Starting /dee2/code/volunteer_pipeline.sh SRR7170808 current disk space = 3088867975168 free memory = 1494308452 SRR7170808 SRAfilesize d04e8adf8e306a79d6d46482dddfbc01 SRR7170808.sra SRR7170808.sra file validated SRR7170808 is paired end SRR7170808 is conventional basespace SRR7170808 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170808_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.936 34.0 33.0 34.0 32.0 34.0 2 33.225 34.0 33.0 34.0 32.0 34.0 3 33.25075 34.0 33.0 34.0 31.0 34.0 4 33.43 34.0 33.0 34.0 33.0 34.0 5 33.49575 34.0 33.0 34.0 33.0 34.0 6 37.074 38.0 37.0 38.0 36.0 38.0 7 37.3805 38.0 38.0 38.0 37.0 38.0 8 37.43375 38.0 38.0 38.0 37.0 38.0 9 37.5805 38.0 38.0 38.0 38.0 38.0 10-14 37.56614999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.57395000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.5226 38.0 38.0 38.0 38.0 38.0 25-29 37.5118 38.0 38.0 38.0 38.0 38.0 30-34 37.461499999999994 38.0 38.0 38.0 37.2 38.0 35-39 37.4202 38.0 38.0 38.0 37.2 38.0 40-44 37.172399999999996 38.0 38.0 38.0 36.6 38.0 45-49 37.28465 38.0 38.0 38.0 37.0 38.0 50-54 37.16875 38.0 38.0 38.0 36.4 38.0 55-59 37.0509 38.0 38.0 38.0 36.2 38.0 60-64 37.00055 38.0 38.0 38.0 36.0 38.0 65-69 37.04475000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.91095 38.0 38.0 38.0 35.8 38.0 75-79 35.71605 38.0 38.0 38.0 33.2 38.0 80-84 35.22615 38.0 38.0 38.0 31.4 38.0 85-89 35.16735 38.0 38.0 38.0 31.4 38.0 90-94 35.03035 38.0 37.8 38.0 30.2 38.0 95-99 34.94085 38.0 37.0 38.0 29.2 38.0 100-104 34.90984999999999 38.0 37.0 38.0 29.0 38.0 105-109 34.74499999999999 38.0 37.0 38.0 28.4 38.0 110-114 34.6645 38.0 36.8 38.0 28.2 38.0 115-119 34.3586 38.0 36.0 38.0 25.8 38.0 120-124 34.231100000000005 38.0 36.0 38.0 24.4 38.0 125-129 33.895950000000006 38.0 35.6 38.0 21.8 38.0 130-134 33.52625 38.0 34.4 38.0 17.4 38.0 135-139 33.150000000000006 38.0 34.4 38.0 14.2 38.0 140-144 32.7127 38.0 33.0 38.0 13.0 38.0 145-149 32.01335 38.0 33.0 38.0 10.8 38.0 150-151 27.77 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 3.0 13 1.0 14 3.0 15 2.0 16 4.0 17 11.0 18 23.0 19 128.0 20 14.0 21 4.0 22 7.0 23 8.0 24 6.0 25 15.0 26 8.0 27 21.0 28 25.0 29 38.0 30 40.0 31 50.0 32 78.0 33 94.0 34 149.0 35 241.0 36 675.0 37 2346.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.45959463016583 16.68860226375362 9.686759673598315 27.165043432482232 2 22.45 20.95 31.900000000000002 24.7 3 19.3 25.324999999999996 31.900000000000002 23.474999999999998 4 21.75 30.975 22.475 24.8 5 24.75 35.225 22.45 17.575 6 25.6 33.875 22.425 18.099999999999998 7 16.625 27.625 37.974999999999994 17.775 8 17.1 27.325 28.1 27.474999999999998 9 22.325 22.575 30.049999999999997 25.05 10-14 20.849999999999998 28.89 25.195 25.064999999999998 15-19 21.165 27.445000000000004 27.279999999999998 24.11 20-24 20.515 28.860000000000003 26.700000000000003 23.925 25-29 21.48 27.52 26.200000000000003 24.8 30-34 20.03 28.939999999999998 26.145000000000003 24.884999999999998 35-39 21.93609680484024 28.111405570278514 26.126306315315766 23.826191309565477 40-44 21.34 28.560000000000002 26.6 23.5 45-49 21.456072803640183 27.551377568878443 