Starting /dee2/code/volunteer_pipeline.sh SRR7170697 current disk space = 3088662827008 free memory = 1459846100 SRR7170697 SRAfilesize 42c309605d57d586cdf57350edd782c7 SRR7170697.sra SRR7170697.sra file validated SRR7170697 is paired end SRR7170697 is conventional basespace SRR7170697 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170697_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.80425 18.0 18.0 18.0 18.0 32.0 2 26.9935 27.0 25.0 30.0 18.0 31.0 3 28.52225 29.0 27.0 31.0 18.0 33.0 4 31.105 33.0 31.0 33.0 29.0 33.0 5 31.8305 33.0 31.0 33.0 29.0 33.0 6 36.28375 38.0 36.0 38.0 33.0 38.0 7 36.8985 38.0 37.0 38.0 35.0 38.0 8 37.2715 38.0 38.0 38.0 36.0 38.0 9 37.446 38.0 38.0 38.0 37.0 38.0 10-14 37.365449999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.3855 38.0 38.0 38.0 37.0 38.0 20-24 37.49185 38.0 38.0 38.0 37.4 38.0 25-29 37.50675 38.0 38.0 38.0 37.4 38.0 30-34 37.419349999999994 38.0 38.0 38.0 37.2 38.0 35-39 37.4016 38.0 38.0 38.0 37.0 38.0 40-44 37.3672 38.0 38.0 38.0 37.0 38.0 45-49 37.3107 38.0 38.0 38.0 37.0 38.0 50-54 37.22165 38.0 38.0 38.0 36.4 38.0 55-59 37.17475 38.0 38.0 38.0 36.0 38.0 60-64 37.0927 38.0 38.0 38.0 36.0 38.0 65-69 37.079950000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.946099999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.85345 38.0 38.0 38.0 35.4 38.0 80-84 36.664 38.0 38.0 38.0 34.8 38.0 85-89 36.62500000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.43585 38.0 38.0 38.0 34.0 38.0 95-99 36.333450000000006 38.0 37.6 38.0 33.8 38.0 100-104 36.233599999999996 38.0 37.0 38.0 34.0 38.0 105-109 36.09075 38.0 37.0 38.0 33.0 38.0 110-114 35.84035 38.0 37.0 38.0 31.8 38.0 115-119 35.64535 38.0 36.4 38.0 31.4 38.0 120-124 35.3768 38.0 36.0 38.0 30.2 38.0 125-129 35.22805 38.0 35.8 38.0 29.6 38.0 130-134 34.92569999999999 38.0 35.0 38.0 28.0 38.0 135-139 34.6004 38.0 35.0 38.0 27.2 38.0 140-144 33.9875 38.0 34.4 38.0 24.2 38.0 145-149 33.0291 38.0 33.2 38.0 18.2 38.0 150-151 28.186374999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 3.0 14 0.0 15 2.0 16 1.0 17 1.0 18 5.0 19 10.0 20 5.0 21 2.0 22 3.0 23 7.0 24 5.0 25 11.0 26 10.0 27 21.0 28 29.0 29 37.0 30 40.0 31 56.0 32 90.0 33 105.0 34 221.0 35 401.0 36 1067.0 37 1866.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.147427693882776 29.66470437675966 11.338622984386998 26.849244944970568 2 19.1 25.275 38.324999999999996 17.299999999999997 3 17.25 31.15 28.349999999999998 23.25 4 21.125 36.0 22.55 20.325 5 20.080120180270406 37.03054581872809 24.211316975463195 18.678017025538306 6 16.975 35.15 25.074999999999996 22.8 7 13.200000000000001 20.0 45.675 21.125 8 18.25 19.825 29.225 32.7 9 17.775 22.475 30.275000000000002 29.475 10-14 19.055 30.014999999999997 26.634999999999998 24.295 15-19 19.650000000000002 28.29 27.99 24.07 20-24 19.325 28.645 27.785 24.245 25-29 19.57 29.2 27.950000000000003 23.28 30-34 19.875 28.73 27.675 23.72 35-39 19.79 29.375 27.169999999999998 23.665 40-44 19.74 29.215000000000003 27.33 23.715 45-49 19.595000000000002 28.59 28.225 23.59 50-54 19.835 28.555000000000003 27.57 24.04 55-59 19.865 29.185 27.66 23.29 60-64 19.59 29.165000000000003 27.639999999999997 23.605 65-69 19.900000000000002 28.58 28.21 23.31 70-74 19.689999999999998 28.720000000000002 27.71 23.880000000000003 75-79 19.985 28.34 28.215 23.46 80-84 19.759999999999998 28.215 28.015 24.01 85-89 19.955000000000002 28.28 27.605 24.16 90-94 20.09 28.68 27.185 24.044999999999998 95-99 20.61 28.09 28.01 23.29 100-104 20.13 28.565 27.235 24.07 105-109 20.605 