Starting /dee2/code/volunteer_pipeline.sh SRR7170806 current disk space = 3088920485888 free memory = 1441099012 SRR7170806 SRAfilesize e9932e048220a37a7a42ed4f750dabbf SRR7170806.sra SRR7170806.sra file validated SRR7170806 is paired end SRR7170806 is conventional basespace SRR7170806 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170806_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6485 34.0 33.0 34.0 32.0 34.0 2 33.253 34.0 33.0 34.0 33.0 34.0 3 33.218 34.0 33.0 34.0 33.0 34.0 4 33.3175 34.0 33.0 34.0 33.0 34.0 5 33.33875 34.0 33.0 34.0 33.0 34.0 6 36.822 38.0 37.0 38.0 35.0 38.0 7 37.2455 38.0 38.0 38.0 36.0 38.0 8 37.39225 38.0 38.0 38.0 37.0 38.0 9 37.4305 38.0 38.0 38.0 37.0 38.0 10-14 37.395500000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.32945 38.0 38.0 38.0 37.0 38.0 20-24 37.32845 38.0 38.0 38.0 37.0 38.0 25-29 37.2727 38.0 38.0 38.0 37.0 38.0 30-34 37.18645 38.0 38.0 38.0 36.0 38.0 35-39 37.11815 38.0 38.0 38.0 36.0 38.0 40-44 37.001149999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.859350000000006 38.0 38.0 38.0 35.4 38.0 50-54 36.8498 38.0 38.0 38.0 35.2 38.0 55-59 36.773649999999996 38.0 38.0 38.0 35.0 38.0 60-64 36.608900000000006 38.0 38.0 38.0 34.4 38.0 65-69 36.6614 38.0 38.0 38.0 34.8 38.0 70-74 36.61749999999999 38.0 38.0 38.0 34.4 38.0 75-79 36.214099999999995 38.0 37.6 38.0 33.8 38.0 80-84 35.92355 38.0 37.0 38.0 32.4 38.0 85-89 35.965149999999994 38.0 37.0 38.0 32.6 38.0 90-94 35.78484999999999 38.0 37.0 38.0 32.6 38.0 95-99 35.72109999999999 38.0 37.0 38.0 31.6 38.0 100-104 35.32935 38.0 36.0 38.0 29.4 38.0 105-109 35.25045 38.0 36.0 38.0 29.0 38.0 110-114 34.87095000000001 38.0 35.6 38.0 28.0 38.0 115-119 34.634 38.0 34.6 38.0 26.8 38.0 120-124 34.3097 38.0 34.2 38.0 24.8 38.0 125-129 33.7593 38.0 33.2 38.0 21.8 38.0 130-134 33.12185 38.0 33.0 38.0 17.4 38.0 135-139 32.4216 38.0 32.0 38.0 14.0 38.0 140-144 31.23555 36.4 29.8 38.0 12.8 38.0 145-149 29.728949999999998 36.0 27.8 38.0 4.0 38.0 150-151 23.676625 30.5 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 2.0 10 2.0 11 0.0 12 2.0 13 2.0 14 5.0 15 2.0 16 1.0 17 3.0 18 6.0 19 18.0 20 4.0 21 11.0 22 11.0 23 17.0 24 13.0 25 27.0 26 26.0 27 31.0 28 43.0 29 58.0 30 67.0 31 74.0 32 113.0 33 164.0 34 270.0 35 447.0 36 1093.0 37 1484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.54121863799283 12.23758320532514 18.63799283154122 37.58320532514081 2 20.349999999999998 18.45 35.75 25.45 3 20.724999999999998 24.025 27.325 27.925 4 22.325 31.974999999999998 23.625 22.075 5 21.4 34.65 25.45 18.5 6 19.2 33.900000000000006 25.874999999999996 21.025 7 14.124999999999998 21.925 44.824999999999996 19.125 8 18.175 25.45 29.549999999999997 26.825 9 18.425 24.45 33.025 24.099999999999998 10-14 19.515 29.485 27.525 23.474999999999998 15-19 19.575 29.115000000000002 27.935 23.375 20-24 19.634999999999998 28.689999999999998 27.935 23.74 25-29 19.575 28.415000000000003 28.315 23.695 30-34 19.145 28.71 28.73 23.415 35-39 19.6 28.175 27.935 24.29 40-44 19.325 28.544999999999998 28.375 23.755000000000003 45-49 19.564999999999998 28.58 28.04 23.815 50-54 19.29 28.050000000000004 28.439999999999998 24.22 55-59 19.064999999999998 28.244999999999997 28.689999999999998 24.0 60-64 19.215 28.43 28.27 24.085 65-69 19.38 29.085 27.875 23.66 70-74 19.78 28.915000000000003 27.93 23.375 75-79 19.18 28.845 28.13 23.845 80-84 19.345000000000002 28.744999999999997 27.71 24.2 85-89 19.96 27.985 28.71 23.345 90-94 19.985 28.084999999999997 