Starting /dee2/code/volunteer_pipeline.sh SRR7170811 current disk space = 3088847962112 free memory = 1471275136 SRR7170811 SRAfilesize e33c418d4f836007a2cd0397890e06ca SRR7170811.sra SRR7170811.sra file validated SRR7170811 is paired end SRR7170811 is conventional basespace SRR7170811 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170811_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.973 34.0 33.0 34.0 32.0 34.0 2 33.2585 34.0 33.0 34.0 33.0 34.0 3 33.265 34.0 33.0 34.0 33.0 34.0 4 33.23175 34.0 33.0 34.0 33.0 34.0 5 33.26875 34.0 33.0 34.0 33.0 34.0 6 36.66375 38.0 37.0 38.0 34.0 38.0 7 37.13875 38.0 38.0 38.0 36.0 38.0 8 37.363 38.0 38.0 38.0 37.0 38.0 9 37.45025 38.0 38.0 38.0 37.0 38.0 10-14 37.40855 38.0 38.0 38.0 37.0 38.0 15-19 37.3211 38.0 38.0 38.0 37.0 38.0 20-24 37.286449999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.299400000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.2508 38.0 38.0 38.0 36.4 38.0 35-39 37.186099999999996 38.0 38.0 38.0 36.0 38.0 40-44 37.10315 38.0 38.0 38.0 36.0 38.0 45-49 36.9395 38.0 38.0 38.0 35.6 38.0 50-54 36.75664999999999 38.0 38.0 38.0 34.8 38.0 55-59 36.805600000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.856899999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.74435 38.0 38.0 38.0 34.6 38.0 70-74 36.618849999999995 38.0 38.0 38.0 34.0 38.0 75-79 36.22365 38.0 37.8 38.0 33.8 38.0 80-84 35.94465 38.0 37.2 38.0 33.2 38.0 85-89 35.86555 38.0 37.2 38.0 32.8 38.0 90-94 35.78305 38.0 37.0 38.0 32.6 38.0 95-99 35.647749999999995 38.0 37.0 38.0 31.8 38.0 100-104 35.5242 38.0 37.0 38.0 30.8 38.0 105-109 35.10045 38.0 36.0 38.0 28.8 38.0 110-114 34.88725 38.0 35.8 38.0 28.0 38.0 115-119 34.4656 38.0 35.0 38.0 25.4 38.0 120-124 34.19690000000001 38.0 34.2 38.0 24.6 38.0 125-129 33.7354 38.0 33.2 38.0 21.0 38.0 130-134 33.24565 38.0 33.0 38.0 19.4 38.0 135-139 32.5355 38.0 32.4 38.0 14.2 38.0 140-144 31.6625 37.4 30.6 38.0 12.8 38.0 145-149 30.498150000000003 37.0 29.2 38.0 5.8 38.0 150-151 24.042749999999998 31.0 12.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 3.0 15 6.0 16 4.0 17 10.0 18 14.0 19 29.0 20 5.0 21 5.0 22 8.0 23 14.0 24 12.0 25 20.0 26 25.0 27 39.0 28 31.0 29 46.0 30 62.0 31 85.0 32 111.0 33 164.0 34 239.0 35 445.0 36 1023.0 37 1598.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.539550164265854 16.80566085418246 8.162749557745768 29.492039423805917 2 19.2 21.4 35.725 23.674999999999997 3 18.125 27.150000000000002 29.375 25.35 4 22.650000000000002 32.225 22.925 22.2 5 21.625 35.55 24.474999999999998 18.35 6 18.575 37.475 24.2 19.75 7 14.325 23.925 43.625 18.125 8 17.275 22.775000000000002 31.55 28.4 9 18.125 23.275000000000002 31.95 26.650000000000002 10-14 20.005 29.244999999999997 26.5 24.25 15-19 20.215 28.035 28.34 23.41 20-24 19.705000000000002 28.794999999999998 28.044999999999998 23.455000000000002 25-29 19.8 28.444999999999997 28.194999999999997 23.56 30-34 19.605 28.93 27.495000000000005 23.97 35-39 19.580000000000002 28.475 27.950000000000003 23.995 40-44 20.505000000000003 27.894999999999996 28.355000000000004 23.244999999999997 45-49 20.275000000000002 28.544999999999998 27.54 23.64 50-54 20.485 28.110000000000003 28.285 23.119999999999997 55-59 20.16 28.065 28.449999999999996 23.325000000000003 60-64 20.035 