Starting /dee2/code/volunteer_pipeline.sh SRR7170809 current disk space = 3088834052096 free memory = 1475425084 SRR7170809 SRAfilesize a4d043ce7a45e8ff4f4f5c40d9357a0d SRR7170809.sra SRR7170809.sra file validated SRR7170809 is paired end SRR7170809 is conventional basespace SRR7170809 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170809_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95625 34.0 33.0 34.0 32.0 34.0 2 33.25925 34.0 33.0 34.0 33.0 34.0 3 33.1705 34.0 33.0 34.0 31.0 34.0 4 33.337 34.0 33.0 34.0 33.0 34.0 5 33.2765 34.0 33.0 34.0 33.0 34.0 6 36.7555 38.0 37.0 38.0 35.0 38.0 7 37.13725 38.0 38.0 38.0 36.0 38.0 8 37.393 38.0 38.0 38.0 37.0 38.0 9 37.4115 38.0 38.0 38.0 37.0 38.0 10-14 37.380449999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.326299999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.2954 38.0 38.0 38.0 37.0 38.0 25-29 37.2149 38.0 38.0 38.0 36.4 38.0 30-34 37.140049999999995 38.0 38.0 38.0 36.0 38.0 35-39 37.0849 38.0 38.0 38.0 36.0 38.0 40-44 36.95305 38.0 38.0 38.0 35.8 38.0 45-49 36.9116 38.0 38.0 38.0 35.6 38.0 50-54 36.604049999999994 38.0 38.0 38.0 34.4 38.0 55-59 36.5478 38.0 38.0 38.0 34.4 38.0 60-64 36.56645 38.0 38.0 38.0 34.0 38.0 65-69 36.427800000000005 38.0 37.8 38.0 33.8 38.0 70-74 36.36395 38.0 38.0 38.0 34.0 38.0 75-79 36.01584999999999 38.0 37.4 38.0 33.6 38.0 80-84 35.9097 38.0 37.2 38.0 33.0 38.0 85-89 35.6572 38.0 37.0 38.0 31.4 38.0 90-94 35.40995 38.0 36.8 38.0 29.8 38.0 95-99 35.323600000000006 38.0 36.8 38.0 29.8 38.0 100-104 34.763099999999994 38.0 36.0 38.0 26.6 38.0 105-109 34.59915 38.0 35.6 38.0 25.2 38.0 110-114 34.30544999999999 38.0 34.4 38.0 24.8 38.0 115-119 33.8808 38.0 33.8 38.0 22.4 38.0 120-124 33.24955 38.0 33.0 38.0 18.8 38.0 125-129 32.616 38.0 32.6 38.0 14.0 38.0 130-134 31.931199999999997 37.8 30.8 38.0 13.0 38.0 135-139 30.836749999999995 36.2 28.6 38.0 13.0 38.0 140-144 30.76975 36.2 28.8 38.0 9.8 38.0 145-149 29.116750000000003 36.0 26.2 38.0 2.0 38.0 150-151 22.1635 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 4.0 10 1.0 11 4.0 12 1.0 13 2.0 14 4.0 15 5.0 16 3.0 17 8.0 18 9.0 19 29.0 20 13.0 21 13.0 22 24.0 23 16.0 24 26.0 25 24.0 26 23.0 27 49.0 28 45.0 29 54.0 30 81.0 31 97.0 32 118.0 33 181.0 34 274.0 35 489.0 36 1066.0 37 1334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.00960080848914 18.69631126831733 13.213744315310763 29.08034360788277 2 20.825 21.5 36.075 21.6 3 17.660320641282564 29.759519038076153 30.26052104208417 22.319639278557112 4 18.875 34.575 25.15 21.4 5 19.825 37.724999999999994 24.825 17.625 6 17.45 37.925 25.4 19.225 7 13.55 24.675 44.625 17.150000000000002 8 17.075000000000003 25.874999999999996 30.3 26.75 9 17.4 24.7 31.374999999999996 26.525 10-14 19.365 30.985000000000003 26.640000000000004 23.01 15-19 19.314999999999998 30.514999999999997 27.24 22.93 20-24 19.470000000000002 30.06 27.705000000000002 22.765 25-29 18.945 30.56 27.384999999999998 23.11 30-34 18.790000000000003 30.435000000000002 27.689999999999998 23.085 35-39 19.33 30.12 27.384999999999998 23.165 40-44 18.990000000000002 31.445 26.810000000000002 22.755 45-49 19.475 29.895 27.415 23.215 50-54 20.035 29.970000000000002 26.979999999999997 23.015 55-59 19.33 29.904999999999998 27.485 23.28 60-64 19.625 29.815 27.77 22.79 65-69 19.7 30.8 26.71 22.79 70-74 18.7 30.725 27.3 23.275000000000002 75-79 19.61 30.490000000000002 26.905 22.994999999999997 80-84 19.395 29.62 27.455000000000002 23.53 85-89 20.29 29.599999999999998 27.165 22.945 90-94 19.535 29.705 27.425 23.335 95-99 20.39 29.435 26.845000000000002 23.330000000000002 100-104 20.46 29.53 26.669999999999998 23.34 105-109 20.095 29.505 26.75 23.65 110-114 20.785 28.99 26.775 23.45 115-119 20.66 29.695 26.19 23.455000000000002 120-124 21.095 29.085 26.345000000000002 23.474999999999998 125-129 20.94 29.195 25.77 24.095 130-134 20.525 29.475 25.95 24.05 135-139 20.615 29.74 25.46 24.185000000000002 140-144 20.49102455122756 29.381469073453676 25.93629681484074 24.191209560478026 145-149 20.64 29.294999999999998 25.264999999999997 24.8 150-151 20.8125 28.5625 25.4625 25.