27.834999999999997 24.095 95-99 19.605 28.08 28.15 24.165 100-104 19.705000000000002 28.95 27.839999999999996 23.505000000000003 105-109 20.14 29.085 27.755000000000003 23.02 110-114 20.095 28.16 27.96 23.785 115-119 19.895 28.499999999999996 27.800000000000004 23.805 120-124 20.535 28.810000000000002 27.500000000000004 23.155 125-129 20.395 28.09 27.839999999999996 23.674999999999997 130-134 20.044999999999998 28.01 28.285 23.66 135-139 19.725 28.685 27.615000000000002 23.974999999999998 140-144 20.225 27.85 28.04 23.885 145-149 20.674999999999997 28.060000000000002 27.71 23.555 150-151 20.525 27.6625 28.237499999999997 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.5 17 2.5 18 2.0 19 0.0 20 1.5 21 3.0 22 2.5 23 2.0 24 3.0 25 6.0 26 7.0 27 7.0 28 15.5 29 21.5 30 26.5 31 31.0 32 28.0 33 42.5 34 62.0 35 76.0 36 95.5 37 123.0 38 152.5 39 183.0 40 202.5 41 223.5 42 247.5 43 261.0 44 259.5 45 259.0 46 268.0 47 241.5 48 218.0 49 191.5 50 160.5 51 136.5 52 106.5 53 82.0 54 62.0 55 48.5 56 33.0 57 25.5 58 21.0 59 15.5 60 13.0 61 9.5 62 6.0 63 4.0 64 2.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39317319848293 98.275 2 0.5309734513274336 1.05 3 0.05056890012642225 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 21 0.525 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.8 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 0.9625 0.0 0.0 0.0 0.0 122-123 1.05 0.0 0.0 0.0 0.0 124-125 1.15 0.0 0.0 0.0 0.0 126-127 1.2625 0.0 0.0 0.0 0.0 128-129 1.425 0.0 0.0 0.0 0.0 130-131 1.5875 0.0 0.0 0.0 0.0 132-133 1.7125 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACCAA 10 0.006830828 145.0 8 GTACTCA 10 0.006830828 145.0 8 AGCAAGC 10 0.006830828 145.0 5 >>END_MODULE SRR7170806 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170806_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.635 33.0 33.0 34.0 32.0 34.0 2 32.79875 33.0 33.0 34.0 32.0 34.0 3 32.8455 34.0 33.0 34.0 32.0 34.0 4 32.75625 34.0 33.0 34.0 32.0 34.0 5 32.72775 34.0 33.0 34.0 32.0 34.0 6 36.8715 38.0 38.0 38.0 36.0 38.0 7 36.871 38.0 38.0 38.0 36.0 38.0 8 36.989 38.0 38.0 38.0 36.0 38.0 9 36.92625 38.0 38.0 38.0 37.0 38.0 10-14 36.854099999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.8438 38.0 38.0 38.0 36.0 38.0 20-24 36.710950000000004 38.0 38.0 38.0 36.0 38.0 25-29 36.679050000000004 38.0 38.0 38.0 35.8 38.0 30-34 36.684749999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.65745 38.0 38.0 38.0 35.8 38.0 40-44 36.60575 38.0 38.0 38.0 35.2 38.0 45-49 36.606049999999996 38.0 38.0 38.0 35.2 38.0 50-54 36.53915 38.0 38.0 38.0 35.0 38.0 55-59 36.4464 38.0 38.0 38.0 34.6 38.0 60-64 36.3908 38.0 38.0 38.0 34.2 38.0 65-69 36.351749999999996 38.0 38.0 38.0 34.0 38.0 70-74 36.29455 38.0 38.0 38.0 34.0 38.0 75-79 36.17295 38.0 38.0 38.0 33.6 38.0 80-84 35.97475 38.0 38.0 38.0 33.0 38.0 85-89 35.888850000000005 38.0 38.0 38.0 33.0 38.0 90-94 35.6625 38.0 37.0 38.0 31.2 38.0 95-99 35.5875 38.0 37.0 38.0 31.0 38.0 100-104 35.253949999999996 38.0 36.8 38.0 28.8 38.0 105-109 35.11710000000001 38.0 36.4 38.0 28.6 38.0 110-114 34.9188 38.0 36.0 38.0 27.8 38.0 115-119 34.623900000000006 38.0 36.0 38.0 26.6 38.0 120-124 34.339 38.0 35.2 38.0 24.8 38.0 125-129 33.8135 38.0 34.6 38.0 21.0 38.0 130-134 33.1773 38.0 33.2 38.0 16.2 38.0 135-139 32.480549999999994 38.0 33.0 38.0 13.8 38.0 140-144 31.61805 38.0 31.8 38.0 12.2 38.0 145-149 30.417099999999998 37.4 28.8 38.0 3.8 38.0 150-151 25.245624999999997 32.