Starting /dee2/code/volunteer_pipeline.sh SRR7170805 current disk space = 3088787922944 free memory = 1502228124 SRR7170805 SRAfilesize f2c5497950c58f18b6f2ab861a9ea87b SRR7170805.sra SRR7170805.sra file validated SRR7170805 is paired end SRR7170805 is conventional basespace SRR7170805 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170805_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9155 34.0 33.0 34.0 32.0 34.0 2 33.2595 34.0 33.0 34.0 32.0 34.0 3 33.26125 34.0 33.0 34.0 33.0 34.0 4 33.24325 34.0 33.0 34.0 33.0 34.0 5 33.26725 34.0 33.0 34.0 33.0 34.0 6 36.76525 38.0 37.0 38.0 35.0 38.0 7 37.201 38.0 38.0 38.0 36.0 38.0 8 37.343 38.0 38.0 38.0 37.0 38.0 9 37.46325 38.0 38.0 38.0 37.0 38.0 10-14 37.4564 38.0 38.0 38.0 37.0 38.0 15-19 37.4158 38.0 38.0 38.0 37.0 38.0 20-24 37.325649999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.3081 38.0 38.0 38.0 37.0 38.0 30-34 37.298500000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.2655 38.0 38.0 38.0 36.8 38.0 40-44 37.1751 38.0 38.0 38.0 36.0 38.0 45-49 37.00945 38.0 38.0 38.0 35.6 38.0 50-54 36.90695 38.0 38.0 38.0 35.6 38.0 55-59 36.89765 38.0 38.0 38.0 35.4 38.0 60-64 36.96015 38.0 38.0 38.0 35.8 38.0 65-69 36.855000000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.782500000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.63195 38.0 38.0 38.0 34.6 38.0 80-84 36.4372 38.0 38.0 38.0 34.0 38.0 85-89 36.38270000000001 38.0 37.6 38.0 33.8 38.0 90-94 36.345299999999995 38.0 37.2 38.0 34.0 38.0 95-99 36.284000000000006 38.0 37.2 38.0 33.6 38.0 100-104 36.08105 38.0 37.0 38.0 33.0 38.0 105-109 35.75435 38.0 36.8 38.0 30.6 38.0 110-114 35.4993 38.0 36.2 38.0 30.2 38.0 115-119 35.0957 38.0 35.4 38.0 28.2 38.0 120-124 34.79085 38.0 34.8 38.0 27.6 38.0 125-129 34.4424 38.0 34.0 38.0 25.6 38.0 130-134 33.9195 38.0 33.0 38.0 23.0 38.0 135-139 33.377449999999996 38.0 33.0 38.0 21.0 38.0 140-144 32.471050000000005 38.0 32.6 38.0 14.4 38.0 145-149 31.44995 38.0 31.6 38.0 8.6 38.0 150-151 25.2095 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 5.0 19 13.0 20 4.0 21 7.0 22 6.0 23 11.0 24 10.0 25 21.0 26 18.0 27 27.0 28 34.0 29 49.0 30 55.0 31 92.0 32 99.0 33 145.0 34 223.0 35 388.0 36 955.0 37 1833.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.642387455741016 14.33990895295903 9.484066767830047 35.533636823469905 2 20.674999999999997 17.7 36.575 25.05 3 18.5 25.525 29.65 26.325 4 20.849999999999998 32.6 23.05 23.5 5 21.575 36.775000000000006 24.25 17.4 6 18.25 36.175000000000004 25.025 20.549999999999997 7 13.075000000000001 25.324999999999996 42.425000000000004 19.175 8 16.6 25.6 28.95 28.849999999999998 9 17.474999999999998 22.75 34.8 24.975 10-14 19.775000000000002 30.735 26.26 23.23 15-19 19.865 29.365000000000002 27.555000000000003 23.215 20-24 19.830000000000002 28.985 27.875 23.31 25-29 20.5 28.689999999999998 27.474999999999998 23.335 30-34 19.384999999999998 29.38 27.245 23.990000000000002 35-39 20.365 29.265 27.375 22.994999999999997 40-44 19.81 28.854999999999997 27.87 23.465 45-49 19.84 29.17 27.224999999999998 23.765 50-54 20.075000000000003 29.04 26.889999999999997 23.995 55-59 19.34 28.455000000000002 28.060000000000002 24.145 60-64 19.915 29.544999999999998 26.669999999999998 23.87 65-69 20.055 29.085 27.38 23.48 70-74 20.235 29.53 27.21 23.025000000000002 75-79 19.985 28.65 28.08 23.285 80-84 19.765 28.815 27.089999999999996 24.33 85-89 19.905 29.01 26.795 24.29 90-94 20.24 28.9 27.315 23.544999999999998 95-99 20.25 28.194999999999997 27.54 24.015 100-104 20.5 28.705000000000002 27.295 23.5 105-109 20.369999999999997 28.79 27.229999999999997 23.61 110-114 20.285 28.65 27.075 23.990000000000002 115-119 20.765 29.015 26.755000000000003 23.465 120-124 20.61 