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 2.0 19 2.0 20 2.5 21 3.5 22 4.5 23 4.0 24 6.5 25 8.0 26 11.0 27 20.0 28 24.0 29 32.0 30 43.0 31 52.0 32 62.0 33 82.5 34 108.0 35 125.0 36 147.5 37 165.0 38 165.0 39 156.0 40 172.5 41 208.5 42 217.0 43 215.5 44 217.0 45 207.0 46 208.5 47 203.0 48 183.5 49 182.0 50 162.5 51 124.5 52 105.0 53 88.0 54 66.5 55 48.5 56 39.5 57 34.5 58 23.5 59 16.0 60 11.0 61 10.5 62 8.0 63 2.5 64 2.0 65 2.0 66 2.0 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.2 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.64484786499617 96.45 2 1.150600869342879 2.25 3 0.17898235745333674 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025568908207619537 0.775 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 31 0.775 TruSeq Adapter, Index 13 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.32499999999999996 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.45 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.85 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 3.0 0.0 0.0 0.0 0.0 108-109 3.375 0.0 0.0 0.0 0.0 110-111 3.9375 0.0 0.0 0.0 0.0 112-113 4.5 0.0 0.0 0.0 0.0 114-115 5.2375 0.0 0.0 0.0 0.0 116-117 6.2 0.0 0.0 0.0 0.0 118-119 6.825 0.0 0.0 0.0 0.0 120-121 7.4375 0.0 0.0 0.0 0.0 122-123 8.15 0.0 0.0 0.0 0.0 124-125 8.875 0.0 0.0 0.0 0.0 126-127 9.725000000000001 0.0 0.0 0.0 0.0 128-129 10.649999999999999 0.0 0.0 0.0 0.0 130-131 11.35 0.0 0.0 0.0 0.0 132-133 12.15 0.0 0.0 0.0 0.0 134-135 13.175 0.0 0.0 0.0 0.0 136-137 13.9875 0.0 0.0 0.0 0.0 138-139 14.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTTAG 10 0.006830828 145.0 3 >>END_MODULE SRR7170809 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170809_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97675 33.0 33.0 34.0 32.0 34.0 2 33.0325 34.0 33.0 34.0 32.0 34.0 3 33.063 34.0 33.0 34.0 32.0 34.0 4 32.96175 34.0 33.0 34.0 32.0 34.0 5 33.06275 34.0 33.0 34.0 32.0 34.0 6 37.2 38.0 38.0 38.0 37.0 38.0 7 37.1975 38.0 38.0 38.0 37.0 38.0 8 37.27425 38.0 38.0 38.0 37.0 38.0 9 37.2235 38.0 38.0 38.0 37.0 38.0 10-14 37.26685 38.0 38.0 38.0 37.0 38.0 15-19 37.212700000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.20665 38.0 38.0 38.0 37.0 38.0 25-29 37.13674999999999 38.0 38.0 38.0 36.8 38.0 30-34 37.142849999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.0923 38.0 38.0 38.0 36.6 38.0 40-44 37.10455 38.0 38.0 38.0 36.4 38.0 45-49 37.060950000000005 38.0 38.0 38.0 36.6 38.0 50-54 37.01095 38.0 38.0 38.0 36.0 38.0 55-59 36.898399999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.92125 38.0 38.0 38.0 36.0 38.0 65-69 36.8037 38.0 38.0 38.0 35.4 38.0 70-74 36.8007 38.0 38.0 38.0 35.6 38.0 75-79 36.75425 38.0 38.0 38.0 35.6 38.0 80-84 36.349399999999996 38.0 38.0 38.0 34.2 38.0 85-89 36.23355 38.0 38.0 38.0 34.0 38.0 90-94 36.08195 38.0 38.0 38.0 34.0 38.0 95-99 36.0588 38.0 38.0 38.0 33.8 38.0 100-104 35.8575 38.0 37.8 38.0 33.2 38.0 105-109 35.75405000000001 38.0 37.6 38.0 33.0 38.0 110-114 35.563900000000004 38.0 37.0 38.0 32.0 38.0 115-119 35.27975000000001 38.0 36.6 38.0 30.0 38.0 120-124 34.86245 38.0 36.0 38.0 28.2 38.0 125-129 34.409800000000004 38.0 35.0 38.0 25.2 38.0 130-134 33.84565 38.0 33.6 38.0 22.8 38.0 135-139 33.2626 38.0 33.0 38.0 19.2 38.0 140-144 32.1693 38.0 32.6 38.0 12.8 38.0 145-149 30.79865 38.0 30.2 38.0 5.6 38.0 150-151 25.03425 31.5 16.