28.075 27.544999999999998 23.775 110-114 20.19 28.689999999999998 27.250000000000004 23.87 115-119 20.215 28.03 28.060000000000002 23.695 120-124 20.745 28.395 27.250000000000004 23.61 125-129 20.465 28.134999999999998 27.125 24.275 130-134 20.585 28.38 27.67 23.365 135-139 20.28 28.57 26.619999999999997 24.529999999999998 140-144 20.86 27.655 27.800000000000004 23.685000000000002 145-149 20.64 28.560000000000002 27.205000000000002 23.595 150-151 21.075 27.712500000000002 27.375 23.8375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 2.0 21 2.5 22 3.5 23 5.0 24 3.5 25 3.5 26 8.0 27 9.5 28 14.0 29 18.0 30 20.0 31 32.5 32 46.5 33 57.5 34 73.0 35 85.0 36 95.0 37 122.5 38 149.0 39 169.0 40 195.5 41 223.5 42 223.5 43 237.0 44 267.0 45 253.0 46 243.5 47 249.0 48 225.5 49 192.0 50 177.0 51 141.5 52 109.0 53 83.5 54 55.5 55 53.0 56 44.0 57 31.0 58 22.5 59 18.5 60 13.0 61 7.5 62 6.0 63 2.5 64 1.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.325 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2938209331652 98.425 2 0.605296343001261 1.2 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025220680958385876 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.2 0.0 0.0 0.0 0.0 114-115 1.35 0.0 0.0 0.0 0.0 116-117 1.5499999999999998 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.625 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 2.9875 0.0 0.0 0.0 0.0 136-137 3.2875 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170697 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170697_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.613 33.0 33.0 34.0 32.0 34.0 2 32.80825 33.0 33.0 34.0 32.0 34.0 3 32.82475 34.0 33.0 34.0 32.0 34.0 4 32.744 34.0 33.0 34.0 32.0 34.0 5 32.79725 34.0 33.0 34.0 32.0 34.0 6 36.902 38.0 38.0 38.0 36.0 38.0 7 36.996 38.0 38.0 38.0 36.0 38.0 8 36.966 38.0 38.0 38.0 36.0 38.0 9 36.88 38.0 38.0 38.0 36.0 38.0 10-14 36.9326 38.0 38.0 38.0 36.2 38.0 15-19 36.9043 38.0 38.0 38.0 36.0 38.0 20-24 36.877500000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.8178 38.0 38.0 38.0 36.0 38.0 30-34 36.786950000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.79615 38.0 38.0 38.0 36.0 38.0 40-44 36.7888 38.0 38.0 38.0 36.0 38.0 45-49 36.75505 38.0 38.0 38.0 35.8 38.0 50-54 36.71034999999999 38.0 38.0 38.0 35.8 38.0 55-59 36.58025 38.0 38.0 38.0 34.8 38.0 60-64 36.58545 38.0 38.0 38.0 35.0 38.0 65-69 36.5475 38.0 38.0 38.0 35.0 38.0 70-74 36.4411 38.0 38.0 38.0 34.4 38.0 75-79 36.440650000000005 38.0 38.0 38.0 34.4 38.0 80-84 36.29715 38.0 38.0 38.0 34.0 38.0 85-89 36.168549999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.066449999999996 38.0 38.0 38.0 33.8 38.0 95-99 35.89534999999999 38.0 37.6 38.0 33.0 38.0 100-104 35.734300000000005 38.0 37.0 38.0 32.6 38.0 105-109 35.618700000000004 38.0 37.0 38.0 31.6 38.0 110-114 35.3781 38.0 36.8 38.0 30.8 38.0 115-119 34.97265 38.0 36.0 38.0 27.8 38.0 120-124 35.02525 38.0 36.0 38.0 28.6 38.0 125-129 34.626 38.0 35.2 38.0 27.2 38.0 130-134 34.1687 38.0 34.0 38.0 24.4 38.0 135-139 33.796899999999994 38.0 33.2 38.0 22.6 38.0 140-144 33.3446 38.0 33.0 38.0 20.8 38.0 145-149 32.2244 38.0 33.0 38.0 10.6 38.0 150-151 26.510624999999997 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 5.0 4 0.0 5 1.0 6 2.0 7 1.0 8 1.0 9 1.0 10 2.0 11 5.0 12 4.0 13 6.0 14 5.0 15 7.0 16 6.0 17 5.0 18 4.0 19 8.0 20 14.0 21 9.0 22 8.0 23 8.0 24 12.0 25 16.0 26 19.0 27 24.0 28 27.0 29 44.0 30 46.0 31 64.0 32 82.0 33 119.0 34 170.0 35 285.0 36 736.0 37 2236.