Starting /dee2/code/volunteer_pipeline.sh SRR7170812 current disk space = 3088647995392 free memory = 1582459252 SRR7170812 SRAfilesize 9a76a007299ea8d8eb71f18999663a0b SRR7170812.sra SRR7170812.sra file validated SRR7170812 is paired end SRR7170812 is conventional basespace SRR7170812 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170812_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94825 34.0 33.0 34.0 32.0 34.0 2 33.265 34.0 33.0 34.0 32.0 34.0 3 33.19725 34.0 33.0 34.0 31.0 34.0 4 33.23275 34.0 33.0 34.0 33.0 34.0 5 33.24025 34.0 33.0 34.0 33.0 34.0 6 36.69725 38.0 37.0 38.0 34.0 38.0 7 37.16825 38.0 38.0 38.0 36.0 38.0 8 37.31875 38.0 38.0 38.0 37.0 38.0 9 37.382 38.0 38.0 38.0 37.0 38.0 10-14 37.39155 38.0 38.0 38.0 37.0 38.0 15-19 37.27475 38.0 38.0 38.0 36.6 38.0 20-24 37.244299999999996 38.0 38.0 38.0 36.6 38.0 25-29 37.27605 38.0 38.0 38.0 36.6 38.0 30-34 37.193599999999996 38.0 38.0 38.0 36.2 38.0 35-39 37.1495 38.0 38.0 38.0 36.0 38.0 40-44 37.041850000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.8509 38.0 38.0 38.0 35.4 38.0 50-54 36.75555000000001 38.0 38.0 38.0 34.8 38.0 55-59 36.77725 38.0 38.0 38.0 34.8 38.0 60-64 36.7922 38.0 38.0 38.0 35.0 38.0 65-69 36.671350000000004 38.0 38.0 38.0 34.4 38.0 70-74 36.58305 38.0 38.0 38.0 34.0 38.0 75-79 36.4756 38.0 38.0 38.0 34.0 38.0 80-84 36.26995 38.0 37.2 38.0 33.8 38.0 85-89 36.197050000000004 38.0 37.2 38.0 33.4 38.0 90-94 36.1728 38.0 37.0 38.0 33.0 38.0 95-99 36.00105 38.0 37.0 38.0 32.6 38.0 100-104 35.8711 38.0 36.8 38.0 32.0 38.0 105-109 35.4329 38.0 36.2 38.0 29.4 38.0 110-114 35.23545 38.0 35.8 38.0 28.4 38.0 115-119 34.872949999999996 38.0 35.0 38.0 27.2 38.0 120-124 34.2402 38.0 34.0 38.0 24.2 38.0 125-129 34.0586 38.0 33.0 38.0 23.6 38.0 130-134 33.5282 38.0 33.0 38.0 21.4 38.0 135-139 32.718999999999994 38.0 32.4 38.0 17.0 38.0 140-144 31.850399999999997 37.4 30.6 38.0 13.2 38.0 145-149 30.7123 36.4 30.0 38.0 8.0 38.0 150-151 24.007375 31.0 14.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 1.0 18 3.0 19 4.0 20 2.0 21 3.0 22 13.0 23 13.0 24 13.0 25 23.0 26 26.0 27 31.0 28 49.0 29 63.0 30 80.0 31 85.0 32 125.0 33 155.0 34 262.0 35 456.0 36 1026.0 37 1559.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.5430881981299 14.758655547131665 7.808946171341925 33.88931008339651 2 20.025000000000002 19.2 38.45 22.325 3 16.85 27.125 29.075 26.950000000000003 4 22.15 33.4 23.075000000000003 21.375 5 19.675 36.925000000000004 25.85 17.549999999999997 6 17.775 36.525 26.075 19.625 7 14.274999999999999 21.675 44.775 19.275000000000002 8 16.625 23.05 32.225 28.1 9 17.45 23.150000000000002 32.35 27.05 10-14 19.93 29.134999999999998 26.99 23.945 15-19 19.580000000000002 28.605000000000004 27.779999999999998 24.035 20-24 19.99 29.25 27.495000000000005 23.265 25-29 19.835 28.98 27.994999999999997 23.189999999999998 30-34 19.955000000000002 28.660000000000004 27.955000000000002 23.43 35-39 20.015 28.785 27.994999999999997 23.205000000000002 40-44 19.555 29.075 28.035 23.335 45-49 19.955000000000002 28.884999999999998 27.49 