 36.864549999999994 38.0 38.0 38.0 36.2 38.0 30-34 36.8119 38.0 38.0 38.0 36.0 38.0 35-39 36.86845 38.0 38.0 38.0 36.6 38.0 40-44 36.922399999999996 38.0 38.0 38.0 36.6 38.0 45-49 36.8583 38.0 38.0 38.0 36.4 38.0 50-54 36.742599999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.7534 38.0 38.0 38.0 36.0 38.0 60-64 36.735 38.0 38.0 38.0 36.0 38.0 65-69 36.6527 38.0 38.0 38.0 36.0 38.0 70-74 36.6464 38.0 38.0 38.0 36.0 38.0 75-79 36.539699999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.471650000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.384299999999996 38.0 38.0 38.0 34.6 38.0 90-94 36.35755 38.0 38.0 38.0 34.4 38.0 95-99 36.2984 38.0 38.0 38.0 34.4 38.0 100-104 36.04475 38.0 38.0 38.0 33.8 38.0 105-109 36.04545 38.0 38.0 38.0 34.0 38.0 110-114 35.84225 38.0 37.8 38.0 33.0 38.0 115-119 35.75320000000001 38.0 37.6 38.0 33.0 38.0 120-124 35.66325 38.0 37.0 38.0 32.2 38.0 125-129 35.232749999999996 38.0 36.0 38.0 30.0 38.0 130-134 34.90465 38.0 36.0 38.0 28.6 38.0 135-139 34.617599999999996 38.0 36.0 38.0 27.4 38.0 140-144 33.971199999999996 38.0 33.8 38.0 24.0 38.0 145-149 33.38035 38.0 33.6 38.0 19.6 38.0 150-151 28.149375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 7.0 4 9.0 5 3.0 6 2.0 7 4.0 8 1.0 9 5.0 10 3.0 11 6.0 12 3.0 13 2.0 14 2.0 15 2.0 16 3.0 17 2.0 18 3.0 19 5.0 20 4.0 21 7.0 22 15.0 23 11.0 24 15.0 25 14.0 26 19.0 27 23.0 28 20.0 29 32.0 30 33.0 31 48.0 32 57.0 33 91.0 34 125.0 35 214.0 36 614.0 37 2587.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.35 16.35 15.275 29.025000000000002 2 23.974999999999998 23.150000000000002 34.675 18.2 3 20.549999999999997 25.825 32.1 21.525 4 22.475 36.875 21.0 19.650000000000002 5 23.5 37.75 21.05 17.7 6 17.424999999999997 36.9 25.45 20.225 7 16.325 16.05 44.775 22.85 8 19.75 22.75 28.025 29.475 9 21.224999999999998 23.474999999999998 29.175 26.125 10-14 21.995 28.845 27.105 22.055 15-19 22.805 27.88 28.34 20.974999999999998 20-24 22.36 27.85 28.455000000000002 21.335 25-29 22.36 27.889999999999997 28.355000000000004 21.395 30-34 22.56 27.694999999999997 28.605000000000004 21.14 35-39 22.264999999999997 27.779999999999998 27.944999999999997 22.009999999999998 40-44 22.46 27.87 28.595 21.075 45-49 23.345 27.765 27.839999999999996 21.05 50-54 22.445 28.155 28.349999999999998 21.05 55-59 23.215 27.485 28.095 21.205 60-64 22.81 27.91 27.715 21.565 65-69 23.044999999999998 28.37 27.525 21.060000000000002 70-74 22.939999999999998 27.74 28.13 21.19 75-79 23.455000000000002 28.305000000000003 27.46 20.78 80-84 23.84 28.139999999999997 27.169999999999998 20.849999999999998 85-89 23.955000000000002 28.23 27.16 20.655 90-94 23.715 28.37 27.54 20.375 95-99 23.630000000000003 27.994999999999997 28.044999999999998 20.330000000000002 100-104 23.669999999999998 27.575 28.04 20.715 105-109 23.74 28.000000000000004 27.495000000000005 20.765 110-114 23.625 28.15 27.43 20.794999999999998 115-119 23.669999999999998 27.495000000000005 27.905 20.93 120-124 23.794999999999998 27.405 27.565 21.235 125-129 23.9 27.605 27.875 20.62 130-134 24.355 27.105 27.845 20.695 135-139 23.465 28.345 27.32 20.87 140-144 24.255 27.51 27.735 20.5 145-149 24.88 27.815 26.790000000000003 20.515 150-151 24.293573393348336 28.132033008252062 27.419354838709676 20.155038759689923 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.5 22 1.5 23 1.0 24 4.0 25 5.5 26 4.0 27 5.0 28 9.0 29 14.0 30 18.0 31 18.5 32 27.5 33 43.5 34 52.0 35 68.5 36 84.0 37 101.0 38 137.0 39 162.5 40 184.5 41 211.5 42 246.0 43 270.0 44 266.5 45 273.5 46 265.5 47 236.5 48 233.0 49 209.5 50 173.5 51 143.5 52 108.5 53 86.0 54 76.0 55 69.5 56 52.5 57 39.5 58 29.5 59 21.0 60 14.0 61 10.0 62 7.0 63 2.5 64 0.