27.051352567628385 23.941197059852993 50-54 22.555 26.38 26.455000000000002 24.610000000000003 55-59 20.465 27.175 27.91 24.45 60-64 21.095 26.900000000000002 28.12 23.885 65-69 20.935000000000002 31.0 25.095 22.97 70-74 20.43 31.185000000000002 25.31 23.075000000000003 75-79 20.87 30.85 25.855 22.425 80-84 21.115000000000002 30.005 25.365 23.515 85-89 20.915 29.035 26.19 23.86 90-94 21.11 29.459999999999997 25.755 23.674999999999997 95-99 21.25 29.38 25.929999999999996 23.44 100-104 21.725 29.485 25.46 23.330000000000002 105-109 22.259999999999998 29.215000000000003 25.465 23.06 110-114 21.785 29.205 25.290000000000003 23.72 115-119 21.58 29.325000000000003 24.895 24.2 120-124 22.005 29.29 24.545 24.16 125-129 21.46 29.354999999999997 24.93 24.255 130-134 21.625 29.37 24.82 24.185000000000002 135-139 21.740000000000002 29.435 25.115 23.71 140-144 21.740000000000002 29.244999999999997 24.925 24.09 145-149 22.33 28.76 24.98 23.93 150-151 22.4875 29.262500000000003 24.3125 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.0 23 2.5 24 3.0 25 3.0 26 3.5 27 5.5 28 9.0 29 11.5 30 17.0 31 24.0 32 33.0 33 47.0 34 65.0 35 74.0 36 86.0 37 111.0 38 135.5 39 149.0 40 158.0 41 174.5 42 195.0 43 207.0 44 218.5 45 227.0 46 228.0 47 214.5 48 212.5 49 205.0 50 180.5 51 159.0 52 144.0 53 140.0 54 121.0 55 98.5 56 76.0 57 59.5 58 50.5 59 44.5 60 32.0 61 21.5 62 15.5 63 9.0 64 6.0 65 3.5 66 2.0 67 2.0 68 1.0 69 1.0 70 1.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 98.48605577689243 92.7 2 1.1952191235059761 2.25 3 0.1593625498007968 0.44999999999999996 4 0.0796812749003984 0.3 5 0.02656042496679947 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02656042496679947 0.4 >50 0.0 0.0 >100 0.02656042496679947 3.775 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 151 3.775 TruSeq Adapter, Index 1 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTATG 16 0.4 TruSeq Adapter, Index 1 (97% over 35bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 5 0.125 TruSeq Adapter, Index 13 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.4625 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.875 0.0 0.0 0.0 0.0 88-89 1.0625 0.0 0.0 0.0 0.0 90-91 1.3 0.0 0.0 0.0 0.0 92-93 1.5750000000000002 0.0 0.0 0.0 0.0 94-95 1.95 0.0 0.0 0.0 0.0 96-97 2.35 0.0 0.0 0.0 0.0 98-99 2.825 0.0 0.0 0.0 0.0 100-101 3.2750000000000004 0.0 0.0 0.0 0.0 102-103 3.8375000000000004 0.0 0.0 0.0 0.0 104-105 4.4 0.0 0.0 0.0 0.0 106-107 4.825 0.0 0.0 0.0 0.0 108-109 5.1625 0.0 0.0 0.0 0.0 110-111 5.675 0.0 0.0 0.0 0.0 112-113 6.1875 0.0 0.0 0.0 0.0 114-115 6.6875 0.0 0.0 0.0 0.0 116-117 7.225 0.0 0.0 0.0 0.0 118-119 7.7875 0.0 0.0 0.0 0.0 120-121 8.35 0.0 0.0 0.0 0.0 122-123 9.100000000000001 0.0 0.0 0.0 0.0 124-125 9.775 0.0 0.0 0.0 0.0 126-127 10.4 0.0 0.0 0.0 0.0 128-129 11.350000000000001 0.0 0.0 0.0 0.0 130-131 12.1 0.0 0.0 0.0 0.0 132-133 12.675 0.0 0.0 0.0 0.0 134-135 13.325 0.0 0.0 0.0 0.0 136-137 13.9375 0.0 0.0 0.0 0.0 138-139 14.