23.669999999999998 50-54 20.28 28.849999999999998 27.05 23.82 55-59 20.11 28.59 27.865000000000002 23.435 60-64 20.74 28.87 27.375 23.015 65-69 19.950000000000003 28.59 27.975 23.485 70-74 20.125 28.64 27.834999999999997 23.400000000000002 75-79 20.27 28.915000000000003 27.245 23.57 80-84 20.18 28.57 27.389999999999997 23.86 85-89 20.419999999999998 28.96 27.22 23.400000000000002 90-94 19.86 28.925 27.694999999999997 23.52 95-99 20.150000000000002 28.384999999999998 27.644999999999996 23.82 100-104 20.41 28.544999999999998 27.37 23.674999999999997 105-109 20.849999999999998 28.555000000000003 26.97 23.625 110-114 20.150000000000002 28.884999999999998 27.105 23.86 115-119 20.95 28.67 26.995 23.385 120-124 20.87 28.634999999999998 27.105 23.39 125-129 20.875 28.53 26.784999999999997 23.810000000000002 130-134 20.565 28.65 26.805 23.98 135-139 20.8 28.375 26.765 24.060000000000002 140-144 20.830000000000002 28.475 26.36 24.335 145-149 20.89 28.549999999999997 26.484999999999996 24.075 150-151 22.037499999999998 26.637499999999996 26.437500000000004 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.5 21 2.0 22 1.5 23 2.5 24 3.0 25 5.0 26 8.5 27 11.0 28 11.5 29 13.0 30 19.5 31 25.0 32 38.0 33 58.0 34 70.0 35 88.0 36 108.5 37 126.0 38 147.5 39 176.0 40 194.5 41 203.0 42 220.5 43 230.0 44 254.0 45 261.5 46 240.0 47 228.5 48 223.0 49 212.5 50 188.5 51 145.5 52 110.5 53 93.5 54 74.5 55 58.5 56 41.5 57 29.0 58 21.5 59 17.5 60 13.5 61 7.5 62 4.0 63 2.5 64 1.0 65 1.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.7374999999999998 0.0 0.0 0.0 0.0 100-101 1.9874999999999998 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 3.0250000000000004 0.0 0.0 0.0 0.0 108-109 3.3125 0.0 0.0 0.0 0.0 110-111 3.6624999999999996 0.0 0.0 0.0 0.0 112-113 4.0375 0.0 0.0 0.0 0.0 114-115 4.4875 0.0 0.0 0.0 0.0 116-117 4.9625 0.0 0.0 0.0 0.0 118-119 5.5625 0.0 0.0 0.0 0.0 120-121 6.1 0.0 0.0 0.0 0.0 122-123 6.737500000000001 0.0 0.0 0.0 0.0 124-125 7.324999999999999 0.0 0.0 0.0 0.0 126-127 7.8625 0.0 0.0 0.0 0.0 128-129 8.4 0.0 0.0 0.0 0.0 130-131 9.025 0.0 0.0 0.0 0.0 132-133 9.675 0.0 0.0 0.0 0.0 134-135 10.25 0.0 0.0 0.0 0.0 136-137 10.85 0.0 0.0 0.0 0.0 138-139 11.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170812 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170812_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86575 33.0 33.0 34.0 32.0 34.0 2 32.991 33.0 33.0 34.0 32.0 34.0 3 33.00575 34.0 33.0 34.0 32.0 34.0 4 33.04075 34.0 33.0 34.0 32.0 34.0 5 33.107 34.0 33.0 34.0 33.0 34.0 6 37.27425 38.0 38.0 38.0 37.0 38.0 7 37.27275 38.0 38.0 38.0 37.0 38.0 8 37.27325 38.0 38.0 38.0 37.0 38.0 9 37.2775 38.0 38.0 38.0 37.0 38.0 10-14 37.2205 38.0 38.0 38.0 37.0 38.0 15-19 37.22285 38.0 38.0 38.0 37.0 38.0 20-24 37.130700000000004 38.0 38.0 38.0 36.8 38.0 25-29 37.133449999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.047399999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.96295 38.0 38.0 38.0 36.4 38.0 40-44 37.0363 38.0 38.0 38.0 36.8 38.0 45-49 37.0261 38.0 38.0 38.0 36.4 38.0 50-54 