Starting /dee2/code/volunteer_pipeline.sh SRR7170696 current disk space = 3088763551744 free memory = 1448032580 SRR7170696 SRAfilesize 4c8b7e763800d305f5479d693345ffa6 SRR7170696.sra SRR7170696.sra file validated SRR7170696 is paired end SRR7170696 is conventional basespace SRR7170696 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170696_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.2295 18.0 18.0 30.0 18.0 33.0 2 28.96775 29.0 27.0 31.0 25.0 33.0 3 30.85975 31.0 29.0 33.0 27.0 33.0 4 32.4 33.0 33.0 33.0 32.0 33.0 5 32.692 33.0 33.0 33.0 32.0 34.0 6 36.84675 38.0 37.0 38.0 35.0 38.0 7 37.13025 38.0 38.0 38.0 36.0 38.0 8 37.39525 38.0 38.0 38.0 37.0 38.0 9 37.31675 38.0 38.0 38.0 37.0 38.0 10-14 37.4231 38.0 38.0 38.0 37.0 38.0 15-19 37.48195 38.0 38.0 38.0 37.0 38.0 20-24 37.5631 38.0 38.0 38.0 37.8 38.0 25-29 37.5585 38.0 38.0 38.0 38.0 38.0 30-34 37.5553 38.0 38.0 38.0 38.0 38.0 35-39 37.47925 38.0 38.0 38.0 37.4 38.0 40-44 37.465650000000004 38.0 38.0 38.0 37.6 38.0 45-49 37.4884 38.0 38.0 38.0 37.6 38.0 50-54 37.382600000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.252250000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.2102 38.0 38.0 38.0 36.4 38.0 65-69 37.1459 38.0 38.0 38.0 36.0 38.0 70-74 37.088 38.0 38.0 38.0 36.0 38.0 75-79 37.0358 38.0 38.0 38.0 36.0 38.0 80-84 36.90955 38.0 38.0 38.0 35.6 38.0 85-89 36.86195 38.0 38.0 38.0 35.0 38.0 90-94 36.7352 38.0 38.0 38.0 35.0 38.0 95-99 36.57295 38.0 38.0 38.0 34.2 38.0 100-104 36.39775 38.0 38.0 38.0 34.0 38.0 105-109 36.290949999999995 38.0 37.0 38.0 34.0 38.0 110-114 36.11465 38.0 37.0 38.0 33.2 38.0 115-119 35.842200000000005 38.0 37.0 38.0 31.6 38.0 120-124 35.73875 38.0 36.4 38.0 31.6 38.0 125-129 35.6188 38.0 36.0 38.0 31.0 38.0 130-134 35.42305 38.0 36.0 38.0 30.4 38.0 135-139 34.9073 38.0 35.2 38.0 28.6 38.0 140-144 34.24679999999999 38.0 33.8 38.0 25.4 38.0 145-149 33.594750000000005 38.0 33.0 38.0 23.0 38.0 150-151 29.209625 35.5 24.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 4.0 19 4.0 20 2.0 21 5.0 22 4.0 23 3.0 24 9.0 25 5.0 26 12.0 27 13.0 28 17.0 29 30.0 30 46.0 31 49.0 32 75.0 33 120.0 34 188.0 35 315.0 36 907.0 37 2187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.01666239425788 22.301973852858243 11.3560625480646 31.32530120481928 2 18.65 27.35 36.075 17.925 3 16.775000000000002 31.324999999999996 28.325 23.575 4 19.900000000000002 36.4 22.7 21.0 5 20.150000000000002 37.574999999999996 22.8 19.475 6 15.4 36.125 25.924999999999997 22.55 7 12.725 19.7 46.5 21.075 8 17.875 20.549999999999997 28.925 32.65 9 17.925 20.8 30.5 30.775000000000002 10-14 19.495 29.09 26.534999999999997 24.88 15-19 20.005 28.625 27.51 23.86 20-24 19.935 28.084999999999997 28.194999999999997 23.785 25-29 20.015 28.660000000000004 27.855 23.47 30-34 20.11 28.895 27.305 23.69 35-39 19.675 29.595 27.16 23.57 40-44 20.025000000000002 29.345 27.279999999999998 23.35 45-49 20.195 28.865000000000002 27.57 23.369999999999997 50-54 20.155 28.67 27.525 23.65 55-59 19.865 28.895 27.639999999999997 23.599999999999998 60-64 19.925 28.84 27.395000000000003 23.84 65-69 20.51 27.66 28.53 23.3 70-74 19.39 28.015 27.950000000000003 24.645 75-79 19.77 28.375 28.07 