Starting /dee2/code/volunteer_pipeline.sh SRR7170810 current disk space = 3088854568960 free memory = 1421890428 SRR7170810 SRAfilesize c8b88f3cc62712590b26282339d20271 SRR7170810.sra SRR7170810.sra file validated SRR7170810 is paired end SRR7170810 is conventional basespace SRR7170810 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170810_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79775 34.0 33.0 34.0 33.0 34.0 2 33.3195 34.0 33.0 34.0 33.0 34.0 3 33.29325 34.0 33.0 34.0 33.0 34.0 4 33.37425 34.0 33.0 34.0 33.0 34.0 5 33.346 34.0 33.0 34.0 33.0 34.0 6 36.85975 38.0 37.0 38.0 35.0 38.0 7 37.2265 38.0 38.0 38.0 36.0 38.0 8 37.43825 38.0 38.0 38.0 37.0 38.0 9 37.4855 38.0 38.0 38.0 37.0 38.0 10-14 37.4716 38.0 38.0 38.0 37.0 38.0 15-19 37.43770000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.343 38.0 38.0 38.0 37.0 38.0 25-29 37.31954999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.30985 38.0 38.0 38.0 37.0 38.0 35-39 37.290099999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.21655 38.0 38.0 38.0 36.6 38.0 45-49 37.14915 38.0 38.0 38.0 36.0 38.0 50-54 37.04605 38.0 38.0 38.0 36.0 38.0 55-59 36.98205 38.0 38.0 38.0 36.0 38.0 60-64 36.998599999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.88915 38.0 38.0 38.0 35.4 38.0 70-74 36.8189 38.0 38.0 38.0 35.2 38.0 75-79 36.543749999999996 38.0 38.0 38.0 34.2 38.0 80-84 36.499199999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.42285 38.0 38.0 38.0 34.0 38.0 90-94 36.27035 38.0 38.0 38.0 34.0 38.0 95-99 36.21040000000001 38.0 38.0 38.0 34.0 38.0 100-104 35.90025000000001 38.0 37.0 38.0 32.6 38.0 105-109 35.7255 38.0 37.0 38.0 31.6 38.0 110-114 35.594649999999994 38.0 36.6 38.0 30.6 38.0 115-119 35.331999999999994 38.0 36.2 38.0 29.8 38.0 120-124 34.9067 38.0 36.0 38.0 27.6 38.0 125-129 34.87295 38.0 35.8 38.0 27.8 38.0 130-134 34.216550000000005 38.0 34.6 38.0 24.0 38.0 135-139 34.16715000000001 38.0 33.8 38.0 24.6 38.0 140-144 33.66945 38.0 33.2 38.0 23.0 38.0 145-149 32.5861 38.0 33.0 38.0 13.8 38.0 150-151 27.611874999999998 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 2.0 15 3.0 16 4.0 17 3.0 18 5.0 19 16.0 20 5.0 21 5.0 22 7.0 23 8.0 24 6.0 25 12.0 26 21.0 27 27.0 28 30.0 29 33.0 30 53.0 31 69.0 32 80.0 33 120.0 34 224.0 35 299.0 36 804.0 37 2159.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.22567498726439 16.96383087111564 11.74223127865512 32.06826286296484 2 21.575 21.025 34.2 23.200000000000003 3 16.975 29.225 29.15 24.65 4 21.099999999999998 33.825 24.55 20.525 5 20.625 37.3 24.2 17.875 6 17.7 37.275000000000006 26.35 18.675 7 14.274999999999999 22.650000000000002 45.074999999999996 18.0 8 16.85 24.6 28.625 29.925 9 16.85 24.474999999999998 32.25 26.424999999999997 10-14 19.81 31.09 26.075 23.025000000000002 15-19 19.33 29.725 27.29 23.655 20-24 20.25 29.775000000000002 27.425 22.55 25-29 19.405 29.54 27.994999999999997 23.06 30-34 19.5 29.925 27.85 22.725 35-39 19.85 29.13 27.515 23.505000000000003 40-44 19.830000000000002 29.709999999999997 27.85 22.61 45-49 19.775000000000002 29.89 26.935 23.400000000000002 50-54 19.765 29.435 27.450000000000003 23.35 55-59 19.64 29.425 27.534999999999997 23.400000000000002 60-64 19.96 29.215000000000003 27.13 23.695 65-69 19.8 28.92 28.060000000000002 23.22 70-74 19.67 29.709999999999997 27.43 23.189999999999998 75-79 20.04 29.345 27.99 22.625 80-84 19.875 28.994999999999997 27.6 23.53 85-89 20.294999999999998 29.609999999999996 27.455000000000002 22.64 90-94 20.200000000000003 29.065 27.58 23.155 95-99 19.86 30.070000000000004 26.805 23.265 100-104 20.195 29.555 27.029999999999998 23.22 