37.006800000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.93465 38.0 38.0 38.0 36.0 38.0 60-64 36.90535 38.0 38.0 38.0 36.0 38.0 65-69 36.846900000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.7522 38.0 38.0 38.0 35.6 38.0 75-79 36.6223 38.0 38.0 38.0 34.8 38.0 80-84 36.50495 38.0 38.0 38.0 34.4 38.0 85-89 36.45695 38.0 38.0 38.0 34.2 38.0 90-94 36.19405 38.0 38.0 38.0 33.6 38.0 95-99 36.3003 38.0 38.0 38.0 34.0 38.0 100-104 36.05875 38.0 37.8 38.0 33.2 38.0 105-109 35.9696 38.0 37.6 38.0 33.2 38.0 110-114 35.7333 38.0 37.0 38.0 31.8 38.0 115-119 35.4701 38.0 36.8 38.0 30.6 38.0 120-124 35.29325 38.0 36.4 38.0 29.6 38.0 125-129 34.89575 38.0 36.0 38.0 27.8 38.0 130-134 34.32675 38.0 34.2 38.0 25.0 38.0 135-139 33.73435 38.0 33.0 38.0 22.4 38.0 140-144 33.09975 38.0 33.0 38.0 18.6 38.0 145-149 32.22455 38.0 33.0 38.0 10.8 38.0 150-151 26.986375000000002 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 1.0 5 3.0 6 0.0 7 3.0 8 1.0 9 1.0 10 1.0 11 1.0 12 5.0 13 5.0 14 2.0 15 1.0 16 3.0 17 2.0 18 6.0 19 4.0 20 9.0 21 4.0 22 12.0 23 15.0 24 14.0 25 19.0 26 27.0 27 27.0 28 37.0 29 42.0 30 50.0 31 73.0 32 86.0 33 84.0 34 160.0 35 261.0 36 695.0 37 2342.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.525 19.725 10.174999999999999 24.575 2 23.85596399099775 26.03150787696924 33.908477119279816 16.204051012753187 3 19.439579684763572 27.145359019264447 33.77533149862397 19.63972979734801 4 24.706176544136035 35.95898974743686 21.45536384096024 17.879469867466867 5 24.256064016004 38.73468367091773 21.155288822205552 15.853963490872719 6 19.229807451862964 38.38459614903726 24.006001500375092 18.37959489872468 7 19.025 19.175 42.125 19.675 8 20.455113778444613 24.406101525381345 29.08227056764191 26.056514128532132 9 22.330582645661416 24.681170292573142 29.43235808952238 23.55588897224306 10-14 23.914782956591317 28.780756151230246 26.000200040008004 21.304260852170433 15-19 22.96188856656997 28.518555566670003 27.328198459537862 21.191357407222167 20-24 22.672469858422133 28.8408624743609 27.760268147481113 20.726399519735857 25-29 22.31007907116405 28.270443399059154 28.931037934140726 20.488439595636073 30-34 23.01456237802132 28.173947855677326 28.284041435219937 20.52744833108142 35-39 23.230553608969867 28.441285413955352 28.100911002102315 20.22724997497247 40-44 23.265592151366505 28.105916508158973 28.43127440184203 20.197216938632494 45-49 22.8189599079033 27.824215426197508 28.164572801441512 21.19225186445768 50-54 22.76504154570027 27.740514566022622 28.841725898488335 20.65271798978877 55-59 22.886319267157234 27.811983781348548 28.297542173499522 21.004154777994692 60-64 23.771394254829346 27.865078570713642 27.905114603142827 20.458412571314184 65-69 23.29946443765954 28.109514990740276 27.508884328544976 21.082136243055206 70-74 23.033033033033032 27.59259259259259 28.383383383383382 20.99099099099099 75-79 23.095404945439984 27.355090599659626 28.19101011112223 21.358494343778155 80-84 23.600060051043386 28.16393934844618 27.54841615373067 20.687584446779763 85-89 23.74899919935949 27.917333867093674 