23.785 80-84 19.905 28.38 27.605 24.11 85-89 20.305 28.849999999999998 27.150000000000002 23.695 90-94 20.0 28.535 27.985 23.48 95-99 20.115 29.080000000000002 27.725 23.080000000000002 100-104 20.825 28.544999999999998 27.68 22.95 105-109 20.575 28.595 27.82 23.01 110-114 20.635 28.965000000000003 27.005000000000003 23.395 115-119 20.599999999999998 28.79 27.08 23.53 120-124 20.665 28.389999999999997 27.73 23.215 125-129 20.65 28.505000000000003 28.050000000000004 22.795 130-134 20.61 28.549999999999997 27.46 23.380000000000003 135-139 20.745 28.225 27.26 23.77 140-144 21.42 28.07 26.700000000000003 23.810000000000002 145-149 20.77 28.23 27.325 23.674999999999997 150-151 20.549999999999997 29.062500000000004 26.9125 23.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 4.0 24 7.5 25 6.0 26 5.5 27 11.0 28 15.5 29 14.0 30 21.0 31 29.5 32 36.5 33 53.0 34 61.5 35 72.0 36 102.0 37 121.5 38 135.5 39 148.5 40 181.5 41 221.0 42 237.5 43 259.0 44 259.0 45 262.5 46 271.0 47 256.0 48 246.5 49 227.0 50 173.5 51 125.0 52 102.5 53 81.0 54 60.0 55 46.0 56 42.0 57 32.0 58 17.0 59 17.0 60 13.0 61 5.5 62 4.0 63 3.0 64 2.5 65 1.0 66 1.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5291005291005291 1.05 3 0.12597631645250693 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.5249999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 1.05 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.45 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.7375 0.0 0.0 0.0 0.0 120-121 1.95 0.0 0.0 0.0 0.0 122-123 2.1875 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.725 0.0 0.0 0.0 0.0 128-129 3.1500000000000004 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.825 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 5.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGATT 10 0.006832588 144.9875 2 >>END_MODULE SRR7170696 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170696_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75825 33.0 33.0 34.0 32.0 34.0 2 32.91025 33.0 33.0 34.0 32.0 34.0 3 32.94775 34.0 33.0 34.0 32.0 34.0 4 32.88825 34.0 33.0 34.0 32.0 34.0 5 32.82425 34.0 33.0 34.0 32.0 34.0 6 37.0885 38.0 38.0 38.0 37.0 38.0 7 37.13875 38.0 38.0 38.0 37.0 38.0 8 37.16525 38.0 38.0 38.0 37.0 38.0 9 37.0575 38.0 38.0 38.0 37.0 38.0 10-14 37.046499999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.05735000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.0414 38.0 38.0 38.0 36.6 38.0 25-29 36.90845 38.0 38.0 38.0 36.0 38.0 30-34 36.905199999999994 38.0 38.0 38.0 36.2 38.0 35-39 36.94845 38.0 38.0 38.0 36.4 38.0 40-44 36.9137 38.0 38.0 38.0 36.2 38.0 45-49 36.846199999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.79155000000001 38.0 38.0 38.0 35.8 38.0 55-59 36.778 38.0 38.0 38.0 36.0 38.0 60-64 36.7504 38.0 38.0 38.0 36.0 38.0 65-69 36.71635 38.0 38.0 38.0 35.6 38.0 70-74 36.6309 38.0 38.0 38.0 35.2 38.0 75-79 36.5196 38.0 38.0 38.0 34.8 38.0 80-84 36.4548 38.0 38.0 38.0 34.4 38.0 85-89 36.4097 38.0 38.0 38.0 34.6 38.0 90-94 36.3277 38.0 38.0 38.0 34.0 38.0 95-99 36.0496 38.0 37.8 38.0 33.6 38.0 100-104 35.94865 38.0 37.6 38.0 33.2 38.0 105-109 35.78955 38.0 37.2 38.0 32.6 38.0 110-114 35.52135 38.0 37.0 38.0 31.0 