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 6.0 4 2.0 5 0.0 6 1.0 7 2.0 8 1.0 9 3.0 10 1.0 11 2.0 12 2.0 13 4.0 14 4.0 15 3.0 16 7.0 17 6.0 18 10.0 19 19.0 20 21.0 21 19.0 22 15.0 23 17.0 24 27.0 25 32.0 26 30.0 27 28.0 28 42.0 29 47.0 30 57.0 31 70.0 32 95.0 33 111.0 34 172.0 35 330.0 36 804.0 37 1993.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.25 16.2 25.7 28.849999999999998 2 26.338169084542272 22.586293146573286 33.616808404202104 17.45872936468234 3 22.086043021510758 27.088544272136065 31.390695347673837 19.43471735867934 4 23.686843421710854 32.06603301650826 23.51175587793897 20.735367683841922 5 22.81711283462597 36.35226419814861 22.66700025018764 18.16362271703778 6 20.075000000000003 35.15 25.775 19.0 7 19.35 19.075 40.5 21.075 8 21.65 25.25 26.325 26.775 9 20.5 25.775 28.525 25.2 10-14 23.021151057552878 28.381419070953545 26.181309065453274 22.4161208060403 15-19 22.953443016452468 27.69415412311847 28.63929589438416 20.713106966044904 20-24 22.57677303190957 28.428528558567574 28.258477543262977 20.736220866259877 25-29 22.026519889917438 29.211908931698776 27.78083562672004 20.98073555166375 30-34 22.408963585434176 28.141256502601042 28.501400560224088 20.948379351740694 35-39 22.496749024707412 28.32349704911473 27.838351505451637 21.34140242072622 40-44 23.096548274137067 28.21910955477739 28.114057028514257 20.570285142571283 45-49 22.787975791527035 27.719701895663484 28.484969739408793 21.007352573400688 50-54 22.767968789076175 27.76471765117791 28.690041514530083 20.777272045215824 55-59 23.475868967241812 27.82195548887222 27.926981745436358 20.775193798449614 60-64 22.850712678169543 27.991997999499873 28.157039259814955 21.00025006251563 65-69 23.026908072421726 27.70331099329799 28.543563068920676 20.726217865359608 70-74 22.431729518855654 28.283485045513657 28.178453536060815 21.10633189956987 75-79 23.165791447861967 28.687171792948234 27.671917979494875 20.475118779694924 80-84 23.10193057917375 28.888666599979995 27.348204461338398 20.66119835950785 85-89 22.97844676701505 28.359253888083213 27.889183377506626 20.77311596739511 90-94 23.049609921984395 28.445689137827568 27.355471094218842 21.149229845969195 95-99 23.306165308265413 28.48642432121606 27.721386069303467 20.48602430121506 100-104 23.36967393478696 28.650730146029208 27.640528105621126 20.33906781356271 105-109 23.50587646911728 28.70217554388597 27.211802950737685 20.580145036259065 110-114 23.158473771065662 28.519277891683753 27.819172875931393 20.5030754613192 115-119 23.835958989747436 28.207051762940733 27.776944236059016 20.180045011252815 120-124 23.459691938387678 28.555711142228446 27.335467093418686 20.649129825965193 125-129 23.470867716929234 28.822205551387846 27.336834208552137 20.370092523130783 130-134 23.092309230923092 28.38783878387839 28.112811281128113 20.407040704070408 135-139 23.520880220055012 28.18704676169042 27.581895473868467 20.710177544386095 140-144 24.016004001000248 28.20205051262816 27.406851712928233 20.37509377344336 145-149 23.53470694138828 28.470694138827767 27.68553710742148 20.309061812362472 150-151 24.04050506313289 27.853481685210653 28.103512939117394 20.002500312539066 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 1.0 23 2.0 24 2.5 25 4.5 26 5.0 27 4.5 28 10.5 29 15.0 30 18.5 31 23.5 32 25.5 33 35.0 34 48.0 35 64.5 36 87.5 37 108.0 38 144.5 39 177.5 40 205.0 41 236.5 42 252.0 43 262.5 44 282.0 45 276.5 46 269.5 47 264.5 48 238.0 49 208.0 50 158.5 51 130.0 52 102.5 53 73.0 54 71.0 55 53.0 56 33.5 57 27.0 58 18.0 59 14.5 60 13.0 61 11.0 62 7.0 63 3.0 64 2.0 65 1.