Starting /dee2/code/volunteer_pipeline.sh SRR7170813 current disk space = 3088866377728 free memory = 1469532520 SRR7170813 SRAfilesize 3770a31373b50436e1bd99d9aad1dfc2 SRR7170813.sra SRR7170813.sra file validated SRR7170813 is paired end SRR7170813 is conventional basespace SRR7170813 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170813_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34425 34.0 33.0 34.0 33.0 34.0 2 33.3205 34.0 33.0 34.0 33.0 34.0 3 33.3275 34.0 34.0 34.0 33.0 34.0 4 33.489 34.0 34.0 34.0 33.0 34.0 5 33.477 34.0 34.0 34.0 33.0 34.0 6 37.189 38.0 37.0 38.0 36.0 38.0 7 37.43075 38.0 38.0 38.0 37.0 38.0 8 37.53775 38.0 38.0 38.0 37.0 38.0 9 37.6175 38.0 38.0 38.0 38.0 38.0 10-14 37.6015 38.0 38.0 38.0 38.0 38.0 15-19 37.6 38.0 38.0 38.0 38.0 38.0 20-24 37.557900000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.55285000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.499199999999995 38.0 38.0 38.0 37.8 38.0 35-39 37.48005 38.0 38.0 38.0 37.6 38.0 40-44 37.39935 38.0 38.0 38.0 37.0 38.0 45-49 37.353300000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.2703 38.0 38.0 38.0 37.0 38.0 55-59 37.22085 38.0 38.0 38.0 36.6 38.0 60-64 37.13615 38.0 38.0 38.0 36.0 38.0 65-69 37.201899999999995 38.0 38.0 38.0 36.4 38.0 70-74 37.0597 38.0 38.0 38.0 36.2 38.0 75-79 36.95195 38.0 38.0 38.0 36.0 38.0 80-84 36.85885 38.0 38.0 38.0 35.4 38.0 85-89 36.7462 38.0 38.0 38.0 35.2 38.0 90-94 36.63290000000001 38.0 38.0 38.0 34.6 38.0 95-99 36.535849999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.45325 38.0 38.0 38.0 34.0 38.0 105-109 36.368700000000004 38.0 37.6 38.0 34.0 38.0 110-114 36.257400000000004 38.0 37.4 38.0 34.0 38.0 115-119 35.99485 38.0 37.0 38.0 33.0 38.0 120-124 35.8694 38.0 37.0 38.0 32.2 38.0 125-129 35.56245 38.0 36.0 38.0 31.0 38.0 130-134 35.22234999999999 38.0 35.8 38.0 29.6 38.0 135-139 34.772299999999994 38.0 35.2 38.0 28.0 38.0 140-144 34.2071 38.0 33.2 38.0 25.2 38.0 145-149 33.459199999999996 38.0 33.0 38.0 21.0 38.0 150-151 28.9145 34.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 1.0 17 0.0 18 4.0 19 2.0 20 1.0 21 5.0 22 9.0 23 6.0 24 9.0 25 11.0 26 16.0 27 22.0 28 20.0 29 23.0 30 33.0 31 45.0 32 83.0 33 92.0 34 156.0 35 261.0 36 749.0 37 2447.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.822614107883815 14.419087136929459 10.140041493775934 36.61825726141078 2 19.525000000000002 19.5 38.25 22.725 3 17.724999999999998 25.275 28.425 28.575 4 21.65 32.725 24.5 21.125 5 21.25 36.425000000000004 24.875 17.45 6 18.5 37.625 24.425 19.45 7 13.950000000000001 23.375 43.8 18.875 8 17.779444861215303 22.95573893473368 31.207801950487625 28.057014253563388 9 17.7 22.45 32.875 26.974999999999998 10-14 19.31 29.125 27.485 24.08 15-19 19.98 28.605000000000004 28.050000000000004 23.365 20-24 19.650000000000002 28.335 28.175 23.84 25-29 19.63 28.895 28.21 23.265 30-34 19.759999999999998 28.025 28.685 23.53 35-39 19.502925438815822 28.964344651697754 27.819172875931393 23.713557033555034 40-44 20.195 29.044999999999998 27.72 23.04 45-49 20.142014201420142 28.277827782778274 27.987798779877988 23.592359235923592 50-54 19.59 28.925 27.584999999999997 23.9 55-59 19.39 28.735 28.294999999999998 23.580000000000002 60-64 19.955000000000002 28.544999999999998 27.800000000000004 23.7 65-69 19.61 28.775000000000002 28.015 23.599999999999998 70-74 20.115 