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 3.0 10 2.0 11 4.0 12 1.0 13 2.0 14 6.0 15 0.0 16 2.0 17 7.0 18 6.0 19 13.0 20 32.0 21 7.0 22 16.0 23 9.0 24 13.0 25 17.0 26 16.0 27 24.0 28 35.0 29 41.0 30 53.0 31 62.0 32 90.0 33 111.0 34 203.0 35 277.0 36 783.0 37 2157.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.0 20.375 14.000000000000002 22.625 2 28.125 23.45 31.85 16.575 3 22.080520130032507 26.25656414103526 35.483870967741936 16.179044761190298 4 25.456364091022753 33.383345836459114 21.405351337834457 19.754938734683673 5 24.381095273818453 36.70917729432358 21.630407601900476 17.27931982995749 6 22.605651412853213 37.58439609902476 22.18054513628407 17.62940735183796 7 20.030007501875467 20.355088772193046 38.85971492873218 20.7551887971993 8 22.630657664416105 24.256064016004 26.63165791447862 26.481620405101275 9 23.80595148787197 23.95598899724931 28.482120530132534 23.755938984746187 10-14 24.651162790697676 27.776944236059016 25.991497874468617 21.580395098774694 15-19 24.0222066619986 28.00340102030609 27.573271981594477 20.40112033610083 20-24 24.042021010505252 28.46423211605803 27.373686843421712 20.120060030015008 25-29 23.996998499249624 27.83391695847924 27.453726863431715 20.715357678839418 30-34 23.881940970485243 27.673836918459227 27.99899949974988 20.445222611305653 35-39 23.45672836418209 27.293646823411706 28.54927463731866 20.700350175087546 40-44 23.741870935467734 28.129064532266135 28.519259629814908 19.609804902451224 45-49 23.441720860430216 27.823911955977987 28.44922461230615 20.28514257128564 50-54 23.246623311655828 27.063531765882942 29.10455227613807 20.58529264632316 55-59 24.005802611175028 26.90710819868941 28.782952328547847 20.304136861587715 60-64 23.326663331665834 27.158579289644823 28.31415707853927 21.200600300150075 65-69 23.1815907953977 28.029014507253624 27.793896948474238 20.995497748874435 70-74 22.826413206603302 27.473736868434216 28.7743871935968 20.92546273136568 75-79 23.386693346673336 28.264132066033014 27.933966983491747 20.415207603801903 80-84 23.360512230503726 28.122655194837677 27.93757190735831 20.579260667300286 85-89 23.721860930465233 27.768884442221108 28.344172086043024 20.165082541270635 90-94 22.85642821410705 28.179089544772385 28.97948974487244 19.984992496248125 95-99 23.2016008004002 28.844422211105552 27.673836918459227 20.280140070035017 100-104 24.18209104552276 27.768884442221108 28.099049524762382 19.949974987493746 105-109 23.781890945472735 27.518759379689843 28.934467233616807 19.76488244122061 110-114 23.936968484242122 28.084042021010507 28.129064532266135 19.849924962481243 115-119 25.152576288144076 28.47423711855928 27.19859929964982 19.174587293646823 120-124 24.607303651825912 28.194097048524263 27.678839419709856 19.519759879939972 125-129 25.642821410705352 27.598799399699853 27.5887943971986 19.1695847923962 130-134 25.78789394697349 27.723861930965484 27.64382191095548 18.844422211105552 135-139 26.058029014507255 28.109054527263634 27.603801900950476 18.22911455727864 140-144 26.634649056981342 28.300565310921005 26.599629796388015 18.46515583570964 145-149 27.458729364682345 27.768884442221108 26.8184092046023 17.953976988494247 150-151 27.101050525262632 28.16408204102051 26.650825412706354 18.084042021010504 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 3.0 26 4.5 27 7.0 28 9.0 29 10.5 30 14.0 31 21.5 32 31.5 33 42.0 34 62.0 35 78.0 36 93.5 37 115.0 38 130.5 39 161.0 40 185.0 41 200.0 42 235.0 43 248.5 44 251.5 45 263.0 46 265.0 47 261.0 48 235.0 49 196.5 50 162.0 51 138.5 52 122.5 53 104.0 54 83.5 55 66.5 56 49.0 57 34.5 58 29.5 59 26.0 60 20.0 61 12.0 62 6.0 63 4.0 64 3.