Starting /dee2/code/volunteer_pipeline.sh SRR7170814 current disk space = 3088890208256 free memory = 1486332212 SRR7170814 SRAfilesize fb444b549d313a24d5fa1ff9a97d14f0 SRR7170814.sra SRR7170814.sra file validated SRR7170814 is paired end SRR7170814 is conventional basespace SRR7170814 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170814_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.45575 34.0 33.0 34.0 32.0 34.0 2 33.267 34.0 33.0 34.0 32.0 34.0 3 33.25725 34.0 33.0 34.0 31.0 34.0 4 33.42875 34.0 33.0 34.0 33.0 34.0 5 33.40075 34.0 33.0 34.0 33.0 34.0 6 36.97975 38.0 37.0 38.0 36.0 38.0 7 37.37925 38.0 38.0 38.0 37.0 38.0 8 37.46075 38.0 38.0 38.0 37.0 38.0 9 37.521 38.0 38.0 38.0 38.0 38.0 10-14 37.56235 38.0 38.0 38.0 38.0 38.0 15-19 37.4995 38.0 38.0 38.0 37.8 38.0 20-24 37.4717 38.0 38.0 38.0 37.0 38.0 25-29 37.4322 38.0 38.0 38.0 37.0 38.0 30-34 37.38905 38.0 38.0 38.0 37.0 38.0 35-39 37.310649999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.30285 38.0 38.0 38.0 37.0 38.0 45-49 37.17785 38.0 38.0 38.0 36.2 38.0 50-54 37.14874999999999 38.0 38.0 38.0 36.0 38.0 55-59 36.98805 38.0 38.0 38.0 36.0 38.0 60-64 36.925050000000006 38.0 38.0 38.0 35.6 38.0 65-69 36.9788 38.0 38.0 38.0 35.8 38.0 70-74 36.904849999999996 38.0 38.0 38.0 35.6 38.0 75-79 36.701049999999995 38.0 38.0 38.0 34.8 38.0 80-84 36.49185000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.5245 38.0 38.0 38.0 34.4 38.0 90-94 36.3652 38.0 38.0 38.0 34.0 38.0 95-99 36.299699999999994 38.0 37.8 38.0 33.6 38.0 100-104 36.05145 38.0 37.0 38.0 33.0 38.0 105-109 35.8315 38.0 37.0 38.0 31.8 38.0 110-114 35.56155 38.0 36.6 38.0 30.6 38.0 115-119 35.36205 38.0 36.0 38.0 30.2 38.0 120-124 35.1376 38.0 36.0 38.0 29.2 38.0 125-129 34.51035 38.0 34.4 38.0 26.0 38.0 130-134 34.107600000000005 38.0 33.2 38.0 24.6 38.0 135-139 33.55225 38.0 33.0 38.0 21.4 38.0 140-144 32.700450000000004 38.0 32.6 38.0 16.2 38.0 145-149 31.54255 38.0 31.8 38.0 8.6 38.0 150-151 25.280125 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 2.0 16 4.0 17 2.0 18 4.0 19 14.0 20 5.0 21 7.0 22 7.0 23 6.0 24 16.0 25 15.0 26 18.0 27 22.0 28 28.0 29 40.0 30 50.0 31 66.0 32 72.0 33 132.0 34 205.0 35 397.0 36 981.0 37 1902.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.87961766985275 16.24903125807285 7.827434771376905 30.043916300697493 2 20.95 19.175 37.6 22.275 3 18.099999999999998 27.6 28.999999999999996 25.3 4 21.325 33.550000000000004 24.725 20.4 5 20.974999999999998 36.725 24.125 18.175 6 18.15 36.175000000000004 25.525 20.150000000000002 7 14.774999999999999 22.825 42.75 19.650000000000002 8 17.424999999999997 23.400000000000002 31.7 27.474999999999998 9 17.224999999999998 23.7 32.525 26.55 10-14 19.645000000000003 29.485 26.465 24.404999999999998 15-19 19.865 27.560000000000002 28.910000000000004 23.665 20-24 20.05 28.349999999999998 28.16 23.44 25-29 19.885 28.425 27.79 23.9 30-34 19.55 28.660000000000004 28.255000000000003 23.535 35-39 20.195 28.410000000000004 27.82 23.575 40-44 19.900000000000002 29.42 27.584999999999997 23.095 45-49 20.165 28.994999999999997 27.08 23.76 50-54 19.935 28.21 28.32 23.535 55-59 20.294999999999998 28.585 27.62 23.5 60-64 19.79 27.915 28.244999999999997 24.05 65-69 19.905 28.23 28.475 23.39 70-74 19.945 28.99 27.82 23.244999999999997 75-79 20.69 28.92 27.375 23.015 80-84 20.380000000000003 28.705000000000002 27.46 23.455000000000002 85-89 20.365 28.54 27.785 23.31 90-94 20.715 28.804999999999996 27.229999999999997 23.25 95-99 20.59 28.895 27.51 23.005 100-104 20.435 28.74 27.189999999999998 