28.95 27.3 23.635 75-79 20.615 28.375 27.935 23.075000000000003 80-84 20.115 29.439999999999998 27.045 23.400000000000002 85-89 20.549999999999997 28.515 27.555000000000003 23.380000000000003 90-94 20.755000000000003 28.050000000000004 27.665 23.53 95-99 20.235 28.52 27.794999999999998 23.45 100-104 20.169999999999998 28.13 28.075 23.625 105-109 20.5 28.835 27.04 23.625 110-114 20.175 28.255000000000003 27.975 23.595 115-119 20.825 28.689999999999998 26.875 23.61 120-124 20.665 28.470000000000002 27.415 23.45 125-129 20.91 27.73 27.165 24.195 130-134 20.830000000000002 28.605000000000004 26.685 23.880000000000003 135-139 20.95 29.12 26.505000000000003 23.425 140-144 21.465 28.305000000000003 26.08 24.15 145-149 20.575 29.099999999999998 25.990000000000002 24.335 150-151 20.7 28.3375 26.375 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 2.0 22 4.0 23 4.5 24 3.5 25 4.5 26 6.5 27 9.0 28 13.5 29 18.0 30 22.5 31 31.0 32 41.0 33 53.5 34 64.0 35 77.0 36 89.5 37 112.0 38 147.5 39 173.0 40 211.5 41 237.0 42 237.5 43 247.0 44 262.0 45 270.0 46 243.5 47 218.0 48 213.5 49 196.0 50 168.5 51 133.5 52 113.0 53 98.0 54 80.5 55 56.0 56 30.0 57 27.5 58 25.0 59 18.5 60 13.5 61 6.0 62 3.0 63 3.5 64 3.0 65 2.0 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.015 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 1.0125 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.5875 0.0 0.0 0.0 0.0 98-99 1.875 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.5 0.0 0.0 0.0 0.0 104-105 2.8375 0.0 0.0 0.0 0.0 106-107 3.175 0.0 0.0 0.0 0.0 108-109 3.6875 0.0 0.0 0.0 0.0 110-111 4.2125 0.0 0.0 0.0 0.0 112-113 4.6875 0.0 0.0 0.0 0.0 114-115 5.025 0.0 0.0 0.0 0.0 116-117 5.625 0.0 0.0 0.0 0.0 118-119 6.1625 0.0 0.0 0.0 0.0 120-121 6.7375 0.0 0.0 0.0 0.0 122-123 7.4 0.0 0.0 0.0 0.0 124-125 8.125 0.0 0.0 0.0 0.0 126-127 8.75 0.0 0.0 0.0 0.0 128-129 9.5125 0.0 0.0 0.0 0.0 130-131 10.175 0.0 0.0 0.0 0.0 132-133 10.825 0.0 0.0 0.0 0.0 134-135 11.275 0.0 0.0 0.0 0.0 136-137 12.1 0.0 0.0 0.0 0.0 138-139 13.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTTCC 10 0.006836113 144.9625 3 CCAGTTC 10 0.006836113 144.9625 2 >>END_MODULE SRR7170813 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170813_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.056 33.0 33.0 34.0 32.0 34.0 2 33.207 34.0 33.0 34.0 33.0 34.0 3 33.215 34.0 33.0 34.0 33.0 34.0 4 33.25675 34.0 33.0 34.0 33.0 34.0 5 33.218 34.0 33.0 34.0 33.0 34.0 6 37.47 38.0 38.0 38.0 38.0 38.0 7 37.466 38.0 38.0 38.0 38.0 38.0 8 37.48625 38.0 38.0 38.0 38.0 38.0 9 37.447 38.0 38.0 38.0 38.0 38.0 10-14 37.4399 38.0 38.0 38.0 38.0 38.0 15-19 37.4744 38.0 38.0 38.0 38.0 38.0 20-24 37.3803 38.0 38.0 38.0 37.4 38.0 25-29 37.39575000000001 38.0 38.0 38.0 37.8 38.0 30-34 37.3488 38.0 38.0 38.0 37.4 38.0 35-39 37.32255 38.0 38.0 38.0 37.2 38.0 40-44 37.3156 38.0 38.0 38.0 37.0 38.0 45-49 37.33945 38.0 38.0 38.0 37.4 38.0 50-54 37.242900000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.286199999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.2249 38.0 38.0 38.0 37.0 38.0 65-69 37.17289999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.0486 38.0 38.0 38.0 36.4 38.0 75-79 37.05145 38.0 38.0 38.0 36.4 38.0 80-84 36.950199999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.912 38.0 38.0 38.0 36.0 38.0 90-94 36.80385 38.0 38.0 38.0 36.0 38.0 95-99 