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.03 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.045 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.05 80-84 0.045 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.05 140-144 0.055 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.76923076923076 96.3 2 0.9487179487179488 1.8499999999999999 3 0.10256410256410256 0.3 4 0.10256410256410256 0.4 5 0.02564102564102564 0.125 6 0.02564102564102564 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02564102564102564 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 35 0.8750000000000001 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.6 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.025 0.0 0.0 0.0 0.0 102-103 2.35 0.0 0.0 0.0 0.0 104-105 2.8 0.0 0.0 0.0 0.0 106-107 3.2 0.0 0.0 0.0 0.0 108-109 3.6 0.0 0.0 0.0 0.0 110-111 4.1625 0.0 0.0 0.0 0.0 112-113 4.75 0.0 0.0 0.0 0.0 114-115 5.4875 0.0 0.0 0.0 0.0 116-117 6.4125 0.0 0.0 0.0 0.0 118-119 7.025 0.0 0.0 0.0 0.0 120-121 7.5875 0.0 0.0 0.0 0.0 122-123 8.287500000000001 0.0 0.0 0.0 0.0 124-125 9.0875 0.0 0.0 0.0 0.0 126-127 10.0125 0.0 0.0 0.0 0.0 128-129 10.9625 0.0 0.0 0.0 0.0 130-131 11.662500000000001 0.0 0.0 0.0 0.0 132-133 12.5125 0.0 0.0 0.0 0.0 134-135 13.5375 0.0 0.0 0.0 0.0 136-137 14.3625 0.0 0.0 0.0 0.0 138-139 15.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580519 spots for SRR7170809.sra Written 580519 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra Read 580517 spots for SRR7170809.sra Written 580517 spots for SRR7170809.sra SRR ids: ['SRR7170809.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8_y3fsny SRR7170809.sra spots: 11610342 blocks: [[1, 580517], [580518, 1161034], [1161035, 1741551], [1741552, 2322068], [2322069, 2902585], [2902586, 3483102], [3483103, 4063619], [4063620, 4644136], [4644137, 5224653], [5224654, 5805170], [5805171, 6385687], [6385688, 6966204], [6966205, 7546721], [7546722, 8127238], [8127239, 8707755], [8707756, 9288272], [9288273, 9868789], [9868790, 10449306], [10449307, 11029823], [11029824, 11610342]] SRR7170809 file size 3912663 SRR7170809 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170809 SRR7170809_1.fastq SRR7170809_2.fastq Input file: SRR7170809_1.fastq Paired file: SRR7170809_2.fastq trimmed: SRR7170809-trimmed-pair1.fastq, SRR7170809-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:37:21 2025 >> started Thu Feb 13 16:37:33 2025 >> done (12.198s) 11610342 read pairs processed; of these: 15848 ( 0.14%) short read pairs filtered out after trimming by size control 133989 ( 1.15%) empty read pairs filtered out after trimming by size control 11460505 (98.71%) read pairs available; of these: 8098519 (70.66%) trimmed read pairs available after processing 3361986 (29.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 14 0.00% 20 8 0.00% 21 24 0.00% 22 17 0.00% 23 27 0.00% 24 21 0.00% 25 27 0.00% 26 27 0.00% 27 36 0.00% 28 23 0.00% 29 49 0.00% 30 42 0.00% 31 243 0.00% 32 48 0.00% 33 41 0.00% 34 41 0.00% 35 41 0.00% 36 49 0.00% 37 57 0.00% 38 57 0.00% 39 53 0.00% 40 68 0.00% 41 68 0.00% 42 57 0.00% 43 72 0.00% 44 103 0.00% 45 96 0.00% 46 110 0.00% 47 157 0.00% 48 118 0.00% 49 162 0.00% 50 198 0.00% 51 219 0.00% 52 271 0.00% 53 268 0.00% 54 270 0.00% 55 259 0.00% 56 358 0.00% 57 344 0.00% 58 426 0.00% 59 474 0.00% 60 602 0.01% 61 633 0.01% 62 842 0.01% 63 858 0.01% 64 921 0.01% 65 976 0.01% 66 987 0.01% 67 1091 0.01% 68 1248 0.01% 69 1421 0.01% 70 1688 0.01% 71 2089 0.02% 72 2559 0.02% 73 2922 0.03% 74 3127 0.03% 75 3582 0.03% 76 6112 0.05% 77 5109 0.04% 78 4019 0.04% 79 4263 0.04% 80 4961 0.04% 81 5892 0.05% 82 6792 0.06% 83 7917 0.07% 84 9370 0.08% 85 9715 0.08% 86 9899 0.09% 87 10353 0.09% 88 10584 0.09% 89 11448 0.10% 90 12717 0.11% 91 13969 0.12% 92 15875 0.14% 93 