27.500000000000004 28.98 23.485 65-69 19.935 28.955 27.639999999999997 23.47 70-74 19.62 29.345 28.065 22.97 75-79 20.325 28.804999999999996 27.77 23.1 80-84 19.775000000000002 28.26 27.925 24.04 85-89 19.965 28.87 27.735 23.43 90-94 19.81 28.849999999999998 27.375 23.965 95-99 19.965 29.12 27.21 23.705000000000002 100-104 20.125 28.77 27.57 23.535 105-109 20.36 28.244999999999997 27.644999999999996 23.75 110-114 20.8 27.935 27.560000000000002 23.705000000000002 115-119 20.76 28.215 27.295 23.73 120-124 20.8 29.160000000000004 26.634999999999998 23.405 125-129 20.64 28.825 26.87 23.665 130-134 21.12 28.715000000000003 25.83 24.335 135-139 20.810000000000002 28.615000000000002 26.55 24.025 140-144 20.974999999999998 28.775000000000002 26.435 23.815 145-149 20.72 28.37 26.279999999999998 24.63 150-151 20.8125 28.1125 26.937499999999996 24.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 1.0 21 1.5 22 2.0 23 3.5 24 4.5 25 4.5 26 6.5 27 8.5 28 12.0 29 17.0 30 19.0 31 19.5 32 31.5 33 46.5 34 68.5 35 84.0 36 96.0 37 118.0 38 148.5 39 172.0 40 202.0 41 233.5 42 254.5 43 275.5 44 256.5 45 229.5 46 248.0 47 255.0 48 223.5 49 193.0 50 164.0 51 136.0 52 101.5 53 73.5 54 66.5 55 55.5 56 43.5 57 37.5 58 23.5 59 20.5 60 17.5 61 6.0 62 3.5 63 5.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.38931297709924 97.65 2 0.5343511450381679 1.05 3 0.0 0.0 4 0.0 0.0 5 0.02544529262086514 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05089058524173028 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 34 0.8500000000000001 TruSeq Adapter, Index 8 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTATG 13 0.325 TruSeq Adapter, Index 8 (97% over 35bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3375 0.0 0.0 0.0 0.0 76-77 0.4 0.0 0.0 0.0 0.0 78-79 0.5375000000000001 0.0 0.0 0.0 0.0 80-81 0.6125 0.0 0.0 0.0 0.0 82-83 0.6625000000000001 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.85 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.1125 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.875 0.0 0.0 0.0 0.0 100-101 2.175 0.0 0.0 0.0 0.0 102-103 2.5875000000000004 0.0 0.0 0.0 0.0 104-105 3.0375 0.0 0.0 0.0 0.0 106-107 3.4749999999999996 0.0 0.0 0.0 0.0 108-109 3.9749999999999996 0.0 0.0 0.0 0.0 110-111 4.3125 0.0 0.0 0.0 0.0 112-113 4.800000000000001 0.0 0.0 0.0 0.0 114-115 5.4 0.0 0.0 0.0 0.0 116-117 5.95 0.0 0.0 0.0 0.0 118-119 6.475 0.0 0.0 0.0 0.0 120-121 6.9875 0.0 0.0 0.0 0.0 122-123 7.5 0.0 0.0 0.0 0.0 124-125 7.8375 0.0 0.0 0.0 0.0 126-127 8.5 0.0 0.0 0.0 0.0 128-129 9.1625 0.0 0.0 0.0 0.0 130-131 9.712499999999999 0.0 0.0 0.0 0.0 132-133 10.2 0.0 0.0 0.0 0.0 134-135 10.8625 0.0 0.0 0.0 0.0 136-137 11.3625 0.0 0.0 0.0 0.0 138-139 12.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 125 2.2566765E-6 12.76 70-74 >>END_MODULE SRR7170811 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170811_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81825 33.0 33.0 34.0 32.0 34.0 2 32.905 33.0 33.0 34.0 32.0 34.0 3 32.94625 34.0 33.0 34.0 32.0 34.0 4 32.90525 34.0 33.0 34.0 32.0 34.0 5 32.87325 34.0 33.0 34.0 32.0 34.0 6 36.96 38.0 38.0 38.0 36.0 38.0 7 37.0895 38.0 38.0 38.0 37.0 38.0 8 37.0795 38.0 38.0 38.0 37.0 38.0 9 37.10375 38.0 38.0 38.0 37.0 38.0 10-14 37.012350000000005 38.0 38.0 38.0 36.6 38.0 15-19 