36.68364999999999 38.0 38.0 38.0 35.2 38.0 100-104 36.5499 38.0 38.0 38.0 34.8 38.0 105-109 36.52095 38.0 38.0 38.0 34.2 38.0 110-114 36.42265 38.0 38.0 38.0 34.0 38.0 115-119 36.17645 38.0 38.0 38.0 34.0 38.0 120-124 35.92100000000001 38.0 38.0 38.0 33.2 38.0 125-129 35.58540000000001 38.0 37.0 38.0 31.4 38.0 130-134 35.2695 38.0 36.0 38.0 30.6 38.0 135-139 34.6323 38.0 35.4 38.0 27.4 38.0 140-144 34.22425 38.0 34.4 38.0 25.8 38.0 145-149 33.3877 38.0 33.0 38.0 18.6 38.0 150-151 28.646875 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 3.0 14 0.0 15 4.0 16 3.0 17 2.0 18 4.0 19 2.0 20 8.0 21 6.0 22 8.0 23 12.0 24 11.0 25 14.0 26 16.0 27 15.0 28 25.0 29 40.0 30 33.0 31 43.0 32 56.0 33 59.0 34 104.0 35 220.0 36 539.0 37 2763.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.699999999999996 17.9 12.5 26.900000000000002 2 23.925 25.45 34.125 16.5 3 20.175 27.474999999999998 31.674999999999997 20.674999999999997 4 24.349999999999998 35.0 22.425 18.224999999999998 5 23.425 38.324999999999996 22.1 16.150000000000002 6 19.25 38.074999999999996 24.4 18.275 7 19.625 18.45 40.875 21.05 8 20.525 23.9 28.725 26.85 9 21.7 25.05 29.575000000000003 23.674999999999997 10-14 22.900000000000002 28.68 26.96 21.46 15-19 22.845 28.12 28.375 20.66 20-24 22.425 28.050000000000004 28.48 21.044999999999998 25-29 22.335 27.93 28.610000000000003 21.125 30-34 22.39 28.060000000000002 28.765 20.785 35-39 22.79 28.325 28.560000000000002 20.325 40-44 22.53 27.865000000000002 28.555000000000003 21.05 45-49 22.82 28.435 28.384999999999998 20.36 50-54 23.06 28.33 27.965 20.645 55-59 22.67 28.194999999999997 28.110000000000003 21.025 60-64 22.945 28.060000000000002 28.499999999999996 20.495 65-69 22.705000000000002 27.639999999999997 28.265 21.39 70-74 23.380000000000003 27.88 27.700000000000003 21.04 75-79 22.759999999999998 28.199999999999996 28.410000000000004 20.630000000000003 80-84 22.715 27.794999999999998 28.494999999999997 20.995 85-89 23.525 27.905 28.015 20.555 90-94 23.48 27.595 28.405 20.52 95-99 23.41 28.68 27.38 20.53 100-104 23.345 28.075 28.044999999999998 20.535 105-109 23.494999999999997 27.91 28.015 20.580000000000002 110-114 23.685000000000002 28.299999999999997 28.15 19.865 115-119 23.915 27.96 27.894999999999996 20.23 120-124 24.625 28.084999999999997 26.979999999999997 20.31 125-129 24.26 28.294999999999998 27.615000000000002 19.830000000000002 130-134 24.759999999999998 28.1 26.96 20.18 135-139 25.3 27.82 27.02 19.86 140-144 25.080000000000002 27.705000000000002 27.16 20.055 145-149 25.380000000000003 27.975 26.979999999999997 19.665 150-151 26.55 27.55 26.8625 19.037499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 1.0 22 1.5 23 2.0 24 4.0 25 5.0 26 4.0 27 9.0 28 14.0 29 18.0 30 22.0 31 25.5 32 33.0 33 44.5 34 59.5 35 73.0 36 91.0 37 110.5 38 134.5 39 170.5 40 206.0 41 230.5 42 241.5 43 257.0 44 277.5 45 278.0 46 251.5 47 236.0 48 239.0 49 197.5 50 153.5 51 138.5 52 111.0 53 84.0 54 64.5 55 48.5 56 37.5 57 34.5 58 26.5 59 15.5 60 12.0 61 12.0 62 8.5 63 4.0 64 3.0 65 3.