38.0 115-119 35.40045 38.0 36.8 38.0 31.0 38.0 120-124 35.275 38.0 36.0 38.0 30.2 38.0 125-129 34.88875 38.0 35.6 38.0 28.6 38.0 130-134 34.341049999999996 38.0 34.0 38.0 26.0 38.0 135-139 33.975750000000005 38.0 33.2 38.0 23.8 38.0 140-144 33.2291 38.0 33.0 38.0 20.6 38.0 145-149 32.07345 38.0 33.0 38.0 10.6 38.0 150-151 26.352249999999998 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 3.0 5 3.0 6 1.0 7 2.0 8 1.0 9 2.0 10 2.0 11 3.0 12 4.0 13 1.0 14 3.0 15 3.0 16 2.0 17 7.0 18 4.0 19 3.0 20 4.0 21 6.0 22 12.0 23 11.0 24 15.0 25 14.0 26 18.0 27 21.0 28 32.0 29 37.0 30 40.0 31 59.0 32 80.0 33 116.0 34 184.0 35 328.0 36 711.0 37 2251.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.150000000000006 16.3 14.975 28.575 2 23.400000000000002 23.35 36.199999999999996 17.05 3 19.475 25.85 32.9 21.775 4 22.675 36.025 21.5 19.8 5 22.85 38.324999999999996 22.05 16.775000000000002 6 16.375 36.5 25.2 21.925 7 17.325 15.299999999999999 46.025 21.349999999999998 8 20.575 21.875 27.525 30.025000000000002 9 21.6 24.375 28.625 25.4 10-14 22.045 28.43 27.61 21.915000000000003 15-19 22.225 27.805000000000003 28.945 21.025 20-24 22.39 28.28 27.834999999999997 21.495 25-29 22.835 27.950000000000003 28.384999999999998 20.830000000000002 30-34 22.695 28.355000000000004 28.21 20.74 35-39 22.29 27.994999999999997 28.235 21.48 40-44 23.125 27.42 28.194999999999997 21.26 45-49 22.255 28.225 28.49 21.029999999999998 50-54 22.88 28.21 28.01 20.9 55-59 23.085 27.61 27.944999999999997 21.36 60-64 22.759999999999998 28.02 28.015 21.205 65-69 23.48 27.67 27.73 21.12 70-74 22.765 27.644999999999996 28.12 21.47 75-79 23.41 27.815 27.800000000000004 20.974999999999998 80-84 22.509999999999998 28.325 28.02 21.145 85-89 22.98 28.115000000000002 28.07 20.835 90-94 22.770000000000003 27.939999999999998 27.605 21.685 95-99 22.994999999999997 28.105000000000004 27.894999999999996 21.005 100-104 23.73 27.805000000000003 28.065 20.4 105-109 23.474999999999998 27.655 28.18 20.69 110-114 23.44 28.09 27.855 20.615 115-119 23.23 28.475 28.17 20.125 120-124 23.815 27.474999999999998 27.994999999999997 20.715 125-129 23.51 27.785 28.035 20.669999999999998 130-134 23.825 28.57 26.875 20.73 135-139 23.880000000000003 27.85 28.035 20.235 140-144 24.485 27.83 27.694999999999997 19.99 145-149 24.135 27.505000000000003 27.88 20.48 150-151 24.224999999999998 26.237500000000004 29.15 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.5 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 3.5 25 4.5 26 6.0 27 8.0 28 8.5 29 9.0 30 16.5 31 23.5 32 27.0 33 42.0 34 59.5 35 74.0 36 95.5 37 116.5 38 136.0 39 166.5 40 193.5 41 216.0 42 251.0 43 257.5 44 260.0 45 272.5 46 248.5 47 250.5 48 230.5 49 187.0 50 165.5 51 138.5 52 113.5 53 87.5 54 71.5 55 59.0 56 49.5 57 36.5 58 28.0 59 25.0 60 17.0 61 11.5 62 8.0 63 3.5 64 1.0 65 1.5 66 2.5 67 2.0 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.7579585649317837 1.5 3 0.15159171298635674 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6000000000000001 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.325 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.6375 0.0 0.0 0.0 0.0 118-119 1.7625 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.2125 