105-109 20.7 28.54 27.48 23.28 110-114 21.235 29.020000000000003 26.57 23.175 115-119 20.875 29.609999999999996 26.064999999999998 23.45 120-124 20.84 28.560000000000002 26.875 23.724999999999998 125-129 20.555 28.785 26.8 23.86 130-134 21.310000000000002 28.435 26.700000000000003 23.555 135-139 21.465 28.48 26.400000000000002 23.655 140-144 20.9 28.765 26.05 24.285 145-149 20.990000000000002 29.29 25.88 23.84 150-151 21.81522690336292 28.716089511188898 25.84073009126141 23.627953494186773 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 4.0 23 3.5 24 2.0 25 4.0 26 6.0 27 8.5 28 18.5 29 25.5 30 30.5 31 43.5 32 52.0 33 60.5 34 80.5 35 105.0 36 129.0 37 146.0 38 162.5 39 192.5 40 203.5 41 206.5 42 228.5 43 232.5 44 234.5 45 231.5 46 225.5 47 232.0 48 214.0 49 182.0 50 162.5 51 142.5 52 108.5 53 79.0 54 60.0 55 45.5 56 33.5 57 28.5 58 20.5 59 11.5 60 12.0 61 10.0 62 6.5 63 5.0 64 2.5 65 0.5 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19089759797724 98.075 2 0.7079646017699115 1.4000000000000001 3 0.07585335018963338 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025284450063211124 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 12 0.3 TruSeq Adapter, Index 7 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.15 0.0 0.0 0.0 0.0 104-105 2.4 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.550000000000001 0.0 0.0 0.0 0.0 116-117 4.975 0.0 0.0 0.0 0.0 118-119 5.6625 0.0 0.0 0.0 0.0 120-121 6.199999999999999 0.0 0.0 0.0 0.0 122-123 6.6125 0.0 0.0 0.0 0.0 124-125 7.175 0.0 0.0 0.0 0.0 126-127 7.6875 0.0 0.0 0.0 0.0 128-129 8.2625 0.0 0.0 0.0 0.0 130-131 8.9625 0.0 0.0 0.0 0.0 132-133 9.6125 0.0 0.0 0.0 0.0 134-135 10.25 0.0 0.0 0.0 0.0 136-137 11.125 0.0 0.0 0.0 0.0 138-139 12.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170810 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170810_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03 33.0 33.0 34.0 32.0 34.0 2 33.125 34.0 33.0 34.0 33.0 34.0 3 33.13875 34.0 33.0 34.0 33.0 34.0 4 33.03925 34.0 33.0 34.0 33.0 34.0 5 33.059 34.0 33.0 34.0 33.0 34.0 6 37.23 38.0 38.0 38.0 37.0 38.0 7 37.33875 38.0 38.0 38.0 37.0 38.0 8 37.2215 38.0 38.0 38.0 37.0 38.0 9 37.25625 38.0 38.0 38.0 37.0 38.0 10-14 37.21485 38.0 38.0 38.0 37.0 38.0 15-19 37.192249999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.149150000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.13035 38.0 38.0 38.0 37.0 38.0 30-34 37.13355 38.0 38.0 38.0 37.0 38.0 35-39 37.1041 38.0 38.0 38.0 37.0 38.0 40-44 37.07345 38.0 38.0 38.0 37.0 38.0 45-49 37.06275 38.0 38.0 38.0 37.0 38.0 50-54 37.015950000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.9373 38.0 38.0 38.0 36.6 38.0 60-64 36.86515000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.8903 38.0 38.0 38.0 36.2 38.0 70-74 36.83475 38.0 38.0 38.0 36.0 38.0 75-79 36.69275 38.0 38.0 38.0 36.0 38.0 80-84 36.517450000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.386750000000006 38.0 38.0 38.0 34.8 38.0 90-94 36.35615 38.0 38.0 38.0 34.6 38.0 95-99 36.28915 38.0 38.0 38.0 34.6 38.0 100-104 36.12155 38.0 38.0 38.0 34.0 38.0 105-109 36.00265 38.0 38.0 38.0 34.0 38.0 110-114 35.698249999999994 38.0 37.6 38.0 32.2 38.0 115-119 35.5155 38.0 37.2 38.0 31.6 38.0 120-124 35.21665 38.0 36.8 38.0 29.4 38.0 125-129 34.98415 38.0 36.2 38.0 28.2 38.0 130-134 34.7633 38.0 36.0 38.0 27.6 38.0 135-139 34.057399999999994 38.0 34.6 38.0 22.6 38.0 140-144 33.748000000000005 38.0 33.8 38.0 22.0 38.0 145-149 32.938399999999994 38.0 33.4 38.0 14.4 38.0 150-151 27.7265 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 2.0 5 1.0 6 0.0 7 4.0 8 3.0 9 2.0 10 1.0 11 4.0 12 2.0 13 1.0 14 0.0 15 4.0 16 4.0 17 7.0 18 3.0 19 14.0 20 13.0 21 9.0 22 8.0 23 16.0 24 15.0 25 15.0 26 23.0 27 21.0 28 29.0 29 27.0 30 26.0 31 61.0 32 68.0 33 87.0 34 102.0 35 248.0 36 534.0 37 2632.