28.939999999999998 26.3 24.15 125-129 20.821041052052603 28.461423071153558 26.741337066853344 23.976198809940495 130-134 20.891044552227612 28.41142057102855 26.601330066503326 24.09620481024051 135-139 21.299259851970394 28.430686137227447 26.380276055211045 23.889777955591118 140-144 20.49602480124006 28.421421071053555 25.976298814940748 25.10625531276564 145-149 20.555 27.810000000000002 26.58 25.055 150-151 20.91511438929866 28.128516064508062 25.55319414926866 25.403175396924617 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 2.0 25 6.0 26 7.0 27 8.5 28 12.0 29 15.5 30 21.0 31 33.5 32 45.0 33 53.5 34 70.0 35 91.5 36 103.0 37 118.0 38 148.0 39 169.5 40 197.0 41 225.5 42 217.0 43 218.5 44 259.0 45 267.0 46 245.5 47 244.5 48 227.5 49 194.5 50 163.5 51 132.5 52 115.0 53 92.0 54 72.0 55 56.5 56 42.5 57 35.5 58 26.5 59 20.5 60 15.0 61 7.0 62 4.0 63 4.5 64 3.5 65 2.5 66 2.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.005 135-139 0.02 140-144 0.005 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19089759797724 98.075 2 0.7079646017699115 1.4000000000000001 3 0.07585335018963338 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 12 0.3 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3250000000000002 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.1624999999999996 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.675 0.0 0.0 0.0 0.0 112-113 4.2375 0.0 0.0 0.0 0.0 114-115 4.775 0.0 0.0 0.0 0.0 116-117 5.4875 0.0 0.0 0.0 0.0 118-119 6.237500000000001 0.0 0.0 0.0 0.0 120-121 6.8125 0.0 0.0 0.0 0.0 122-123 7.45 0.0 0.0 0.0 0.0 124-125 7.975 0.0 0.0 0.0 0.0 126-127 8.575 0.0 0.0 0.0 0.0 128-129 9.337499999999999 0.0 0.0 0.0 0.0 130-131 10.25 0.0 0.0 0.0 0.0 132-133 10.9375 0.0 0.0 0.0 0.0 134-135 11.675 0.0 0.0 0.0 0.0 136-137 12.625 0.0 0.0 0.0 0.0 138-139 13.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170805 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170805_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8305 33.0 33.0 34.0 32.0 34.0 2 32.98275 33.0 33.0 34.0 32.0 34.0 3 32.98025 34.0 33.0 34.0 32.0 34.0 4 33.008 34.0 33.0 34.0 32.0 34.0 5 32.981 34.0 33.0 34.0 32.0 34.0 6 37.22725 38.0 38.0 38.0 37.0 38.0 7 37.19275 38.0 38.0 38.0 37.0 38.0 8 37.296 38.0 38.0 38.0 37.0 38.0 9 37.23475 38.0 38.0 38.0 37.0 38.0 10-14 37.19885 38.0 38.0 38.0 37.0 38.0 15-19 37.15605 38.0 38.0 38.0 37.0 38.0 20-24 37.0873 38.0 38.0 38.0 37.0 38.0 25-29 37.1024 38.0 38.0 38.0 37.0 38.0 30-34 37.01265 38.0 38.0 38.0 36.4 38.0 35-39 36.951299999999996 38.0 38.0 38.0 36.2 38.0 40-44 37.02045 38.0 38.0 38.0 36.6 38.0 45-49 36.9595 38.0 38.0 38.0 36.0 38.0 50-54 36.9157 38.0 38.0 38.0 36.0 38.0 55-59 36.90795000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.77995 38.0 38.0 38.0 35.6 38.0 65-69 36.785849999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.761250000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.654849999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.41435 38.0 38.0 38.0 34.4 38.0 85-89 36.33795 38.0 38.0 38.0 34.0 38.0 90-94 36.065599999999996 38.0 37.8 38.0 33.4 38.0 95-99 36.12765 38.0 38.0 38.0 33.8 38.0 100-104 35.925149999999995 38.0 37.2 38.0 33.0 38.0 105-109 35.883500000000005 38.0 37.0 38.0 32.6 38.0 110-114 35.678399999999996 38.0 37.0 38.0 31.6 38.0 115-119 35.41755 38.0 36.6 38.0 29.8 38.0 120-124 35.16005 38.0 36.0 38.0 29.2 38.0 125-129 34.791399999999996 38.0 35.6 38.0 27.6 38.0 130-134 34.2428 38.0 34.2 38.0 25.0 38.0 135-139 33.631 38.0 33.0 38.0 22.2 38.0 140-144 32.924600000000005 38.0 33.0 38.0 16.4 38.0 145-149 31.742200000000004 38.0 32.0 38.0 8.4 38.0 150-151 26.136625000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 3.0 4 2.0 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 3.0 15 1.0 16 4.0 17 2.0 18 3.0 19 14.0 20 15.0 21 9.0 22 9.0 23 11.0 24 21.0 25 22.0 26 22.0 27 24.0 28 29.0 29 46.0 30 50.0 31 53.0 32 71.0 33 111.0 34 173.0 35 297.0 36 732.0 37 2255.