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.05 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.015 20-24 0.03 25-29 0.075 30-34 0.04 35-39 0.03 40-44 0.05 45-49 0.034999999999999996 50-54 0.034999999999999996 55-59 0.025 60-64 0.025 65-69 0.03 70-74 0.03 75-79 0.025 80-84 0.03 85-89 0.015 90-94 0.02 95-99 0.005 100-104 0.02 105-109 0.025 110-114 0.015 115-119 0.025 120-124 0.02 125-129 0.025 130-134 0.01 135-139 0.025 140-144 0.025 145-149 0.02 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46916076845298 98.375 2 0.40444893832153694 0.8 3 0.05055611729019212 0.15 4 0.05055611729019212 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02527805864509606 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 19 0.475 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1375000000000002 0.0 0.0 0.0 0.0 126-127 1.2625 0.0 0.0 0.0 0.0 128-129 1.45 0.0 0.0 0.0 0.0 130-131 1.6375000000000002 0.0 0.0 0.0 0.0 132-133 1.7625 0.0 0.0 0.0 0.0 134-135 1.8875 0.0 0.0 0.0 0.0 136-137 1.975 0.0 0.0 0.0 0.0 138-139 2.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra Read 493314 spots for SRR7170806.sra Written 493314 spots for SRR7170806.sra Read 493299 spots for SRR7170806.sra Written 493299 spots for SRR7170806.sra SRR ids: ['SRR7170806.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zhyiph7a SRR7170806.sra spots: 9865995 blocks: [[1, 493299], [493300, 986598], [986599, 1479897], [1479898, 1973196], [1973197, 2466495], [2466496, 2959794], [2959795, 3453093], [3453094, 3946392], [3946393, 4439691], [4439692, 4932990], [4932991, 5426289], [5426290, 5919588], [5919589, 6412887], [6412888, 6906186], [6906187, 7399485], [7399486, 7892784], [7892785, 8386083], [8386084, 8879382], [8879383, 9372681], [9372682, 9865995]] SRR7170806 file size 3321823 SRR7170806 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170806 SRR7170806_1.fastq SRR7170806_2.fastq Input file: SRR7170806_1.fastq Paired file: SRR7170806_2.fastq trimmed: SRR7170806-trimmed-pair1.fastq, SRR7170806-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:13:58 2025 >> started Thu Feb 13 16:14:09 2025 >> done (10.943s) 9865995 read pairs processed; of these: 25773 ( 0.26%) short read pairs filtered out after trimming by size control 80777 ( 0.82%) empty read pairs filtered out after trimming by size control 9759445 (98.92%) read pairs available; of these: 6454449 (66.14%) trimmed read pairs available after processing 3304996 (33.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 11 0.00% 21 16 0.00% 22 9 0.00% 23 20 0.00% 24 19 0.00% 25 19 0.00% 26 15 0.00% 27 11 0.00% 28 12 0.00% 29 9 0.00% 30 14 0.00% 31 14 0.00% 32 12 0.00% 33 20 0.00% 34 15 0.00% 35 34 0.00% 36 18 0.00% 37 19 0.00% 38 23 0.00% 39 34 0.00% 40 31 0.00% 41 32 0.00% 42 40 0.00% 43 48 0.00% 44 41 0.00% 45 51 0.00% 46 73 0.00% 47 84 0.00% 48 82 0.00% 49 76 0.00% 50 99 0.00% 51 99 0.00% 52 104 0.00% 53 103 0.00% 54 123 0.00% 55 149 0.00% 56 135 0.00% 57 149 0.00% 58 194 0.00% 59 190 0.00% 60 236 0.00% 61 356 0.00% 62 303 0.00% 63 375 0.00% 64 274 0.00% 65 260 0.00% 66 305 0.00% 67 325 0.00% 68 359 0.00% 69 390 0.00% 70 472 0.00% 71 559 0.01% 72 751 0.01% 73 864 0.01% 74 946 0.01% 75 1289 0.01% 76 2938 0.03% 77 3730 0.04% 78 1964 0.02% 79 1431 0.01% 80 1389 0.01% 81 1501 0.02% 82 1646 0.02% 83 2142 0.02% 84 3228 0.03% 85 2870 0.03% 86 2783 0.03% 87 2864 0.03% 88 2968 0.03% 89 3045 0.03% 90 3152 0.03% 91 3186 0.03% 