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.275 19.6 15.6 24.525 2 27.224999999999998 24.65 31.15 16.975 3 20.75 27.200000000000003 33.225 18.825 4 24.175 33.900000000000006 23.575 18.35 5 22.900000000000002 38.25 21.625 17.224999999999998 6 21.330332583145786 36.284071017754435 24.60615153788447 17.779444861215303 7 19.879969992498125 19.70492623155789 39.934983745936485 20.4801200300075 8 22.1055263815954 25.081270317579396 27.00675168792198 25.806451612903224 9 22.20555138784696 25.381345336334082 29.457364341085274 22.95573893473368 10-14 23.671570099069346 28.349844891424 26.78875212648854 21.189832883018113 15-19 23.046132292604824 27.47923546482538 28.900230161112777 20.57440208145702 20-24 22.98183274110405 27.816425604324106 28.477053200540514 20.72468845403133 25-29 23.240212275958747 27.866226093922098 28.10153199158907 20.79202963853009 30-34 22.558197747183982 28.155193992490613 28.79599499374218 20.490613266583228 35-39 22.804646039851807 28.06648643236207 28.07649944928407 21.052368078502052 40-44 23.34384858044164 28.561414050373042 27.38971508687597 20.70502228230935 45-49 23.263732411997395 27.66511441590306 28.386159931901254 20.68499324019829 50-54 22.899769700610793 27.751076399319114 28.77240412536297 20.57674977470712 55-59 23.39892844624706 27.30459165790396 28.481297881928796 20.815182013920182 60-64 23.34151103990387 27.02648575577029 28.62864867571221 21.00335452861363 65-69 23.235205767497746 27.400620807049165 28.391909482327026 20.972263943126062 70-74 22.96830404085925 27.71017976065295 28.731660908317057 20.589855290170746 75-79 23.202483476867613 28.86040456639295 27.843981574203884 20.09313038253555 80-84 23.068449251414552 27.40974412898703 28.836813379400127 20.68499324019829 85-89 23.824545591107103 27.995593610735565 28.11076060287417 20.06910019528316 90-94 22.924386579869804 28.327491236855284 28.372558838257383 20.375563345017525 95-99 23.15973960941412 27.68652979469204 28.5878818227341 20.56584877315974 100-104 23.354702995091657 28.047681057798258 28.493438846038266 20.104177101071823 105-109 23.561520356552656 27.898242275527068 27.74300165256147 20.797235715358806 110-114 23.044566850275412 28.382573860791187 28.377566349524287 20.19529293940911 115-119 24.427748559979964 27.693463561232157 28.234410217881294 19.644377660906585 120-124 24.437878712003606 28.434072812859934 27.6528619360008 19.47518653913566 125-129 24.849729513123624 28.08555399719495 27.724904828691642 19.33981166098978 130-134 24.947410598016628 28.207953520985672 27.84233196433938 19.00230391665832 135-139 24.77335336839469 27.913849236163284 27.913849236163284 19.398948159278735 140-144 25.332999499248878 28.292438657986978 27.59639459188783 18.778167250876315 145-149 25.798698047070605 28.49774661992989 27.1407110665999 18.5628442663996 150-151 25.61342013019529 28.004506760140206 27.491236855282924 18.890836254381572 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 1.0 18 0.5 19 1.0 20 1.5 21 1.5 22 1.5 23 3.5 24 4.0 25 5.5 26 9.0 27 7.5 28 10.5 29 17.0 30 21.0 31 24.0 32 34.5 33 45.0 34 56.0 35 81.0 36 89.5 37 101.5 38 133.5 39 157.5 40 196.0 41 224.5 42 251.0 43 260.5 44 253.5 45 264.0 46 259.0 47 235.5 48 218.5 49 217.5 50 171.0 51 129.0 52 110.0 53 88.5 54 77.5 55 61.5 56 48.5 57 36.0 58 24.0 59 15.5 60 13.0 61 11.0 62 7.0 63 4.0 64 3.0 65 1.0 66 1.5 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.06999999999999999 