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.400000000000006 17.025000000000002 14.249999999999998 28.325 2 23.35 23.7 34.75 18.2 3 19.075 26.825 31.900000000000002 22.2 4 22.575 35.875 21.925 19.625 5 23.325000000000003 36.55 21.275 18.85 6 17.51751751751752 38.11311311311311 22.64764764764765 21.72172172172172 7 16.73336668334167 16.758379189594798 44.772386193096544 21.735867933966986 8 21.17117117117117 22.42242242242242 28.77877877877878 27.627627627627625 9 21.53576788394197 23.936968484242122 27.263631815907953 27.263631815907953 10-14 22.653592155293175 28.907344406643986 26.83109865919552 21.60796477886732 15-19 22.33393357342937 27.59603841536615 28.746498599439775 21.323529411764707 20-24 22.90030513731179 27.932569656345358 28.122655194837677 21.04447001150518 25-29 23.046523261630817 28.249124562281143 27.593796898449224 21.11055527763882 30-34 22.457351543348842 28.26054329881435 27.840312171694432 21.441792986142378 35-39 22.426820115086315 27.62071553665249 28.391293470102575 21.56117087815862 40-44 22.76776776776777 27.992992992992992 27.627627627627625 21.61161161161161 45-49 22.91875125075045 27.78166900140084 28.65719431658995 20.642385431258756 50-54 22.556278139069537 28.06903451725863 27.63381690845423 21.74087043521761 55-59 22.926048233763634 26.993895727008905 28.44991494045832 21.630141098769137 60-64 22.997648706788734 27.575166341487815 28.01040572314773 21.416779228575717 65-69 22.65406162464986 27.58603441376551 28.12625050020008 21.633653461384554 70-74 23.43351502725409 27.594139120868128 27.544131619742963 21.42821423213482 75-79 22.74523535591016 28.287729478265216 27.632434595568007 21.334600570256615 80-84 22.747961786625318 28.194868203871355 27.724703646276193 21.33246636322713 85-89 23.191957587276182 27.953386015804742 28.02840852255677 20.82624787436231 90-94 22.873431014652198 28.66930039505926 27.40911136670501 21.048157223583537 95-99 22.830000000000002 28.000000000000004 27.779999999999998 21.39 100-104 23.731186559327966 28.046402320116005 27.611380569028455 20.611030551527577 105-109 23.507052115634693 27.563268980694204 28.093428028408525 20.83625087526258 110-114 23.52499624680979 28.19396487013962 27.463343842265925 20.817695040784667 115-119 23.577967882335287 28.21051578368102 28.045424983741057 20.166091350242635 120-124 23.319663932786558 27.230446089217843 28.300660132026405 21.149229845969195 125-129 23.723303156104635 27.71470014505077 27.844745660981346 20.717251037863253 130-134 24.137241172351708 26.93808142442733 28.178453536060815 20.74622386716015 135-139 23.727795846885165 27.685764323242434 28.021015761821367 20.565424068051037 140-144 23.937953465098825 27.970978233675257 28.34625969477108 19.744808606454843 145-149 24.606230311515574 26.986349317465873 27.83639181959098 20.571028551427574 150-151 23.6125 27.35 28.4 20.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 3.5 23 4.0 24 4.5 25 4.5 26 4.0 27 8.5 28 13.0 29 12.5 30 12.5 31 16.0 32 27.0 33 38.0 34 50.0 35 70.0 36 95.5 37 115.5 38 131.0 39 148.0 40 183.0 41 231.5 42 234.5 43 238.5 44 271.0 45 280.0 46 258.0 47 240.0 48 223.0 49 195.0 50 171.5 51 147.0 52 121.5 53 94.0 54 79.5 55 70.5 56 55.5 57 47.5 58 31.0 59 18.5 60 20.5 61 12.0 62 5.0 63 2.5 64 2.0 65 2.0 66 0.