37.01035 38.0 38.0 38.0 36.6 38.0 20-24 36.91655 38.0 38.0 38.0 36.0 38.0 25-29 36.886649999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.83325000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.7563 38.0 38.0 38.0 35.6 38.0 40-44 36.7966 38.0 38.0 38.0 36.0 38.0 45-49 36.78104999999999 38.0 38.0 38.0 36.0 38.0 50-54 36.7582 38.0 38.0 38.0 36.0 38.0 55-59 36.665200000000006 38.0 38.0 38.0 35.6 38.0 60-64 36.599450000000004 38.0 38.0 38.0 35.0 38.0 65-69 36.514300000000006 38.0 38.0 38.0 34.8 38.0 70-74 36.52295 38.0 38.0 38.0 34.8 38.0 75-79 36.33565 38.0 38.0 38.0 34.0 38.0 80-84 35.873200000000004 38.0 38.0 38.0 33.8 38.0 85-89 35.78165 38.0 38.0 38.0 33.0 38.0 90-94 35.48365 38.0 37.0 38.0 31.4 38.0 95-99 35.5064 38.0 37.0 38.0 32.2 38.0 100-104 35.19005 38.0 37.0 38.0 29.4 38.0 105-109 35.1342 38.0 37.0 38.0 29.0 38.0 110-114 34.92305 38.0 36.6 38.0 28.2 38.0 115-119 34.61285 38.0 36.0 38.0 26.8 38.0 120-124 34.4003 38.0 35.4 38.0 26.2 38.0 125-129 33.90685 38.0 34.8 38.0 22.0 38.0 130-134 33.4574 38.0 33.2 38.0 19.8 38.0 135-139 32.816500000000005 38.0 33.0 38.0 15.4 38.0 140-144 32.118750000000006 38.0 32.2 38.0 13.0 38.0 145-149 30.936 38.0 30.8 38.0 5.8 38.0 150-151 25.427375 33.0 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 3.0 5 2.0 6 0.0 7 2.0 8 1.0 9 2.0 10 2.0 11 2.0 12 5.0 13 3.0 14 11.0 15 5.0 16 9.0 17 5.0 18 9.0 19 15.0 20 37.0 21 13.0 22 18.0 23 19.0 24 17.0 25 20.0 26 17.0 27 19.0 28 32.0 29 21.0 30 48.0 31 74.0 32 99.0 33 133.0 34 172.0 35 301.0 36 776.0 37 2091.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.225 19.75 12.225 20.8 2 25.7007007007007 24.624624624624623 32.30730730730731 17.36736736736737 3 20.550688360450565 27.459324155193993 32.44055068836045 19.549436795994993 4 23.7987987987988 36.011011011011014 21.57157157157157 18.61861861861862 5 24.84984984984985 36.511511511511515 21.246246246246248 17.39239239239239 6 20.640480360270203 36.5774330748061 24.0180135101326 18.764073054791094 7 18.25912956478239 21.260630315157577 40.14507253626813 20.335167583791897 8 19.96497373029772 24.993745308981737 29.19689767325494 25.8443832874656 9 23.167375531648737 25.794345759319487 27.87090317738304 23.167375531648737 10-14 23.76282211658744 28.56642481861396 26.554916187140353 21.115836877658246 15-19 23.063450760608486 27.97237790232186 28.382706164931946 20.58146517213771 20-24 22.495870250788407 28.552835761125294 28.247484607298396 20.703809380787906 25-29 22.775747258799377 28.683723026085218 28.39833775597056 20.142191959144846 30-34 22.474216481425856 27.475718433964154 28.692299989986985 21.35776509462301 35-39 21.939005458460613 28.634383294105863 28.414041764735337 21.012569482698183 40-44 23.015674295157492 27.763032700686065 28.639391056137015 20.58190194801943 45-49 22.109269367519655 29.070058590815766 28.41904952676649 20.401622514898094 50-54 22.897055878229523 28.154416182655716 28.11936711395954 20.829160825155217 55-59 23.273401111834527 28.10637551960735 28.066309410527367 20.55391395803075 60-64 22.77688764269978 27.80392549569397 27.783897456439018 21.635289405167235 65-69 22.70405608412619 27.891837756634953 28.5978968452679 20.806209313970957 70-74 23.234852278417627 28.657986980470707 27.53630445668503 20.57085628442664 75-79 23.111979166666664 