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGCTG 10 0.0068343505 144.975 7 ATCAACT 10 0.0068343505 144.975 6 AAAAAAA 95 3.2953707E-5 13.734473 65-69 >>END_MODULE SRR7170808 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170808_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82675 33.0 33.0 34.0 32.0 34.0 2 32.939 34.0 33.0 34.0 32.0 34.0 3 32.87925 34.0 33.0 34.0 32.0 34.0 4 32.8535 34.0 33.0 34.0 32.0 34.0 5 32.87375 34.0 33.0 34.0 33.0 34.0 6 36.96425 38.0 38.0 38.0 37.0 38.0 7 36.99575 38.0 38.0 38.0 37.0 38.0 8 36.94375 38.0 38.0 38.0 37.0 38.0 9 36.9445 38.0 38.0 38.0 37.0 38.0 10-14 36.97155 38.0 38.0 38.0 37.0 38.0 15-19 36.9414 38.0 38.0 38.0 37.0 38.0 20-24 36.9151 38.0 38.0 38.0 37.0 38.0 25-29 36.877300000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.82945 38.0 38.0 38.0 36.6 38.0 35-39 36.75485 38.0 38.0 38.0 36.6 38.0 40-44 36.776599999999995 38.0 38.0 38.0 36.8 38.0 45-49 36.71035 38.0 38.0 38.0 36.4 38.0 50-54 36.719 38.0 38.0 38.0 36.6 38.0 55-59 36.629149999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.5265 38.0 38.0 38.0 35.8 38.0 65-69 36.619550000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.668 38.0 38.0 38.0 36.0 38.0 75-79 36.56465 38.0 38.0 38.0 35.8 38.0 80-84 35.136 38.0 38.0 38.0 31.6 38.0 85-89 34.97089999999999 38.0 38.0 38.0 30.6 38.0 90-94 34.8598 38.0 38.0 38.0 29.8 38.0 95-99 34.6522 38.0 38.0 38.0 28.2 38.0 100-104 34.68365 38.0 38.0 38.0 28.6 38.0 105-109 34.50865 38.0 38.0 38.0 26.8 38.0 110-114 34.41145 38.0 38.0 38.0 26.2 38.0 115-119 34.26215 38.0 37.0 38.0 24.6 38.0 120-124 34.077749999999995 38.0 36.8 38.0 22.6 38.0 125-129 33.80095 38.0 36.0 38.0 17.4 38.0 130-134 33.44685 38.0 35.8 38.0 14.6 38.0 135-139 32.825450000000004 38.0 33.8 38.0 13.4 38.0 140-144 32.464999999999996 38.0 33.0 38.0 12.6 38.0 145-149 31.6351 38.0 33.0 38.0 2.0 38.0 150-151 26.966749999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 6.0 4 3.0 5 1.0 6 4.0 7 1.0 8 1.0 9 6.0 10 3.0 11 1.0 12 8.0 13 12.0 14 10.0 15 8.0 16 10.0 17 7.0 18 13.0 19 25.0 20 124.0 21 5.0 22 14.0 23 6.0 24 18.0 25 14.0 26 15.0 27 22.0 28 21.0 29 24.0 30 31.0 31 41.0 32 41.0 33 70.0 34 89.0 35 205.0 36 465.0 37 2651.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.75 19.275000000000002 12.35 20.625 2 27.3 24.825 29.099999999999998 18.775 3 20.65 23.775 36.15 19.425 4 22.825 31.4 22.575 23.200000000000003 5 27.0 34.775 20.125 18.099999999999998 6 23.75 34.75 21.3 20.200000000000003 7 18.2 24.9 35.525 21.375 8 20.150000000000002 27.175 26.125 26.55 9 24.05 23.674999999999997 27.450000000000003 24.825 10-14 24.14 27.08 25.955000000000002 22.825 15-19 23.849999999999998 26.325 28.544999999999998 21.279999999999998 20-24 24.834999999999997 27.860000000000003 26.605 20.7 25-29 23.865 28.13 26.695 21.310000000000002 30-34 22.79 27.034999999999997 29.065 21.11 35-39 23.04 27.345000000000002 28.405 21.21 40-44 23.805 26.895000000000003 28.175 21.125 45-49 22.8 27.13 27.92 22.15 50-54 23.645 25.674999999999997 28.904999999999998 21.775 55-59 24.385 25.724999999999998 27.13 22.759999999999998 60-64 23.605 26.255 27.345000000000002 22.795 65-69 22.495 25.95 29.48 22.075 70-74 22.535 29.78 26.395000000000003 21.29 75-79 22.585 29.37 26.395000000000003 21.65 80-84 22.53 29.849999999999998 26.5 