0.0 0.0 0.0 0.0 124-125 2.4625 0.0 0.0 0.0 0.0 126-127 2.725 0.0 0.0 0.0 0.0 128-129 3.1125 0.0 0.0 0.0 0.0 130-131 3.325 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.0 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTTGA 10 0.006830828 145.0 4 AGTCTCA 10 0.006830828 145.0 7 TGCAGGA 10 0.006830828 145.0 7 >>END_MODULE Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025214 spots for SRR7170696.sra Written 1025214 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra Read 1025212 spots for SRR7170696.sra Written 1025212 spots for SRR7170696.sra SRR ids: ['SRR7170696.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_59d_x7qp SRR7170696.sra spots: 20504242 blocks: [[1, 1025212], [1025213, 2050424], [2050425, 3075636], [3075637, 4100848], [4100849, 5126060], [5126061, 6151272], [6151273, 7176484], [7176485, 8201696], [8201697, 9226908], [9226909, 10252120], [10252121, 11277332], [11277333, 12302544], [12302545, 13327756], [13327757, 14352968], [14352969, 15378180], [15378181, 16403392], [16403393, 17428604], [17428605, 18453816], [18453817, 19479028], [19479029, 20504242]] SRR7170696 file size 6926514 SRR7170696 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170696 SRR7170696_1.fastq SRR7170696_2.fastq Input file: SRR7170696_1.fastq Paired file: SRR7170696_2.fastq trimmed: SRR7170696-trimmed-pair1.fastq, SRR7170696-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:01:56 2025 >> started Thu Feb 13 17:02:19 2025 >> done (22.693s) 20504242 read pairs processed; of these: 20945 ( 0.10%) short read pairs filtered out after trimming by size control 23581 ( 0.12%) empty read pairs filtered out after trimming by size control 20459716 (99.78%) read pairs available; of these: 11089606 (54.20%) trimmed read pairs available after processing 9370110 (45.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 14 0.00% 20 11 0.00% 21 8 0.00% 22 17 0.00% 23 13 0.00% 24 10 0.00% 25 9 0.00% 26 19 0.00% 27 19 0.00% 28 10 0.00% 29 14 0.00% 30 12 0.00% 31 20 0.00% 32 20 0.00% 33 22 0.00% 34 34 0.00% 35 19 0.00% 36 27 0.00% 37 22 0.00% 38 31 0.00% 39 27 0.00% 40 35 0.00% 41 34 0.00% 42 36 0.00% 43 42 0.00% 44 69 0.00% 45 61 0.00% 46 78 0.00% 47 73 0.00% 48 89 0.00% 49 99 0.00% 50 111 0.00% 51 147 0.00% 52 141 0.00% 53 153 0.00% 54 167 0.00% 55 195 0.00% 56 194 0.00% 57 199 0.00% 58 251 0.00% 59 339 0.00% 60 299 0.00% 61 394 0.00% 62 384 0.00% 63 459 0.00% 64 475 0.00% 65 576 0.00% 66 568 0.00% 67 664 0.00% 68 754 0.00% 69 795 0.00% 70 965 0.00% 71 1147 0.01% 72 1240 0.01% 73 1342 0.01% 74 1609 0.01% 75 1745 0.01% 76 2150 0.01% 77 2266 0.01% 78 2120 0.01% 79 2589 0.01% 80 2777 0.01% 81 3033 0.01% 82 3406 0.02% 83 3977 0.02% 84 5260 0.03% 85 6073 0.03% 86 6582 0.03% 87 7109 0.03% 88 7254 0.04% 89 7619 0.04% 90 8060 0.04% 91 8641 0.04% 92 9249 0.05% 93 9994 0.05% 94 10603 0.05% 95 11453 0.06% 96 12088 0.06% 97 12102 0.06% 98 12833 0.06% 99 13548 0.07% 100 14329 0.07% 101 15353 0.08% 102 15996 0.08% 103 17052 0.08% 104 17785 0.09% 105 18651 0.09% 106 19343 0.09% 107 20099 0.10% 108 20866 0.10% 109 21666 0.11% 110 22787 0.11% 111 23399 0.11% 112 24543 0.12% 113 25727 0.13% 114 26778 0.13% 115 27750 0.14% 116 28913 0.14% 