29.211738782051285 26.878004807692307 20.798277243589745 80-84 22.745706704050466 29.13433134731888 27.246783157262307 20.873178791368346 85-89 23.054971462901772 28.326824872334033 27.801141483929108 20.817062180835087 90-94 23.09310362097461 29.002854710271947 27.640607001552564 20.26343466720088 95-99 23.62780448717949 27.819511217948715 27.50400641025641 21.048677884615387 100-104 23.877009364514997 27.768040462717213 27.432520406630278 20.922429766137512 105-109 23.878205128205128 28.125 27.949719551282055 20.047075320512818 110-114 24.386456976860664 27.91245116698387 27.33146348792948 20.369628368225985 115-119 24.313902243589745 28.18008814102564 27.463942307692307 20.042067307692307 120-124 24.18369391025641 28.42047275641026 27.724358974358974 19.671474358974358 125-129 24.837223279575277 28.683762396073327 26.89071421416408 19.58830011018732 130-134 24.350177793359045 27.906044974207443 28.05629288325737 19.68748434917614 135-139 25.299213781361107 27.527667885222094 27.482598026941762 19.690520306475037 140-144 24.80969551282051 28.039863782051285 27.413862179487182 19.736578525641026 145-149 25.632166641630366 28.11576786340193 27.299584397376197 18.95248109759151 150-151 25.994993742177723 28.09762202753442 26.858573216520647 19.048811013767207 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 3.0 22 5.0 23 3.0 24 3.5 25 5.5 26 6.5 27 8.0 28 7.0 29 9.5 30 15.5 31 24.0 32 34.5 33 38.0 34 55.5 35 82.5 36 95.5 37 107.5 38 132.5 39 165.0 40 201.0 41 223.5 42 253.0 43 288.0 44 300.5 45 274.0 46 250.5 47 235.0 48 214.5 49 196.0 50 159.0 51 127.5 52 107.5 53 92.5 54 67.0 55 50.5 56 41.0 57 32.0 58 23.5 59 16.0 60 12.5 61 8.5 62 6.5 63 5.0 64 3.0 65 1.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.125 4 0.1 5 0.1 6 0.075 7 0.05 8 0.075 9 0.075 10-14 0.075 15-19 0.08 20-24 0.11499999999999999 25-29 0.135 30-34 0.13 35-39 0.155 40-44 0.155 45-49 0.155 50-54 0.13999999999999999 55-59 0.165 60-64 0.13999999999999999 65-69 0.15 70-74 0.15 75-79 0.16 80-84 0.135 85-89 0.13 90-94 0.165 95-99 0.16 100-104 0.155 105-109 0.16 110-114 0.16999999999999998 115-119 0.16 120-124 0.16 125-129 0.16999999999999998 130-134 0.165 135-139 0.155 140-144 0.16 145-149 0.145 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31192660550458 97.425 2 0.509683995922528 1.0 3 0.05096839959225281 0.15 4 0.025484199796126403 0.1 5 0.025484199796126403 0.125 6 0.05096839959225281 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025484199796126403 0.8999999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 36 0.8999999999999999 Illumina Single End PCR Primer 1 (96% over 32bp) AACACATTCACACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.2125 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.36250000000000004 0.0 0.0 0.0 0.0 76-77 0.42500000000000004 0.0 0.0 0.0 0.0 78-79 0.5625 0.0 0.0 0.0 0.0 80-81 0.6375 0.0 0.0 0.0 0.0 82-83 0.7 0.0 0.0 0.0 0.0 84-85 0.7875000000000001 0.0 0.0 0.0 0.0 86-87 0.875 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.2999999999999998 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.6875 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.65 0.0 0.0 0.0 0.0 104-105 3.0999999999999996 0.0 0.0 0.0 0.0 106-107 3.5250000000000004 0.0 0.0 0.0 0.0 108-109 3.9875 0.0 0.0 0.0 0.0 110-111 4.3125 0.0 0.0 0.0 0.0 112-113 4.7625 0.0 0.0 0.0 0.0 114-115 5.3375 0.0 0.0 0.0 0.0 116-117 5.8875 0.0 0.0 0.0 0.0 118-119 6.3625 0.0 0.0 0.0 0.0 120-121 6.9 0.0 0.0 0.0 0.0 122-123 7.4 0.0 0.0 0.0 0.0 124-125 7.7625 0.0 0.0 0.0 0.0 126-127 8.4125 0.0 0.0 0.0 0.0 128-129 9.075 0.0 0.0 0.0 0.0 130-131 9.6125 0.0 0.0 0.0 0.0 132-133 10.125 0.0 0.0 0.0 0.0 134-135 10.8125 0.0 0.0 0.0 0.0 136-137 11.375 0.0 0.0 0.0 0.0 138-139 12.