17717 0.15% 94 18432 0.16% 95 19460 0.17% 96 19229 0.17% 97 19145 0.17% 98 19482 0.17% 99 19943 0.17% 100 21378 0.19% 101 23414 0.20% 102 26227 0.23% 103 28742 0.25% 104 30652 0.27% 105 31839 0.28% 106 31531 0.28% 107 30996 0.27% 108 30790 0.27% 109 30885 0.27% 110 32246 0.28% 111 34617 0.30% 112 37018 0.32% 113 40767 0.36% 114 43647 0.38% 115 44955 0.39% 116 45873 0.40% 117 44799 0.39% 118 44332 0.39% 119 44151 0.39% 120 45297 0.40% 121 47270 0.41% 122 50701 0.44% 123 54604 0.48% 124 58519 0.51% 125 61099 0.53% 126 63003 0.55% 127 62659 0.55% 128 62997 0.55% 129 64055 0.56% 130 65325 0.57% 131 67240 0.59% 132 72889 0.64% 133 77921 0.68% 134 83456 0.73% 135 89142 0.78% 136 93471 0.82% 137 97695 0.85% 138 101488 0.89% 139 105619 0.92% 140 111611 0.97% 141 119257 1.04% 142 132959 1.16% 143 150785 1.32% 144 174153 1.52% 145 206792 1.80% 146 254131 2.22% 147 332440 2.90% 148 487039 4.25% 149 887389 7.74% 150 2805649 24.48% 151 3361986 29.34% 11460505 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=36 prefix-density=0.56 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=58.12 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.4 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACAAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=25 prefix-density=0.61 prefix-fanout=2.4 sequence=GAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=38.10 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170809 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:38:22 Started mapping on | Feb 13 16:38:22 Finished on | Feb 13 16:40:21 Mapping speed, Million of reads per hour | 346.70 Number of input reads | 11460505 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 10502284 Uniquely mapped reads % | 91.64% Average mapped length | 285.40 Number of splices: Total | 8295620 Number of splices: Annotated (sjdb) | 8105514 Number of splices: GT/AG | 8135726 Number of splices: GC/AG | 121114 Number of splices: AT/AC | 7666 Number of splices: Non-canonical | 31114 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.04% Deletion average length | 2.68 Insertion rate per base | 0.03% Insertion average length | 2.01 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 292626 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 15330 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.63% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 680921 680921 680921 N_multimapping 292626 292626 292626 N_noFeature 318824 10230334 402589 N_ambiguous 260235 874 71777 UnstrandedReadsAssigned:9923225 PositiveStrandReadsAssigned:271076 NegativeStrandReadsAssigned:10027918 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR7170809 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170809-trimmed-pair1.fastq SRR7170809-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,460,505 reads, 10,028,840 reads pseudoaligned [quant] estimated average fragment length: 213.036 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7170809.ke.tsv 34699 SRR7170809.se.tsv 87100 total ==> SRR7170809.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.96 360 14.6181 Potri.005G024800.1.v4.1 1035 822.964 561 49.9897 Potri.004G059700.1.v4.1 961 748.977 3 0.293732 Potri.007G009000.2.v4.1 1416 1203.96 0 0 Potri.003G141000.2.v4.1 2943 2730.96 406 10.9021 Potri.016G087400.1.v4.1 270 97.1645 707.596 534.042 Potri.015G069301.1.v4.1 564 355.167 0 0 Potri.010G195200.1.v4.1 1773 1560.96 102 4.79188 Potri.012G127500.1.v4.1 977 764.968 406 38.9207 ==> SRR7170809.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 125 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 428 Potri.001G212900.v4.1 19 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170809 completed mapping pipeline successfully