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34442763489663 98.5 2 0.529500756429652 1.05 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.6625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.8374999999999999 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.6625 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.2125 0.0 0.0 0.0 0.0 102-103 2.575 0.0 0.0 0.0 0.0 104-105 2.9375 0.0 0.0 0.0 0.0 106-107 3.2874999999999996 0.0 0.0 0.0 0.0 108-109 3.8125 0.0 0.0 0.0 0.0 110-111 4.3375 0.0 0.0 0.0 0.0 112-113 4.8125 0.0 0.0 0.0 0.0 114-115 5.1625 0.0 0.0 0.0 0.0 116-117 5.775 0.0 0.0 0.0 0.0 118-119 6.2875 0.0 0.0 0.0 0.0 120-121 6.8625 0.0 0.0 0.0 0.0 122-123 7.5 0.0 0.0 0.0 0.0 124-125 8.2125 0.0 0.0 0.0 0.0 126-127 8.837499999999999 0.0 0.0 0.0 0.0 128-129 9.649999999999999 0.0 0.0 0.0 0.0 130-131 10.35 0.0 0.0 0.0 0.0 132-133 11.0125 0.0 0.0 0.0 0.0 134-135 11.4375 0.0 0.0 0.0 0.0 136-137 12.275 0.0 0.0 0.0 0.0 138-139 13.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra Read 634065 spots for SRR7170813.sra Written 634065 spots for SRR7170813.sra Read 634048 spots for SRR7170813.sra Written 634048 spots for SRR7170813.sra SRR ids: ['SRR7170813.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bufbbopx SRR7170813.sra spots: 12680977 blocks: [[1, 634048], [634049, 1268096], [1268097, 1902144], [1902145, 2536192], [2536193, 3170240], [3170241, 3804288], [3804289, 4438336], [4438337, 5072384], [5072385, 5706432], [5706433, 6340480], [6340481, 6974528], [6974529, 7608576], [7608577, 8242624], [8242625, 8876672], [8876673, 9510720], [9510721, 10144768], [10144769, 10778816], [10778817, 11412864], [11412865, 12046912], [12046913, 12680977]] SRR7170813 file size 4275466 SRR7170813 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170813 SRR7170813_1.fastq SRR7170813_2.fastq Input file: SRR7170813_1.fastq Paired file: SRR7170813_2.fastq trimmed: SRR7170813-trimmed-pair1.fastq, SRR7170813-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:49:55 2025 >> started Thu Feb 13 16:50:10 2025 >> done (14.442s) 12680977 read pairs processed; of these: 8081 ( 0.06%) short read pairs filtered out after trimming by size control 18379 ( 0.14%) empty read pairs filtered out after trimming by size control 12654517 (99.79%) read pairs available; of these: 7956270 (62.87%) trimmed read pairs available after processing 4698247 (37.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 16 0.00% 20 26 0.00% 21 14 0.00% 22 15 0.00% 23 20 0.00% 24 17 0.00% 25 14 0.00% 26 15 0.00% 27 18 0.00% 28 23 0.00% 29 22 0.00% 30 27 0.00% 31 25 0.00% 32 26 0.00% 33 27 0.00% 34 18 0.00% 35 36 0.00% 36 40 0.00% 37 39 0.00% 38 44 0.00% 39 42 0.00% 40 46 0.00% 41 60 0.00% 42 52 0.00% 43 66 0.00% 44 86 0.00% 45 68 0.00% 46 80 0.00% 47 98 0.00% 48 120 0.00% 49 144 0.00% 50 168 0.00% 51 216 0.00% 52 200 0.00% 53 204 0.00% 54 240 0.00% 55 263 0.00% 56 288 0.00% 57 318 0.00% 58 391 0.00% 59 500 0.00% 60 602 0.00% 61 591 0.00% 62 666 0.01% 63 760 0.01% 64 874 0.01% 65 903 0.01% 66 1021 0.01% 67 1141 0.01% 68 1300 0.01% 69 1485 0.01% 70 1729 0.01% 71 2019 0.02% 72 2230 0.02% 73 2693 0.02% 74 2781 0.02% 75 3273 0.03% 76 4118 0.03% 77 4633 0.04% 78 4176 0.03% 79 4742 0.04% 80 5242 0.04% 81 5839 0.05% 82 6596 0.05% 83 7498 0.06% 84 8346 0.07% 85 9087 0.07% 86 9410 0.07% 87 10379 0.08% 88 10873 0.09% 89 11700 0.09% 90 12929 0.10% 91 13741 0.11% 92 14956 0.12% 93 16175 0.13% 94 17380 0.14% 95 18121 0.14% 96 19002 0.15% 97 19973 0.16% 98 20700 0.16% 99 21500 0.17% 100 22972 0.18% 101 23836 0.19% 102 25222 0.20% 103 26707 0.21% 104 27688 0.22% 105 28867 0.23% 106 30123 0.24% 107 30453 0.24% 108 31317 0.25% 109 31879 0.25% 110 32773 0.26% 111 