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTAT 10 0.006830828 145.0 1 TTTTATT 10 0.006830828 145.0 2 AAAAAAA 155 2.875396E-4 9.354838 70-74 >>END_MODULE Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra Read 916797 spots for SRR7170811.sra Written 916797 spots for SRR7170811.sra Read 916779 spots for SRR7170811.sra Written 916779 spots for SRR7170811.sra SRR ids: ['SRR7170811.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_282ckr_q SRR7170811.sra spots: 18335598 blocks: [[1, 916779], [916780, 1833558], [1833559, 2750337], [2750338, 3667116], [3667117, 4583895], [4583896, 5500674], [5500675, 6417453], [6417454, 7334232], [7334233, 8251011], [8251012, 9167790], [9167791, 10084569], [10084570, 11001348], [11001349, 11918127], [11918128, 12834906], [12834907, 13751685], [13751686, 14668464], [14668465, 15585243], [15585244, 16502022], [16502023, 17418801], [17418802, 18335598]] SRR7170811 file size 6191632 SRR7170811 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170811 SRR7170811_1.fastq SRR7170811_2.fastq Input file: SRR7170811_1.fastq Paired file: SRR7170811_2.fastq trimmed: SRR7170811-trimmed-pair1.fastq, SRR7170811-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:50:58 2025 >> started Thu Feb 13 16:51:18 2025 >> done (19.888s) 18335598 read pairs processed; of these: 33170 ( 0.18%) short read pairs filtered out after trimming by size control 177359 ( 0.97%) empty read pairs filtered out after trimming by size control 18125069 (98.85%) read pairs available; of these: 13068140 (72.10%) trimmed read pairs available after processing 5056929 (27.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 36 0.00% 20 35 0.00% 21 34 0.00% 22 36 0.00% 23 52 0.00% 24 38 0.00% 25 52 0.00% 26 64 0.00% 27 44 0.00% 28 56 0.00% 29 55 0.00% 30 75 0.00% 31 81 0.00% 32 87 0.00% 33 77 0.00% 34 94 0.00% 35 98 0.00% 36 100 0.00% 37 114 0.00% 38 173 0.00% 39 180 0.00% 40 179 0.00% 41 204 0.00% 42 203 0.00% 43 244 0.00% 44 281 0.00% 45 275 0.00% 46 346 0.00% 47 408 0.00% 48 431 0.00% 49 482 0.00% 50 585 0.00% 51 650 0.00% 52 801 0.00% 53 804 0.00% 54 802 0.00% 55 876 0.00% 56 964 0.01% 57 1093 0.01% 58 1229 0.01% 59 1408 0.01% 60 1664 0.01% 61 1971 0.01% 62 2130 0.01% 63 2439 0.01% 64 2462 0.01% 65 2687 0.01% 66 2684 0.01% 67 3010 0.02% 68 3352 0.02% 69 3859 0.02% 70 4342 0.02% 71 5051 0.03% 72 6105 0.03% 73 7142 0.04% 74 8669 0.05% 75 11833 0.07% 76 28853 0.16% 77 24295 0.13% 78 12267 0.07% 79 10883 0.06% 80 11770 0.06% 81 13069 0.07% 82 14535 0.08% 83 15937 0.09% 84 18672 0.10% 85 18106 0.10% 86 18597 0.10% 87 19462 0.11% 88 20037 0.11% 89 20706 0.11% 90 22240 0.12% 91 24008 0.13% 92 25851 0.14% 93 28057 0.15% 94 29391 0.16% 95 30547 0.17% 96 31259 0.17% 97 31433 0.17% 98 31740 0.18% 99 32720 0.18% 100 34522 0.19% 101 36127 0.20% 102 39571 0.22% 103 40897 0.23% 104 43042 0.24% 105 44610 0.25% 106 45005 0.25% 107 