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.85 18.425 12.9 25.825 2 26.458072590738425 24.53066332916145 32.24030037546934 16.77096370463079 3 21.00650976464697 26.41462193289935 34.05107661492238 18.5277916875313 4 24.831038798498124 34.593241551939926 22.27784730913642 18.29787234042553 5 25.381727158948685 37.27158948685857 20.35043804755945 16.99624530663329 6 19.83987990993245 39.229422066549915 23.267450587940957 17.663247435576682 7 20.110055027513756 20.985492746373186 39.09454727363682 19.809904952476238 8 21.51613710282712 25.519139354515886 28.396297222917187 24.568426319739807 9 22.9672254190643 24.7935951963973 29.67225419064298 22.566925193895422 10-14 23.75281461095822 28.56642481861396 26.715036277207904 20.965724293219914 15-19 23.42225113858165 28.066663330163657 27.781392322706573 20.72969320854812 20-24 23.573002203084318 28.039254956939715 28.044261966753453 20.34348087322251 25-29 23.601582452801843 28.2437778556763 27.883218989433622 20.271420702088236 30-34 23.309964947421133 27.936905358037055 28.067100650976464 20.686029043565348 35-39 23.275732531930878 27.638367142499376 28.30954169797145 20.776358627598295 40-44 23.348525066359493 27.555466519757598 28.46196223769219 20.634046176190715 45-49 23.949516702559222 27.73075574698252 27.690689637902537 20.629037912555717 50-54 23.783052884615387 27.30869391025641 28.300280448717945 20.607972756410255 55-59 23.887998397114806 27.28411140052094 28.245842516529752 20.5820476858345 60-64 23.497596153846153 27.604166666666668 28.13000801282051 20.768229166666664 65-69 23.48875644813943 27.02459057444784 28.887664646666998 20.59898833074573 70-74 24.01081839126515 27.47170189321847 27.88740859461084 20.630071120905537 75-79 23.573896929934392 27.92106976511243 27.800871437872487 20.704161867080686 80-84 23.656667835144475 27.888226751464774 27.928288847713954 20.5268165656768 85-89 24.206309464196295 28.03204807210816 27.706559839759638 20.055082623935906 90-94 23.661407463060353 27.783621337340346 27.948910593538695 20.606060606060606 95-99 23.87057998597616 27.90243413803466 27.757187218271064 20.469798657718123 100-104 24.56298522414225 27.232657150012525 27.838717756073127 20.3656398697721 105-109 24.060903536011217 27.937493739356906 27.77221276169488 20.22938996293699 110-114 24.441438733593827 27.792806332030857 27.722673078849812 20.0430818555255 115-119 24.48284497871275 28.029050838968196 27.72852491860756 19.759579263711498 120-124 24.623090408214377 27.793638868019034 27.793638868019034 19.789631855747558 125-129 25.58978211870774 28.379664412722267 26.601552717255196 19.429000751314803 130-134 25.83763209295337 27.370160765262685 26.98452446536786 19.807682676416086 135-139 25.499624342599546 27.347858752817427 27.122464312546956 20.030052592036064 140-144 25.881586856341414 27.945301542777003 26.352434381887395 19.82067721899419 145-149 26.347155448717945 27.463942307692307 26.85296474358974 19.3359375 150-151 25.98898347521282 27.954431647471207 26.852779168753127 19.203805708562843 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 0.5 24 0.5 25 2.0 26 4.0 27 5.0 28 5.0 29 9.0 30 13.0 31 21.0 32 26.5 33 36.5 34 52.5 35 67.5 36 88.5 37 113.5 38 133.0 39 147.0 40 181.0 41 217.5 42 237.0 43 243.5 44 265.0 45 293.5 46 280.5 47 254.5 48 227.5 49 202.5 50 179.5 51 153.0 52 122.0 53 94.0 54 83.0 55 62.5 56 44.0 57 36.5 58 27.0 59 17.5 60 17.5 61 13.0 62 3.5 63 1.0 64 0.5 65 2.