92 3345 0.03% 93 3460 0.04% 94 3625 0.04% 95 3768 0.04% 96 3768 0.04% 97 4001 0.04% 98 4211 0.04% 99 4486 0.05% 100 4660 0.05% 101 4928 0.05% 102 5293 0.05% 103 5383 0.06% 104 6007 0.06% 105 6188 0.06% 106 6503 0.07% 107 6919 0.07% 108 7238 0.07% 109 7635 0.08% 110 8144 0.08% 111 8764 0.09% 112 9223 0.09% 113 9812 0.10% 114 10509 0.11% 115 11054 0.11% 116 12203 0.13% 117 12728 0.13% 118 13498 0.14% 119 14252 0.15% 120 15397 0.16% 121 16586 0.17% 122 17943 0.18% 123 19121 0.20% 124 20415 0.21% 125 21791 0.22% 126 23329 0.24% 127 25712 0.26% 128 27788 0.28% 129 29619 0.30% 130 32112 0.33% 131 34827 0.36% 132 37815 0.39% 133 41492 0.43% 134 45182 0.46% 135 50440 0.52% 136 55434 0.57% 137 61793 0.63% 138 67801 0.69% 139 76346 0.78% 140 85613 0.88% 141 97714 1.00% 142 112695 1.15% 143 131975 1.35% 144 156818 1.61% 145 191390 1.96% 146 244838 2.51% 147 330825 3.39% 148 499979 5.12% 149 917456 9.40% 150 2711438 27.78% 151 3304996 33.86% 9759445 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.42 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=15.41 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.1 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=12 prefix-density=0.37 prefix-fanout=2.8 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=33.58 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=11.6 sequence=TGATGTTGTTGCTG SRR7170806 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:14:51 Started mapping on | Feb 13 16:14:51 Finished on | Feb 13 16:15:55 Mapping speed, Million of reads per hour | 548.97 Number of input reads | 9759445 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9157048 Uniquely mapped reads % | 93.83% Average mapped length | 293.30 Number of splices: Total | 9243791 Number of splices: Annotated (sjdb) | 9031290 Number of splices: GT/AG | 9073703 Number of splices: GC/AG | 134300 Number of splices: AT/AC | 5572 Number of splices: Non-canonical | 30216 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 256392 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 14133 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.34% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 365883 365883 365883 N_multimapping 256392 256392 256392 N_noFeature 325056 9035074 356198 N_ambiguous 159062 536 67971 UnstrandedReadsAssigned:8672930 PositiveStrandReadsAssigned:121438 NegativeStrandReadsAssigned:8732879 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170806 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170806-trimmed-pair1.fastq SRR7170806-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,759,445 reads, 8,675,601 reads pseudoaligned [quant] estimated average fragment length: 300.28 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR7170806.ke.tsv 34699 SRR7170806.se.tsv 87100 total ==> SRR7170806.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1718.72 476 28.838 Potri.005G024800.1.v4.1 1035 735.72 141 19.9558 Potri.004G059700.1.v4.1 961 661.79 3 0.472024 Potri.007G009000.2.v4.1 1416 1116.72 0 0 Potri.003G141000.2.v4.1 2943 2643.72 633.407 24.9477 Potri.016G087400.1.v4.1 270 62.528 806 1342.22 Potri.015G069301.1.v4.1 564 274.548 0 0 Potri.010G195200.1.v4.1 1773 1473.72 194 13.7072 Potri.012G127500.1.v4.1 977 677.753 157 24.1208 ==> SRR7170806.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 387 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 206 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 20 SRR7170806 completed mapping pipeline successfully