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.05 8 0.1 9 0.05 10-14 0.06 15-19 0.04 20-24 0.045 25-29 0.05 30-34 0.055 35-39 0.075 40-44 0.1 45-49 0.06 50-54 0.05 55-59 0.06999999999999999 60-64 0.055 65-69 0.04 70-74 0.015 75-79 0.045 80-84 0.034999999999999996 85-89 0.03 90-94 0.015 95-99 0.0 100-104 0.005 105-109 0.03 110-114 0.08499999999999999 115-119 0.055 120-124 0.02 125-129 0.034999999999999996 130-134 0.03 135-139 0.075 140-144 0.075 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93319786639573 97.375 2 0.8382016764033529 1.6500000000000001 3 0.10160020320040639 0.3 4 0.025400050800101596 0.1 5 0.05080010160020319 0.25 6 0.025400050800101596 0.15 7 0.025400050800101596 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 32bp) TCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGT 6 0.15 No Hit TCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCA 5 0.125 No Hit TTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.7625 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0375 0.0 0.0 0.0 0.0 112-113 1.1875 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.6749999999999998 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 1.9500000000000002 0.0 0.0 0.0 0.0 124-125 2.125 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.7 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.0625 0.0 0.0 0.0 0.0 136-137 3.3625 0.0 0.0 0.0 0.0 138-139 3.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770227 spots for SRR7170697.sra Written 770227 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra Read 770214 spots for SRR7170697.sra Written 770214 spots for SRR7170697.sra SRR ids: ['SRR7170697.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_adqyf2ur SRR7170697.sra spots: 15404293 blocks: [[1, 770214], [770215, 1540428], [1540429, 2310642], [2310643, 3080856], [3080857, 3851070], [3851071, 4621284], [4621285, 5391498], [5391499, 6161712], [6161713, 6931926], [6931927, 7702140], [7702141, 8472354], [8472355, 9242568], [9242569, 10012782], [10012783, 10782996], [10782997, 11553210], [11553211, 12323424], [12323425, 13093638], [13093639, 13863852], [13863853, 14634066], [14634067, 15404293]] SRR7170697 file size 5198309 SRR7170697 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170697 SRR7170697_1.fastq SRR7170697_2.fastq Input file: SRR7170697_1.fastq Paired file: SRR7170697_2.fastq trimmed: SRR7170697-trimmed-pair1.fastq, SRR7170697-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:11:48 2025 >> started Thu Feb 13 17:12:14 2025 >> done (25.658s) 15404293 read pairs processed; of these: 18708 ( 0.12%) short read pairs filtered out after trimming by size control 41900 ( 0.27%) empty read pairs filtered out after trimming by size control 15343685 (99.61%) read pairs available; of these: 7961904 (51.89%) trimmed read pairs available after processing 7381781 (48.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 5 0.00% 21 3 0.00% 22 9 0.00% 23 8 0.00% 24 10 0.00% 25 9 0.00% 26 8 0.00% 27 8 0.00% 28 8 0.00% 29 12 0.00% 30 10 0.00% 31 12 0.00% 32 18 0.00% 33 15 0.00% 34 9 0.00% 35 11 0.00% 36 11 0.00% 37 18 0.00% 38 16 0.00% 39 19 0.00% 40 23 0.00% 41 29 0.00% 42 26 0.00% 43 34 0.00% 44 45 0.00% 45 45 0.00% 46 56 0.00% 47 75 0.00% 48 66 0.00% 49 101 0.00% 50 97 0.00% 51 122 0.00% 52 114 0.00% 53 138 0.00% 54 151 0.00% 55 146 0.00% 56 170 0.00% 57 209 0.00% 58 219 0.00% 59 230 0.00% 60 266 0.00% 61 327 0.00% 62 339 0.00% 63 399 0.00% 64 443 0.00% 65 472 0.00% 66 495 0.00% 67 592 0.00% 68 596 0.00% 69 708 0.00% 70 783 0.01% 71 909 0.01% 72 1088 0.01% 73 1218 0.01% 74 1436 0.01% 75 1729 0.01% 76 2338 0.02% 77 2607 0.02% 78 1984 0.01% 79 2161 0.01% 80 2363 0.02% 81 2507 0.02% 82 2806 0.02% 83 3195 0.02% 84 4319 0.03% 85 5168 0.03% 86 5246 0.03% 87 5558 0.04% 88 5944 0.04% 89 6093 0.04% 90 6241 0.04% 91 7037 0.05% 92 7353 0.05% 93 