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.15 4 0.125 5 0.125 6 0.075 7 0.05 8 0.075 9 0.075 10-14 0.075 15-19 0.095 20-24 0.13999999999999999 25-29 0.155 30-34 0.15 35-39 0.17500000000000002 40-44 0.165 45-49 0.165 50-54 0.16 55-59 0.18 60-64 0.16 65-69 0.165 70-74 0.16999999999999998 75-79 0.165 80-84 0.155 85-89 0.15 90-94 0.17500000000000002 95-99 0.16999999999999998 100-104 0.17500000000000002 105-109 0.16999999999999998 110-114 0.19 115-119 0.17500000000000002 120-124 0.17500000000000002 125-129 0.17500000000000002 130-134 0.165 135-139 0.17500000000000002 140-144 0.18 145-149 0.16 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0357777213905 97.575 2 0.8119766556711495 1.6 3 0.10149708195889369 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025374270489723422 0.22499999999999998 >10 0.025374270489723422 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 12 0.3 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.5625 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.1624999999999996 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.7125 0.0 0.0 0.0 0.0 112-113 4.275 0.0 0.0 0.0 0.0 114-115 4.8 0.0 0.0 0.0 0.0 116-117 5.5 0.0 0.0 0.0 0.0 118-119 6.3 0.0 0.0 0.0 0.0 120-121 6.8875 0.0 0.0 0.0 0.0 122-123 7.4875 0.0 0.0 0.0 0.0 124-125 8.025 0.0 0.0 0.0 0.0 126-127 8.587499999999999 0.0 0.0 0.0 0.0 128-129 9.3125 0.0 0.0 0.0 0.0 130-131 10.212499999999999 0.0 0.0 0.0 0.0 132-133 10.8625 0.0 0.0 0.0 0.0 134-135 11.6125 0.0 0.0 0.0 0.0 136-137 12.5875 0.0 0.0 0.0 0.0 138-139 13.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910556 spots for SRR7170805.sra Written 910556 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra Read 910541 spots for SRR7170805.sra Written 910541 spots for SRR7170805.sra SRR ids: ['SRR7170805.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rrt0kmyb SRR7170805.sra spots: 18210835 blocks: [[1, 910541], [910542, 1821082], [1821083, 2731623], [2731624, 3642164], [3642165, 4552705], [4552706, 5463246], [5463247, 6373787], [6373788, 7284328], [7284329, 8194869], [8194870, 9105410], [9105411, 10015951], [10015952, 10926492], [10926493, 11837033], [11837034, 12747574], [12747575, 13658115], [13658116, 14568656], [14568657, 15479197], [15479198, 16389738], [16389739, 17300279], [17300280, 18210835]] SRR7170805 file size 6149354 SRR7170805 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170805 SRR7170805_1.fastq SRR7170805_2.fastq Input file: SRR7170805_1.fastq Paired file: SRR7170805_2.fastq trimmed: SRR7170805-trimmed-pair1.fastq, SRR7170805-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:21:45 2025 >> started Thu Feb 13 16:22:08 2025 >> done (22.906s) 18210835 read pairs processed; of these: 17198 ( 0.09%) short read pairs filtered out after trimming by size control 62324 ( 0.34%) empty read pairs filtered out after trimming by size control 18131313 (99.56%) read pairs available; of these: 12758232 (70.37%) trimmed read pairs available after processing 5373081 (29.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 18 0.00% 20 9 0.00% 21 11 0.00% 22 13 0.00% 23 13 0.00% 24 15 0.00% 25 12 0.00% 26 21 0.00% 27 28 0.00% 28 16 0.00% 29 22 0.00% 30 35 0.00% 31 18 0.00% 32 24 0.00% 33 22 0.00% 34 17 0.00% 35 31 0.00% 36 28 0.00% 37 51 0.00% 38 46 0.00% 39 57 0.00% 40 49 0.00% 41 54 0.00% 42 67 0.00% 43 78 0.00% 44 84 0.00% 45 99 0.00% 46 103 0.00% 47 125 0.00% 48 143 0.00% 49 198 0.00% 50 208 0.00% 51 237 0.00% 52 288 0.00% 53 308 0.00% 54 317 0.00% 55 355 0.00% 56 404 0.00% 57 472 0.00% 58 507 0.00% 59 636 0.00% 60 762 0.00% 61 887 0.00% 62 980 0.01% 63 1090 0.01% 64 1246 0.01% 65 1245 0.01% 66 1412 0.01% 67 1589 0.01% 68 1754 0.01% 69 2099 0.01% 70 2406 0.01% 71 2856 0.02% 72 3366 0.02% 73 3723 0.02% 74 4141 0.02% 75 4681 0.03% 76 6360 0.04% 77 6960 0.04% 78 6376 0.04% 79 6572 