27.827261809447556 20.50640512409928 90-94 23.632177003554087 27.556690193722783 28.267507633778845 20.543625168944285 95-99 23.81238424187816 27.61675927316414 28.42268608900235 20.148170395955347 100-104 24.11152267494244 27.49524476924617 27.780558614475925 20.61267394133547 105-109 23.575933526879567 27.9957953749124 27.70547602362599 20.72279507458204 110-114 23.869837296620776 28.44055068836045 28.100125156445554 19.589486858573217 115-119 24.818541322520897 27.832006807829003 27.326425389197578 20.023026480452522 120-124 24.398057766431396 27.76192621514742 27.852029834309455 19.987986184111726 125-129 24.695869837296623 27.934918648310386 27.038798498122652 20.330413016270338 130-134 24.978725534364518 27.736897432046852 27.4115232517395 19.872853781849127 135-139 24.737210932025228 27.585343878266094 27.460206226849532 20.217238962859145 140-144 25.603163479827813 28.366202823105418 26.74942436680348 19.28120933026329 145-149 26.056056056056054 27.982982982982985 27.087087087087085 18.873873873873872 150-151 25.675675675675674 28.82882882882883 26.476476476476474 19.01901901901902 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 1.0 10 0.5 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.5 23 3.0 24 4.0 25 4.5 26 5.0 27 8.0 28 10.0 29 12.0 30 17.5 31 21.5 32 31.0 33 46.0 34 53.5 35 66.5 36 87.5 37 117.0 38 138.0 39 152.0 40 183.0 41 232.5 42 252.0 43 265.0 44 272.5 45 260.0 46 264.5 47 250.5 48 221.0 49 194.5 50 162.5 51 129.5 52 110.5 53 107.0 54 93.0 55 67.0 56 51.5 57 36.5 58 22.5 59 14.0 60 9.5 61 5.5 62 3.5 63 1.5 64 1.0 65 0.5 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.075 4 0.025 5 0.025 6 0.025 7 0.0 8 0.025 9 0.025 10-14 0.02 15-19 0.03 20-24 0.055 25-29 0.09 30-34 0.08499999999999999 35-39 0.11 40-44 0.11 45-49 0.105 50-54 0.11 55-59 0.11499999999999999 60-64 0.09 65-69 0.105 70-74 0.1 75-79 0.11 80-84 0.08499999999999999 85-89 0.08 90-94 0.11499999999999999 95-99 0.11499999999999999 100-104 0.11 105-109 0.11 110-114 0.125 115-119 0.11499999999999999 120-124 0.11499999999999999 125-129 0.125 130-134 0.11499999999999999 135-139 0.11 140-144 0.11 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18987341772151 97.95 2 0.5316455696202532 1.05 3 0.17721518987341772 0.525 4 0.05063291139240507 0.2 5 0.025316455696202535 0.125 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit GTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 90-91 0.9 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.3 0.0 0.0 0.0 0.0 96-97 1.5499999999999998 0.0 0.0 0.0 0.0 98-99 1.7875 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.6500000000000004 0.0 0.0 0.0 0.0 106-107 3.05 0.0 0.0 0.0 0.0 108-109 3.3125 0.0 0.0 0.0 0.0 110-111 3.675 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.5125 0.0 0.0 0.0 0.0 116-117 4.987500000000001 0.0 0.0 0.0 0.0 118-119 5.65 0.0 0.0 0.0 0.0 120-121 6.2125 0.0 0.0 0.0 0.0 122-123 6.824999999999999 0.0 0.0 0.0 0.0 124-125 7.3875 0.0 0.0 0.0 0.0 126-127 7.9875 0.0 0.0 0.0 0.0 128-129 8.537500000000001 0.0 0.0 0.0 0.0 130-131 9.175 0.0 0.0 0.0 0.0 132-133 9.8125 0.0 0.0 0.0 0.0 134-135 10.412500000000001 0.0 0.0 0.0 0.0 136-137 11.037500000000001 0.0 0.0 0.0 0.0 138-139 11.