45559 0.25% 108 46153 0.25% 109 46410 0.26% 110 48134 0.27% 111 50869 0.28% 112 52565 0.29% 113 55220 0.30% 114 57833 0.32% 115 59448 0.33% 116 60964 0.34% 117 61750 0.34% 118 62828 0.35% 119 63776 0.35% 120 65902 0.36% 121 68066 0.38% 122 71056 0.39% 123 74843 0.41% 124 78589 0.43% 125 81990 0.45% 126 85758 0.47% 127 87322 0.48% 128 89941 0.50% 129 93464 0.52% 130 96724 0.53% 131 100875 0.56% 132 107225 0.59% 133 114850 0.63% 134 122196 0.67% 135 130684 0.72% 136 138457 0.76% 137 147940 0.82% 138 158567 0.87% 139 169816 0.94% 140 182928 1.01% 141 201217 1.11% 142 225429 1.24% 143 256361 1.41% 144 297781 1.64% 145 351078 1.94% 146 435591 2.40% 147 574679 3.17% 148 848266 4.68% 149 1517847 8.37% 150 4479712 24.72% 151 5056929 27.90% 18125069 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=8 prefix-density=0.42 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=321.76 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGT criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=22 prefix-density=0.60 prefix-fanout=2.1 sequence=ACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=58.80 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.1 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170811 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:51:59 Started mapping on | Feb 13 16:51:59 Finished on | Feb 13 16:53:44 Mapping speed, Million of reads per hour | 621.43 Number of input reads | 18125069 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 17111002 Uniquely mapped reads % | 94.41% Average mapped length | 285.35 Number of splices: Total | 15756839 Number of splices: Annotated (sjdb) | 15359453 Number of splices: GT/AG | 15461127 Number of splices: GC/AG | 226923 Number of splices: AT/AC | 9946 Number of splices: Non-canonical | 58843 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491838 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 54519 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 546615 546615 546615 N_multimapping 491838 491838 491838 N_noFeature 806022 16732130 1041006 N_ambiguous 261053 1751 115930 UnstrandedReadsAssigned:16043927 PositiveStrandReadsAssigned:377121 NegativeStrandReadsAssigned:15954066 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170811 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170811-trimmed-pair1.fastq SRR7170811-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,125,069 reads, 15,929,544 reads pseudoaligned [quant] estimated average fragment length: 229.054 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7170811.ke.tsv 34699 SRR7170811.se.tsv 87100 total ==> SRR7170811.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.95 785 27.2981 Potri.005G024800.1.v4.1 1035 806.946 460 35.4827 Potri.004G059700.1.v4.1 961 732.97 2 0.169843 Potri.007G009000.2.v4.1 1416 1187.95 0 0 Potri.003G141000.2.v4.1 2943 2714.95 1185.6 27.1819 Potri.016G087400.1.v4.1 270 94.3289 896 591.244 Potri.015G069301.1.v4.1 564 341.463 0 0 Potri.010G195200.1.v4.1 1773 1544.95 98 3.94835 Potri.012G127500.1.v4.1 977 748.964 119 9.88983 ==> SRR7170811.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 763 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 68 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170811 completed mapping pipeline successfully