15-19 0.06999999999999999 20-24 0.095 25-29 0.13 30-34 0.125 35-39 0.13 40-44 0.145 45-49 0.145 50-54 0.13 55-59 0.145 60-64 0.135 65-69 0.13 70-74 0.145 75-79 0.13999999999999999 80-84 0.145 85-89 0.145 90-94 0.15 95-99 0.15 100-104 0.16999999999999998 105-109 0.155 110-114 0.15 115-119 0.17500000000000002 120-124 0.155 125-129 0.18 130-134 0.16999999999999998 135-139 0.17500000000000002 140-144 0.15 145-149 0.15 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4957135653051 98.65 2 0.37821482602118006 0.75 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 12 0.3 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114-115 4.5625 0.0 0.0 0.0 0.0 116-117 4.987500000000001 0.0 0.0 0.0 0.0 118-119 5.675 0.0 0.0 0.0 0.0 120-121 6.237500000000001 0.0 0.0 0.0 0.0 122-123 6.65 0.0 0.0 0.0 0.0 124-125 7.2 0.0 0.0 0.0 0.0 126-127 7.7875 0.0 0.0 0.0 0.0 128-129 8.350000000000001 0.0 0.0 0.0 0.0 130-131 9.0625 0.0 0.0 0.0 0.0 132-133 9.712499999999999 0.0 0.0 0.0 0.0 134-135 10.3125 0.0 0.0 0.0 0.0 136-137 11.149999999999999 0.0 0.0 0.0 0.0 138-139 12.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra Read 564456 spots for SRR7170810.sra Written 564456 spots for SRR7170810.sra SRR ids: ['SRR7170810.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bq7xwlc1 SRR7170810.sra spots: 11289120 blocks: [[1, 564456], [564457, 1128912], [1128913, 1693368], [1693369, 2257824], [2257825, 2822280], [2822281, 3386736], [3386737, 3951192], [3951193, 4515648], [4515649, 5080104], [5080105, 5644560], [5644561, 6209016], [6209017, 6773472], [6773473, 7337928], [7337929, 7902384], [7902385, 8466840], [8466841, 9031296], [9031297, 9595752], [9595753, 10160208], [10160209, 10724664], [10724665, 11289120]] SRR7170810 file size 3803811 SRR7170810 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170810 SRR7170810_1.fastq SRR7170810_2.fastq Input file: SRR7170810_1.fastq Paired file: SRR7170810_2.fastq trimmed: SRR7170810-trimmed-pair1.fastq, SRR7170810-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:43:42 2025 >> started Thu Feb 13 16:43:54 2025 >> done (11.634s) 11289120 read pairs processed; of these: 16680 ( 0.15%) short read pairs filtered out after trimming by size control 37753 ( 0.33%) empty read pairs filtered out after trimming by size control 11234687 (99.52%) read pairs available; of these: 7239676 (64.44%) trimmed read pairs available after processing 3995011 (35.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 6 0.00% 21 7 0.00% 22 8 0.00% 23 10 0.00% 24 8 0.00% 25 14 0.00% 26 13 0.00% 27 10 0.00% 28 7 0.00% 29 12 0.00% 30 16 0.00% 31 6 0.00% 32 15 0.00% 33 19 0.00% 34 11 0.00% 35 28 0.00% 36 17 0.00% 37 23 0.00% 38 29 0.00% 39 27 0.00% 40 51 0.00% 41 47 0.00% 42 43 0.00% 43 53 0.00% 44 56 0.00% 45 64 0.00% 46 54 0.00% 47 78 0.00% 48 91 0.00% 49 112 0.00% 50 142 0.00% 51 132 0.00% 52 179 0.00% 53 176 0.00% 54 212 0.00% 55 222 0.00% 56 248 0.00% 57 248 0.00% 58 323 0.00% 59 381 0.00% 60 468 0.00% 61 556 0.00% 62 656 0.01% 63 726 0.01% 64 761 0.01% 65 791 0.01% 66 849 0.01% 67 948 0.01% 68 1087 0.01% 69 1196 0.01% 70 1476 0.01% 71 1831 0.02% 72 2180 0.02% 73 2448 0.02% 74 2686 0.02% 75 3053 0.03% 76 5368 0.05% 77 5479 0.05% 78 3776 0.03% 79 3932 0.03% 80 4548 0.04% 81 5204 0.05% 82 6142 0.05% 83 7051 0.06% 84 8713 0.08% 85 8990 0.08% 86 8584 0.08% 87 8633 0.08% 88 9131 0.08% 89 9681 0.09% 90 10627 0.09% 91 11871 0.11% 92 13147 0.12% 93 14933 0.13% 94 15876 0.14% 95 16722 0.15% 96 16862 0.15% 97 16751 0.15% 98 16963 0.15% 99 17558 0.16% 100 18486 0.16% 101 20253 0.18% 102 22211 0.20% 103 24153 0.21% 104 25634 