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855378 spots for SRR7170812.sra Written 855378 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra Read 855364 spots for SRR7170812.sra Written 855364 spots for SRR7170812.sra SRR ids: ['SRR7170812.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hupz30t_ SRR7170812.sra spots: 17107294 blocks: [[1, 855364], [855365, 1710728], [1710729, 2566092], [2566093, 3421456], [3421457, 4276820], [4276821, 5132184], [5132185, 5987548], [5987549, 6842912], [6842913, 7698276], [7698277, 8553640], [8553641, 9409004], [9409005, 10264368], [10264369, 11119732], [11119733, 11975096], [11975097, 12830460], [12830461, 13685824], [13685825, 14541188], [14541189, 15396552], [15396553, 16251916], [16251917, 17107294]] SRR7170812 file size 5775400 SRR7170812 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170812 SRR7170812_1.fastq SRR7170812_2.fastq Input file: SRR7170812_1.fastq Paired file: SRR7170812_2.fastq trimmed: SRR7170812-trimmed-pair1.fastq, SRR7170812-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:27:34 2025 >> started Thu Feb 13 17:27:54 2025 >> done (19.612s) 17107294 read pairs processed; of these: 15297 ( 0.09%) short read pairs filtered out after trimming by size control 26989 ( 0.16%) empty read pairs filtered out after trimming by size control 17065008 (99.75%) read pairs available; of these: 12039570 (70.55%) trimmed read pairs available after processing 5025438 (29.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 16 0.00% 21 8 0.00% 22 16 0.00% 23 9 0.00% 24 9 0.00% 25 11 0.00% 26 11 0.00% 27 20 0.00% 28 15 0.00% 29 24 0.00% 30 18 0.00% 31 23 0.00% 32 28 0.00% 33 19 0.00% 34 21 0.00% 35 31 0.00% 36 26 0.00% 37 38 0.00% 38 42 0.00% 39 49 0.00% 40 62 0.00% 41 58 0.00% 42 64 0.00% 43 66 0.00% 44 78 0.00% 45 102 0.00% 46 86 0.00% 47 105 0.00% 48 148 0.00% 49 154 0.00% 50 160 0.00% 51 217 0.00% 52 219 0.00% 53 236 0.00% 54 270 0.00% 55 304 0.00% 56 323 0.00% 57 369 0.00% 58 444 0.00% 59 546 0.00% 60 567 0.00% 61 731 0.00% 62 795 0.00% 63 866 0.01% 64 1014 0.01% 65 1115 0.01% 66 1196 0.01% 67 1303 0.01% 68 1457 0.01% 69 1760 0.01% 70 2054 0.01% 71 2284 0.01% 72 2670 0.02% 73 3009 0.02% 74 3266 0.02% 75 3696 0.02% 76 4738 0.03% 77 4800 0.03% 78 5013 0.03% 79 5401 0.03% 80 5947 0.03% 81 6887 0.04% 82 7834 0.05% 83 8991 0.05% 84 11094 0.07% 85 10872 0.06% 86 11300 0.07% 87 12282 0.07% 88 12955 0.08% 89 13379 0.08% 90 14437 0.08% 91 15886 0.09% 92 17147 0.10% 93 18829 0.11% 94 19965 0.12% 95 21253 0.12% 96 22359 0.13% 97 23213 0.14% 98 24037 0.14% 99 25143 0.15% 100 26806 0.16% 101 28229 0.17% 102 29973 0.18% 103 32367 0.19% 104 33490 0.20% 105 35093 0.21% 106 36282 0.21% 107 37803 0.22% 108 38261 0.22% 109 40148 0.24% 110 41116 0.24% 111 43286 0.25% 112 45001 0.26% 113 47222 0.28% 114 49549 0.29% 115 51447 0.30% 116 52481 0.31% 117 54601 0.32% 118 56017 0.33% 119 58009 0.34% 120 59883 0.35% 121 61481 0.36% 122 64459 