34300 0.27% 112 36175 0.29% 113 37141 0.29% 114 38839 0.31% 115 40431 0.32% 116 41163 0.33% 117 41802 0.33% 118 42909 0.34% 119 43596 0.34% 120 45100 0.36% 121 46279 0.37% 122 47616 0.38% 123 49837 0.39% 124 51419 0.41% 125 52969 0.42% 126 54783 0.43% 127 56515 0.45% 128 57004 0.45% 129 59192 0.47% 130 61417 0.49% 131 62816 0.50% 132 65749 0.52% 133 69022 0.55% 134 72988 0.58% 135 75948 0.60% 136 79706 0.63% 137 83839 0.66% 138 87598 0.69% 139 94153 0.74% 140 100286 0.79% 141 108139 0.85% 142 119903 0.95% 143 134698 1.06% 144 154119 1.22% 145 181186 1.43% 146 224188 1.77% 147 296959 2.35% 148 439056 3.47% 149 836100 6.61% 150 3114159 24.61% 151 4698247 37.13% 12654517 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=17 prefix-density=0.32 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=334.21 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=18.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=16 prefix-density=0.55 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACAGGCCAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=18 fanout-score=22.10 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=9.2 sequence=AGAAGCAAGCAAAGTTGAGT SRR7170813 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:50:51 Started mapping on | Feb 13 16:50:51 Finished on | Feb 13 16:52:07 Mapping speed, Million of reads per hour | 599.42 Number of input reads | 12654517 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 11978509 Uniquely mapped reads % | 94.66% Average mapped length | 287.51 Number of splices: Total | 11150901 Number of splices: Annotated (sjdb) | 10850346 Number of splices: GT/AG | 10935512 Number of splices: GC/AG | 161318 Number of splices: AT/AC | 7353 Number of splices: Non-canonical | 46718 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.03% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 357128 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 76699 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.77% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 328162 328162 328162 N_multimapping 357128 357128 357128 N_noFeature 607056 11727217 758850 N_ambiguous 203131 1300 102695 UnstrandedReadsAssigned:11168322 PositiveStrandReadsAssigned:249992 NegativeStrandReadsAssigned:11116964 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170813 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170813-trimmed-pair1.fastq SRR7170813-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,654,517 reads, 11,106,825 reads pseudoaligned [quant] estimated average fragment length: 228.997 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52401 SRR7170813.ke.tsv 34699 SRR7170813.se.tsv 87100 total ==> SRR7170813.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790 885 45.6081 Potri.005G024800.1.v4.1 1035 807.003 283 32.3492 Potri.004G059700.1.v4.1 961 733.125 25 3.14568 Potri.007G009000.2.v4.1 1416 1188 0 0 Potri.003G141000.2.v4.1 2943 2715 555.504 18.8742 Potri.016G087400.1.v4.1 270 94.9753 750 728.456 Potri.015G069301.1.v4.1 564 344.859 0 0 Potri.010G195200.1.v4.1 1773 1545 195 11.6428 Potri.012G127500.1.v4.1 977 749.075 113 13.9157 ==> SRR7170813.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 628 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 225 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7170813 completed mapping pipeline successfully