0.04% 80 7250 0.04% 81 8181 0.05% 82 9657 0.05% 83 11091 0.06% 84 13524 0.07% 85 13270 0.07% 86 14215 0.08% 87 15219 0.08% 88 15980 0.09% 89 16642 0.09% 90 18100 0.10% 91 19503 0.11% 92 21332 0.12% 93 23543 0.13% 94 25145 0.14% 95 26842 0.15% 96 27869 0.15% 97 28733 0.16% 98 29953 0.17% 99 31100 0.17% 100 33299 0.18% 101 34679 0.19% 102 37144 0.20% 103 40019 0.22% 104 42372 0.23% 105 44291 0.24% 106 45717 0.25% 107 47027 0.26% 108 48264 0.27% 109 49498 0.27% 110 51417 0.28% 111 53698 0.30% 112 56125 0.31% 113 58303 0.32% 114 61593 0.34% 115 64463 0.36% 116 66145 0.36% 117 68347 0.38% 118 69711 0.38% 119 70381 0.39% 120 73267 0.40% 121 75996 0.42% 122 78077 0.43% 123 81898 0.45% 124 85201 0.47% 125 88689 0.49% 126 92642 0.51% 127 95341 0.53% 128 97531 0.54% 129 101334 0.56% 130 104521 0.58% 131 107990 0.60% 132 113580 0.63% 133 118784 0.66% 134 125987 0.69% 135 133491 0.74% 136 140702 0.78% 137 150015 0.83% 138 159787 0.88% 139 169282 0.93% 140 180202 0.99% 141 195673 1.08% 142 216847 1.20% 143 243804 1.34% 144 280335 1.55% 145 328826 1.81% 146 404038 2.23% 147 531801 2.93% 148 785544 4.33% 149 1432034 7.90% 150 4479617 24.71% 151 5373081 29.63% 18131313 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=73.61 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=14 prefix-density=0.61 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=30.37 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.7 sequence=TTTATAGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATG SRR7170805 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:22:52 Started mapping on | Feb 13 16:22:53 Finished on | Feb 13 16:25:02 Mapping speed, Million of reads per hour | 505.99 Number of input reads | 18131313 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 17202606 Uniquely mapped reads % | 94.88% Average mapped length | 285.84 Number of splices: Total | 14854259 Number of splices: Annotated (sjdb) | 14476554 Number of splices: GT/AG | 14568644 Number of splices: GC/AG | 219541 Number of splices: AT/AC | 10592 Number of splices: Non-canonical | 55482 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.04% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 532415 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 32568 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.95% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411862 411862 411862 N_multimapping 532415 532415 532415 N_noFeature 596999 16764011 803850 N_ambiguous 378436 1921 145473 UnstrandedReadsAssigned:16227171 PositiveStrandReadsAssigned:436674 NegativeStrandReadsAssigned:16253283 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170805 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170805-trimmed-pair1.fastq SRR7170805-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,131,313 reads, 16,249,917 reads pseudoaligned [quant] estimated average fragment length: 218.197 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,232 rounds 52401 SRR7170805.ke.tsv 34699 SRR7170805.se.tsv 87100 total ==> SRR7170805.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.8 825 22.9821 Potri.005G024800.1.v4.1 1035 817.803 256 15.7034 Potri.004G059700.1.v4.1 961 743.827 14 0.944188 Potri.007G009000.2.v4.1 1416 1198.8 0 0 Potri.003G141000.2.v4.1 2943 2725.8 949.831 17.4805 Potri.016G087400.1.v4.1 270 95.3391 840 441.988 Potri.015G069301.1.v4.1 564 350.959 0 0 Potri.010G195200.1.v4.1 1773 1555.8 168 5.41698 Potri.012G127500.1.v4.1 977 759.827 536 35.3877 ==> SRR7170805.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 776 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 441 Potri.001G212900.v4.1 93 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7170805 completed mapping pipeline successfully