7736 0.05% 94 8186 0.05% 95 8596 0.06% 96 9050 0.06% 97 9116 0.06% 98 9554 0.06% 99 10097 0.07% 100 10479 0.07% 101 11035 0.07% 102 11422 0.07% 103 12273 0.08% 104 12707 0.08% 105 13505 0.09% 106 13991 0.09% 107 14214 0.09% 108 14708 0.10% 109 15158 0.10% 110 15816 0.10% 111 16450 0.11% 112 17146 0.11% 113 17965 0.12% 114 18892 0.12% 115 19262 0.13% 116 19928 0.13% 117 20691 0.13% 118 21067 0.14% 119 22006 0.14% 120 22626 0.15% 121 23478 0.15% 122 24511 0.16% 123 26043 0.17% 124 27042 0.18% 125 28287 0.18% 126 29403 0.19% 127 30984 0.20% 128 32096 0.21% 129 33961 0.22% 130 35596 0.23% 131 37490 0.24% 132 40057 0.26% 133 42545 0.28% 134 45644 0.30% 135 49010 0.32% 136 53127 0.35% 137 57480 0.37% 138 62585 0.41% 139 69751 0.45% 140 77388 0.50% 141 88868 0.58% 142 102242 0.67% 143 118646 0.77% 144 137601 0.90% 145 172924 1.13% 146 222550 1.45% 147 318558 2.08% 148 478793 3.12% 149 925694 6.03% 150 4078830 26.58% 151 7381781 48.11% 15343685 reads passed initial QC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=14 prefix-density=0.77 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=375.81 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATG criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=10 prefix-density=0.93 prefix-fanout=2.3 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=21.53 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.7 sequence=CATCCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7170697 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:13:02 Started mapping on | Feb 13 17:13:02 Finished on | Feb 13 17:15:06 Mapping speed, Million of reads per hour | 445.46 Number of input reads | 15343685 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 14353574 Uniquely mapped reads % | 93.55% Average mapped length | 294.62 Number of splices: Total | 14360453 Number of splices: Annotated (sjdb) | 14044969 Number of splices: GT/AG | 14089468 Number of splices: GC/AG | 221244 Number of splices: AT/AC | 9523 Number of splices: Non-canonical | 40218 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399517 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 17477 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 609274 609274 609274 N_multimapping 399517 399517 399517 N_noFeature 507030 14090511 583214 N_ambiguous 296312 854 108898 UnstrandedReadsAssigned:13550232 PositiveStrandReadsAssigned:262209 NegativeStrandReadsAssigned:13661462 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170697 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170697-trimmed-pair1.fastq SRR7170697-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,343,685 reads, 13,615,871 reads pseudoaligned [quant] estimated average fragment length: 279.261 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 984 rounds 52401 SRR7170697.ke.tsv 34699 SRR7170697.se.tsv 87100 total ==> SRR7170697.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.74 384 13.3581 Potri.005G024800.1.v4.1 1035 756.739 60 4.79847 Potri.004G059700.1.v4.1 961 682.822 12 1.06358 Potri.007G009000.2.v4.1 1416 1137.74 0 0 Potri.003G141000.2.v4.1 2943 2664.74 740.42 16.8159 Potri.016G087400.1.v4.1 270 72.8798 887 736.57 Potri.015G069301.1.v4.1 564 295.992 0 0 Potri.010G195200.1.v4.1 1773 1494.74 6 0.242931 Potri.012G127500.1.v4.1 977 698.766 64 5.54302 ==> SRR7170697.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 889 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 329 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7170697 completed mapping pipeline successfully