117 29692 0.15% 118 30859 0.15% 119 31695 0.15% 120 33110 0.16% 121 35031 0.17% 122 36330 0.18% 123 38421 0.19% 124 39935 0.20% 125 41722 0.20% 126 43501 0.21% 127 44930 0.22% 128 47394 0.23% 129 49634 0.24% 130 51941 0.25% 131 54542 0.27% 132 58175 0.28% 133 62330 0.30% 134 66678 0.33% 135 71275 0.35% 136 77816 0.38% 137 84187 0.41% 138 92222 0.45% 139 101594 0.50% 140 114116 0.56% 141 127616 0.62% 142 145196 0.71% 143 166987 0.82% 144 200724 0.98% 145 251449 1.23% 146 315350 1.54% 147 436754 2.13% 148 681448 3.33% 149 1358858 6.64% 150 5519960 26.98% 151 9370110 45.80% 20459716 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=13 prefix-density=0.55 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=19.27 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=7.9 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGAC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=15 prefix-density=0.74 prefix-fanout=2.4 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=99.87 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7170696 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:03:26 Started mapping on | Feb 13 17:03:26 Finished on | Feb 13 17:05:52 Mapping speed, Million of reads per hour | 504.49 Number of input reads | 20459716 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19220306 Uniquely mapped reads % | 93.94% Average mapped length | 294.18 Number of splices: Total | 19140933 Number of splices: Annotated (sjdb) | 18697293 Number of splices: GT/AG | 18781885 Number of splices: GC/AG | 295496 Number of splices: AT/AC | 10522 Number of splices: Non-canonical | 53030 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510340 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 43984 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.29% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 750664 750664 750664 N_multimapping 510340 510340 510340 N_noFeature 800386 18905902 916854 N_ambiguous 326699 1175 128068 UnstrandedReadsAssigned:18093221 PositiveStrandReadsAssigned:313229 NegativeStrandReadsAssigned:18175384 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170696 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170696-trimmed-pair1.fastq SRR7170696-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,459,716 reads, 18,132,288 reads pseudoaligned [quant] estimated average fragment length: 273.45 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR7170696.ke.tsv 34699 SRR7170696.se.tsv 87100 total ==> SRR7170696.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.55 680 21.3915 Potri.005G024800.1.v4.1 1035 762.55 77 5.54482 Potri.004G059700.1.v4.1 961 688.641 30 2.39218 Potri.007G009000.2.v4.1 1416 1143.55 0 0 Potri.003G141000.2.v4.1 2943 2670.55 811.375 16.6835 Potri.016G087400.1.v4.1 270 74.8893 703.54 515.863 Potri.015G069301.1.v4.1 564 302.815 0 0 Potri.010G195200.1.v4.1 1773 1500.55 54 1.9761 Potri.012G127500.1.v4.1 977 704.583 61 4.75404 ==> SRR7170696.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1528 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 364 Potri.001G212900.v4.1 35 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170696 completed mapping pipeline successfully