21.12 85-89 23.525 28.725 26.695 21.055 90-94 23.14 29.085 26.529999999999998 21.245 95-99 23.235 28.4 26.900000000000002 21.465 100-104 24.610000000000003 27.865000000000002 26.224999999999998 21.3 105-109 24.665 27.91 26.38 21.044999999999998 110-114 24.375 28.21 26.915 20.5 115-119 25.14 29.060000000000002 25.679999999999996 20.119999999999997 120-124 24.560000000000002 29.4 26.16 19.88 125-129 24.705 28.825 26.205000000000002 20.265 130-134 25.255 28.189999999999998 26.58 19.975 135-139 25.595000000000002 28.525 26.105 19.775000000000002 140-144 25.480000000000004 28.18 26.840000000000003 19.5 145-149 25.965 28.744999999999997 25.72 19.57 150-151 26.4625 28.325 25.825 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.5 18 0.5 19 1.0 20 2.0 21 2.5 22 2.5 23 1.5 24 2.0 25 5.5 26 7.5 27 5.0 28 6.5 29 10.5 30 14.5 31 23.5 32 26.0 33 31.5 34 55.0 35 78.0 36 93.0 37 109.0 38 125.0 39 147.0 40 171.0 41 181.0 42 196.0 43 225.5 44 232.0 45 220.0 46 227.0 47 223.0 48 203.5 49 198.0 50 180.0 51 141.0 52 132.0 53 134.5 54 116.0 55 97.5 56 78.5 57 69.5 58 57.5 59 41.5 60 34.0 61 26.5 62 20.5 63 15.0 64 10.5 65 5.0 66 1.0 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.85 #Duplication Level Percentage of deduplicated Percentage of total 1 98.16196057538626 92.125 2 1.3052743740010655 2.45 3 0.34629728289824185 0.975 4 0.07991475759190196 0.3 5 0.05327650506126798 0.25 6 0.0 0.0 7 0.0 0.0 8 0.02663825253063399 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.02663825253063399 3.6999999999999997 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 148 3.6999999999999997 Illumina Single End PCR Primer 1 (96% over 32bp) ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCTC 8 0.2 Illumina Single End PCR Primer 1 (96% over 31bp) AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2625 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.42500000000000004 0.0 0.0 0.0 0.0 78-79 0.4875 0.0 0.0 0.0 0.0 80-81 0.5375000000000001 0.0 0.0 0.0 0.0 82-83 0.6125 0.0 0.0 0.0 0.0 84-85 0.7125 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.2875 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.8625 0.0 0.0 0.0 0.0 96-97 2.25 0.0 0.0 0.0 0.0 98-99 2.7125 0.0 0.0 0.0 0.0 100-101 3.1500000000000004 0.0 0.0 0.0 0.0 102-103 3.7125000000000004 0.0 0.0 0.0 0.0 104-105 4.3 0.0 0.0 0.0 0.0 106-107 4.7 0.0 0.0 0.0 0.0 108-109 5.0875 0.0 0.0 0.0 0.0 110-111 5.6375 0.0 0.0 0.0 0.0 112-113 6.1625 0.0 0.0 0.0 0.0 114-115 6.637499999999999 0.0 0.0 0.0 0.0 116-117 7.25 0.0 0.0 0.0 0.0 118-119 7.8125 0.0 0.0 0.0 0.0 120-121 8.3625 0.0 0.0 0.0 0.0 122-123 9.100000000000001 0.0 0.0 0.0 0.0 124-125 9.75 0.0 0.0 0.0 0.0 126-127 10.350000000000001 0.0 0.0 0.0 0.0 128-129 11.274999999999999 0.0 0.0 0.0 0.0 130-131 11.962499999999999 0.0 0.0 0.0 0.0 132-133 12.425 0.0 0.0 0.0 0.0 134-135 13.075 0.0 0.0 0.0 0.0 136-137 13.712499999999999 0.0 0.0 0.0 0.0 138-139 14.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 160 3.9544146E-4 9.0625 70-74 >>END_MODULE Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864592 spots for SRR7170808.sra Written 864592 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra Read 864585 spots for SRR7170808.sra Written 864585 spots for SRR7170808.sra SRR ids: ['SRR7170808.