0.23% 105 27073 0.24% 106 27041 0.24% 107 27032 0.24% 108 26711 0.24% 109 27243 0.24% 110 27824 0.25% 111 29522 0.26% 112 31675 0.28% 113 33888 0.30% 114 35900 0.32% 115 37535 0.33% 116 38088 0.34% 117 37639 0.34% 118 37620 0.33% 119 37544 0.33% 120 38015 0.34% 121 39840 0.35% 122 41748 0.37% 123 44229 0.39% 124 47084 0.42% 125 49008 0.44% 126 50681 0.45% 127 51018 0.45% 128 51304 0.46% 129 51800 0.46% 130 52399 0.47% 131 54149 0.48% 132 57321 0.51% 133 61082 0.54% 134 65409 0.58% 135 69572 0.62% 136 73154 0.65% 137 76937 0.68% 138 80697 0.72% 139 84965 0.76% 140 89700 0.80% 141 97770 0.87% 142 109087 0.97% 143 123925 1.10% 144 144211 1.28% 145 172104 1.53% 146 216465 1.93% 147 287408 2.56% 148 424402 3.78% 149 775988 6.91% 150 2793667 24.87% 151 3995011 35.56% 11234687 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.10 fanout-score-rank=35 prefix-density=0.59 prefix-fanout=1.1 sequence=TAAGCTTTCTTTGCCTCCTCAAGCTCAAGCAACACTTGAGATGCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=82.67 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=4.1 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTACTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=38 prefix-density=0.74 prefix-fanout=1.0 sequence=ACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=122.93 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.2 sequence=AGAAAAGGAGTGAGATATTCAAGAGAAATACGTTTAGAAATCAAGAGAGAGAG SRR7170810 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:44:38 Started mapping on | Feb 13 16:44:38 Finished on | Feb 13 16:45:52 Mapping speed, Million of reads per hour | 546.55 Number of input reads | 11234687 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 10600566 Uniquely mapped reads % | 94.36% Average mapped length | 287.60 Number of splices: Total | 9158178 Number of splices: Annotated (sjdb) | 8902162 Number of splices: GT/AG | 8974629 Number of splices: GC/AG | 142094 Number of splices: AT/AC | 8025 Number of splices: Non-canonical | 33430 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.56 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283525 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 15060 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 362659 362659 362659 N_multimapping 283525 283525 283525 N_noFeature 481710 10352020 593863 N_ambiguous 222342 1165 85202 UnstrandedReadsAssigned:9896514 PositiveStrandReadsAssigned:247381 NegativeStrandReadsAssigned:9921501 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7170810 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170810-trimmed-pair1.fastq SRR7170810-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,234,687 reads, 9,883,246 reads pseudoaligned [quant] estimated average fragment length: 223.465 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7170810.ke.tsv 34699 SRR7170810.se.tsv 87100 total ==> SRR7170810.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.54 320 16.0997 Potri.005G024800.1.v4.1 1035 812.535 338 37.5782 Potri.004G059700.1.v4.1 961 738.594 16 1.95693 Potri.007G009000.2.v4.1 1416 1193.54 0 0 Potri.003G141000.2.v4.1 2943 2720.54 314 10.4264 Potri.016G087400.1.v4.1 270 94.6026 519 495.593 Potri.015G069301.1.v4.1 564 346.887 0 0 Potri.010G195200.1.v4.1 1773 1550.54 6 0.349567 Potri.012G127500.1.v4.1 977 754.57 229 27.4156 ==> SRR7170810.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 152 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 279 Potri.001G212900.v4.1 81 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 48 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7170810 completed mapping pipeline successfully