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95965490992134 97.5 2 0.786602385181426 1.55 3 0.1522456229383405 0.44999999999999996 4 0.050748540979446845 0.2 5 0.025374270489723422 0.125 6 0.0 0.0 7 0.025374270489723422 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 7 0.17500000000000002 No Hit CTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.7875000000000001 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3250000000000002 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.85 0.0 0.0 0.0 0.0 122-123 2.1 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.875 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.25 0.0 0.0 0.0 0.0 136-137 3.4375 0.0 0.0 0.0 0.0 138-139 3.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAATTCG 10 0.006830828 145.0 4 TCTGCTC 10 0.006830828 145.0 7 >>END_MODULE Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933144 spots for SRR7170695.sra Written 933144 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra Read 933130 spots for SRR7170695.sra Written 933130 spots for SRR7170695.sra SRR ids: ['SRR7170695.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_inmxjq_p SRR7170695.sra spots: 18662614 blocks: [[1, 933130], [933131, 1866260], [1866261, 2799390], [2799391, 3732520], [3732521, 4665650], [4665651, 5598780], [5598781, 6531910], [6531911, 7465040], [7465041, 8398170], [8398171, 9331300], [9331301, 10264430], [10264431, 11197560], [11197561, 12130690], [12130691, 13063820], [13063821, 13996950], [13996951, 14930080], [14930081, 15863210], [15863211, 16796340], [16796341, 17729470], [17729471, 18662614]] SRR7170695 file size 6302447 SRR7170695 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170695 SRR7170695_1.fastq SRR7170695_2.fastq Input file: SRR7170695_1.fastq Paired file: SRR7170695_2.fastq trimmed: SRR7170695-trimmed-pair1.fastq, SRR7170695-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:01:10 2025 >> started Thu Feb 13 17:01:30 2025 >> done (19.745s) 18662614 read pairs processed; of these: 22145 ( 0.12%) short read pairs filtered out after trimming by size control 20940 ( 0.11%) empty read pairs filtered out after trimming by size control 18619529 (99.77%) read pairs available; of these: 8792327 (47.22%) trimmed read pairs available after processing 9827202 (52.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 6 0.00% 21 9 0.00% 22 6 0.00% 23 9 0.00% 24 9 0.00% 25 9 0.00% 26 16 0.00% 27 6 0.00% 28 6 0.00% 29 11 0.00% 30 17 0.00% 31 12 0.00% 32 7 0.00% 33 14 0.00% 34 12 0.00% 35 10 0.00% 36 18 0.00% 37 21 0.00% 38 32 0.00% 39 18 0.00% 40 34 0.00% 41 38 0.00% 42 33 0.00% 43 30 0.00% 44 42 0.00% 45 33 0.00% 46 65 0.00% 47 52 0.00% 48 80 0.00% 49 85 0.00% 50 92 0.00% 51 89 0.00% 52 93 0.00% 53 107 0.00% 54 131 0.00% 55 106 0.00% 56 135 0.00% 57 158 0.00% 58 183 0.00% 59 220 0.00% 60 240 0.00% 61 290 0.00% 62 323 0.00% 63 385 0.00% 64 399 0.00% 65 444 0.00% 66 467 0.00% 67 490 0.00% 68 584 0.00% 69 666 0.00% 70 695 0.00% 71 903 0.00% 72 1011 0.01% 73 1173 0.01% 74 1297 0.01% 75 1580 0.01% 76 2406 0.01% 77 2451 0.01% 78 1957 0.01% 79 2075 0.01% 80 2254 0.01% 81 2515 0.01% 82 3013 0.02% 83 3371 0.02% 84 4754 0.03% 85 5579 0.03% 86 5643 0.03% 87 6062 0.03% 88 6377 0.03% 89 6587 0.04% 90 7022 0.04% 91 7440 0.04% 92 8350 0.04% 93 8675 0.05% 94 9293 0.05% 95 9650 0.05% 96 10139 0.05% 97 10629 0.06% 98 10802 