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ow23g37o SRR7170808.sra spots: 17291707 blocks: [[1, 864585], [864586, 1729170], [1729171, 2593755], [2593756, 3458340], [3458341, 4322925], [4322926, 5187510], [5187511, 6052095], [6052096, 6916680], [6916681, 7781265], [7781266, 8645850], [8645851, 9510435], [9510436, 10375020], [10375021, 11239605], [11239606, 12104190], [12104191, 12968775], [12968776, 13833360], [13833361, 14697945], [14697946, 15562530], [15562531, 16427115], [16427116, 17291707]] SRR7170808 file size 5837891 SRR7170808 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170808 SRR7170808_1.fastq SRR7170808_2.fastq Input file: SRR7170808_1.fastq Paired file: SRR7170808_2.fastq trimmed: SRR7170808-trimmed-pair1.fastq, SRR7170808-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:46:58 2025 >> started Thu Feb 13 16:47:16 2025 >> done (18.339s) 17291707 read pairs processed; of these: 43695 ( 0.25%) short read pairs filtered out after trimming by size control 887337 ( 5.13%) empty read pairs filtered out after trimming by size control 16360675 (94.62%) read pairs available; of these: 10687377 (65.32%) trimmed read pairs available after processing 5673298 (34.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 59 0.00% 19 74 0.00% 20 70 0.00% 21 61 0.00% 22 61 0.00% 23 55 0.00% 24 77 0.00% 25 65 0.00% 26 71 0.00% 27 94 0.00% 28 71 0.00% 29 89 0.00% 30 72 0.00% 31 89 0.00% 32 111 0.00% 33 93 0.00% 34 85 0.00% 35 75 0.00% 36 111 0.00% 37 95 0.00% 38 109 0.00% 39 118 0.00% 40 131 0.00% 41 161 0.00% 42 142 0.00% 43 159 0.00% 44 196 0.00% 45 353 0.00% 46 440 0.00% 47 471 0.00% 48 497 0.00% 49 524 0.00% 50 619 0.00% 51 652 0.00% 52 718 0.00% 53 733 0.00% 54 846 0.01% 55 890 0.01% 56 939 0.01% 57 1113 0.01% 58 1247 0.01% 59 1447 0.01% 60 1667 0.01% 61 1876 0.01% 62 2190 0.01% 63 2397 0.01% 64 2577 0.02% 65 2601 0.02% 66 2845 0.02% 67 3009 0.02% 68 3542 0.02% 69 3902 0.02% 70 4709 0.03% 71 5521 0.03% 72 7589 0.05% 73 8181 0.05% 74 9319 0.06% 75 12813 0.08% 76 41680 0.25% 77 55028 0.34% 78 23583 0.14% 79 16038 0.10% 80 15444 0.09% 81 16431 0.10% 82 17698 0.11% 83 19287 0.12% 84 21394 0.13% 85 22639 0.14% 86 22949 0.14% 87 24231 0.15% 88 24746 0.15% 89 26263 0.16% 90 28044 0.17% 91 30007 0.18% 92 32212 0.20% 93 34554 0.21% 94 35765 0.22% 95 37349 0.23% 96 38296 0.23% 97 38059 0.23% 98 37841 0.23% 99 38762 0.24% 100 41151 0.25% 101 42266 0.26% 102 46012 0.28% 103 48279 0.30% 104 49880 0.30% 105 52122 0.32% 106 51140 0.31% 107 51872 0.32% 108 51744 0.32% 109 51959 0.32% 110 53042 0.32% 111 55315 0.34% 112 57600 0.35% 113 61049 0.37% 114 62613 0.38% 115 64931 0.40% 116 66232 0.40% 117 66229 0.40% 118 65523 0.40% 119 66227 0.40% 120 66677 0.41% 121 69404 0.42% 122 70629 0.43% 123 74501 0.46% 124 78749 0.48% 125 80401 0.49% 126 82452 0.50% 127 82758 0.51% 128 83729 0.51% 129 84900 0.52% 130 85396 0.52% 131 87523 0.53% 132 92030 0.56% 133 96956 0.59% 134 100778 0.62% 135 105848 0.65% 136 109691 0.67% 137 114977 0.70% 138 118475 0.72% 139 124691 