0.38% 123 67939 0.40% 124 71396 0.42% 125 73683 0.43% 126 76900 0.45% 127 79376 0.47% 128 82137 0.48% 129 86085 0.50% 130 89534 0.52% 131 93263 0.55% 132 99208 0.58% 133 105328 0.62% 134 112312 0.66% 135 120446 0.71% 136 127534 0.75% 137 135780 0.80% 138 146193 0.86% 139 158365 0.93% 140 169381 0.99% 141 186494 1.09% 142 208576 1.22% 143 235714 1.38% 144 273449 1.60% 145 323750 1.90% 146 400965 2.35% 147 533673 3.13% 148 795173 4.66% 149 1438122 8.43% 150 4369786 25.61% 151 5025438 29.45% 17065008 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=15 prefix-density=0.55 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=45.35 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=21 prefix-density=0.66 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=19.10 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=5.5 sequence=GCAATGGCAGCCTCAGTTATGGCTTCATTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7170812 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:28:36 Started mapping on | Feb 13 17:28:37 Finished on | Feb 13 17:30:29 Mapping speed, Million of reads per hour | 548.52 Number of input reads | 17065008 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 16175528 Uniquely mapped reads % | 94.79% Average mapped length | 287.42 Number of splices: Total | 14986587 Number of splices: Annotated (sjdb) | 14609511 Number of splices: GT/AG | 14693753 Number of splices: GC/AG | 228837 Number of splices: AT/AC | 9690 Number of splices: Non-canonical | 54307 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 464292 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 22510 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.32% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 438355 438355 438355 N_multimapping 464292 464292 464292 N_noFeature 740991 15852130 899951 N_ambiguous 275961 1396 110650 UnstrandedReadsAssigned:15158576 PositiveStrandReadsAssigned:322002 NegativeStrandReadsAssigned:15164927 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7170812 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170812-trimmed-pair1.fastq SRR7170812-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,065,008 reads, 15,136,187 reads pseudoaligned [quant] estimated average fragment length: 228.646 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,022 rounds 52401 SRR7170812.ke.tsv 34699 SRR7170812.se.tsv 87100 total ==> SRR7170812.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.35 581 19.8472 Potri.005G024800.1.v4.1 1035 807.354 259 19.62 Potri.004G059700.1.v4.1 961 733.394 21 1.75124 Potri.007G009000.2.v4.1 1416 1188.35 0 0 Potri.003G141000.2.v4.1 2943 2715.35 822 18.5143 Potri.016G087400.1.v4.1 270 91.6678 903 602.468 Potri.015G069301.1.v4.1 564 341.566 0 0 Potri.010G195200.1.v4.1 1773 1545.35 86 3.40356 Potri.012G127500.1.v4.1 977 749.374 157 12.8134 ==> SRR7170812.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 930 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 36 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7170812 completed mapping pipeline successfully