0.06% 99 11194 0.06% 100 11760 0.06% 101 12498 0.07% 102 13085 0.07% 103 14356 0.08% 104 14836 0.08% 105 15530 0.08% 106 16140 0.09% 107 16544 0.09% 108 16837 0.09% 109 17276 0.09% 110 18116 0.10% 111 19012 0.10% 112 20212 0.11% 113 20940 0.11% 114 21902 0.12% 115 22506 0.12% 116 23222 0.12% 117 24211 0.13% 118 24419 0.13% 119 25068 0.13% 120 25924 0.14% 121 26852 0.14% 122 28170 0.15% 123 30155 0.16% 124 31256 0.17% 125 32605 0.18% 126 33990 0.18% 127 34728 0.19% 128 36308 0.19% 129 37614 0.20% 130 38981 0.21% 131 40688 0.22% 132 43328 0.23% 133 45445 0.24% 134 48638 0.26% 135 51961 0.28% 136 55129 0.30% 137 59139 0.32% 138 63683 0.34% 139 69416 0.37% 140 77280 0.42% 141 86189 0.46% 142 98776 0.53% 143 114492 0.61% 144 133229 0.72% 145 163442 0.88% 146 211765 1.14% 147 295773 1.59% 148 464858 2.50% 149 931734 5.00% 150 4851053 26.05% 151 9827202 52.78% 18619529 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=12 prefix-density=0.75 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=12.52 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=6.0 sequence=AGCTCTCCATACTTTTAAGCAGTACTCAACTTTGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATTTGGGCAACC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=10 prefix-density=0.90 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=35.80 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.7 sequence=CTGCATTTGCTAGCTAGAAGTCACTCTACCCTTCGCATTACTTCCTCAATCAACCACTGCTGTTTGATCATGGCAGC SRR7170695 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:02:17 Started mapping on | Feb 13 17:02:17 Finished on | Feb 13 17:04:40 Mapping speed, Million of reads per hour | 468.74 Number of input reads | 18619529 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17567260 Uniquely mapped reads % | 94.35% Average mapped length | 295.31 Number of splices: Total | 17860542 Number of splices: Annotated (sjdb) | 17481896 Number of splices: GT/AG | 17515429 Number of splices: GC/AG | 289472 Number of splices: AT/AC | 10355 Number of splices: Non-canonical | 45286 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 444881 % of reads mapped to multiple loci | 2.39% Number of reads mapped to too many loci | 24833 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 631699 631699 631699 N_multimapping 444881 444881 444881 N_noFeature 621125 17224107 719001 N_ambiguous 359822 1142 113826 UnstrandedReadsAssigned:16586313 PositiveStrandReadsAssigned:342011 NegativeStrandReadsAssigned:16734433 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170695 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170695-trimmed-pair1.fastq SRR7170695-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,619,529 reads, 16,566,257 reads pseudoaligned [quant] estimated average fragment length: 279.214 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,006 rounds 52401 SRR7170695.ke.tsv 34699 SRR7170695.se.tsv 87100 total ==> SRR7170695.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.79 695 20.8667 Potri.005G024800.1.v4.1 1035 756.786 147 10.1463 Potri.004G059700.1.v4.1 961 682.867 8 0.611953 Potri.007G009000.2.v4.1 1416 1137.79 0 0 Potri.003G141000.2.v4.1 2943 2664.79 903 17.7007 Potri.016G087400.1.v4.1 270 72.9438 674 482.654 Potri.015G069301.1.v4.1 564 296.706 0 0 Potri.010G195200.1.v4.1 1773 1494.79 25 0.873625 Potri.012G127500.1.v4.1 977 698.83 102 7.62418 ==> SRR7170695.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1032 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170695 completed mapping pipeline successfully