0.76% 140 131332 0.80% 141 139550 0.85% 142 152722 0.93% 143 171688 1.05% 144 194222 1.19% 145 227184 1.39% 146 278155 1.70% 147 364687 2.23% 148 539820 3.30% 149 1015123 6.20% 150 3770022 23.04% 151 5673298 34.68% 16360675 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=24 prefix-density=0.51 prefix-fanout=2.0 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=28.19 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.3 sequence=TTTTTTGGATTTTTTCCGCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTTCAGCCCTAATTAATGTC criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=24 prefix-density=0.96 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=32.43 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.3 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170808 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:48:03 Started mapping on | Feb 13 16:48:03 Finished on | Feb 13 16:50:50 Mapping speed, Million of reads per hour | 352.69 Number of input reads | 16360675 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 14249445 Uniquely mapped reads % | 87.10% Average mapped length | 284.29 Number of splices: Total | 12561464 Number of splices: Annotated (sjdb) | 12253769 Number of splices: GT/AG | 12318826 Number of splices: GC/AG | 182778 Number of splices: AT/AC | 7139 Number of splices: Non-canonical | 52721 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.03% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481175 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 453406 % of reads mapped to too many loci | 2.77% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.74% % of reads unmapped: other | 0.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1663114 1663114 1663114 N_multimapping 481175 481175 481175 N_noFeature 628488 13873302 818075 N_ambiguous 296255 1973 108064 UnstrandedReadsAssigned:13324702 PositiveStrandReadsAssigned:374170 NegativeStrandReadsAssigned:13323306 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR7170808 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170808-trimmed-pair1.fastq SRR7170808-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,360,675 reads, 13,611,390 reads pseudoaligned [quant] estimated average fragment length: 217.437 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,049 rounds 52401 SRR7170808.ke.tsv 34699 SRR7170808.se.tsv 87100 total ==> SRR7170808.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1801.56 339 11.1896 Potri.005G024800.1.v4.1 1035 818.563 90 6.53817 Potri.004G059700.1.v4.1 961 744.612 2 0.159722 Potri.007G009000.2.v4.1 1416 1199.56 0 0 Potri.003G141000.2.v4.1 2943 2726.56 620 13.522 Potri.016G087400.1.v4.1 270 101.476 1340 785.248 Potri.015G069301.1.v4.1 564 353.862 0 0 Potri.010G195200.1.v4.1 1773 1556.56 35 1.33711 Potri.012G127500.1.v4.1 977 760.597 168 13.1347 ==> SRR7170808.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 153 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 414 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 92 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7170808 completed mapping pipeline successfully