23.635 105-109 20.89 28.595 27.235 23.28 110-114 20.395 28.095 27.800000000000004 23.71 115-119 20.205000000000002 28.299999999999997 27.565 23.93 120-124 20.34 29.03 26.950000000000003 23.68 125-129 20.674999999999997 28.04 27.075 24.21 130-134 20.835 27.985 27.505000000000003 23.674999999999997 135-139 21.125 28.075 26.400000000000002 24.4 140-144 20.7 27.884999999999998 27.16 24.255 145-149 20.605 28.244999999999997 26.57 24.58 150-151 21.5375 28.3625 25.775 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.5 24 3.5 25 4.0 26 5.0 27 5.5 28 10.0 29 17.0 30 25.5 31 33.5 32 37.0 33 42.5 34 53.5 35 76.5 36 104.5 37 132.5 38 147.0 39 160.5 40 178.0 41 206.5 42 250.5 43 272.5 44 272.5 45 271.5 46 253.0 47 240.0 48 224.0 49 194.0 50 169.0 51 140.0 52 109.0 53 83.5 54 72.0 55 51.0 56 36.0 57 33.0 58 24.0 59 19.5 60 16.5 61 9.0 62 4.5 63 1.0 64 0.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19130654536265 98.125 2 0.6317917614354309 1.25 3 0.10108668182966893 0.3 4 0.050543340914834464 0.2 5 0.025271670457417232 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 2.075 0.0 0.0 0.0 0.0 102-103 2.4000000000000004 0.0 0.0 0.0 0.0 104-105 2.5374999999999996 0.0 0.0 0.0 0.0 106-107 2.75 0.0 0.0 0.0 0.0 108-109 3.1375 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 4.0125 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.15 0.0 0.0 0.0 0.0 118-119 5.575 0.0 0.0 0.0 0.0 120-121 6.025 0.0 0.0 0.0 0.0 122-123 6.512499999999999 0.0 0.0 0.0 0.0 124-125 7.05 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 7.9 0.0 0.0 0.0 0.0 130-131 8.4375 0.0 0.0 0.0 0.0 132-133 8.912500000000001 0.0 0.0 0.0 0.0 134-135 9.524999999999999 0.0 0.0 0.0 0.0 136-137 10.125 0.0 0.0 0.0 0.0 138-139 10.774999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCCA 10 0.006836113 144.9625 9 GGCCTCC 10 0.006836113 144.9625 8 >>END_MODULE SRR7170814 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170814_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92125 33.0 33.0 34.0 32.0 34.0 2 33.069 34.0 33.0 34.0 32.0 34.0 3 33.1485 34.0 33.0 34.0 33.0 34.0 4 33.13275 34.0 33.0 34.0 33.0 34.0 5 33.03225 34.0 33.0 34.0 32.0 34.0 6 37.20525 38.0 38.0 38.0 37.0 38.0 7 37.26775 38.0 38.0 38.0 37.0 38.0 8 37.206 38.0 38.0 38.0 37.0 38.0 9 37.2305 38.0 38.0 38.0 37.0 38.0 10-14 37.256 38.0 38.0 38.0 37.0 38.0 15-19 37.241200000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.1819 38.0 38.0 38.0 37.0 38.0 25-29 37.0971 38.0 38.0 38.0 37.0 38.0 30-34 37.15395 38.0 38.0 38.0 37.0 38.0 35-39 37.08225 38.0 38.0 38.0 37.0 38.0 40-44 37.07905 38.0 38.0 38.0 37.0 38.0 45-49 37.05685 38.0 38.0 38.0 37.0 38.0 50-54 37.00535 38.0 38.0 38.0 36.8 38.0 55-59 36.94584999999999 38.0 38.0 38.0 36.2 38.0 60-64 36.906400000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.87910000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.825250000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.67274999999999 38.0 38.0 38.0 35.6 38.0 80-84 36.5779 38.0 38.0 38.0 35.2 38.0 85-89 36.4792 38.0 38.0 38.0 35.0 38.0 90-94 36.332950000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.3008 38.0 38.0 38.0 34.0 38.0 100-104 36.1491 38.0 38.0 38.0 34.0 38.0 105-109 35.907599999999995 38.0 37.8 38.0 32.6 38.0 110-114 35.77745 38.0 37.0 38.0 32.4 38.0 115-119 35.603699999999996 38.0 37.0 38.0 31.2 38.0 120-124 35.291399999999996 38.0 36.4 38.0 29.8 38.0 125-129 34.7821 38.0 35.8 38.0 27.0 38.0 130-134 34.353249999999996 38.0 34.6 38.0 25.2 38.0 135-139 33.70155 38.0 33.2 38.0 22.0 38.0 140-144 33.00064999999999 38.0 33.0 38.0 16.2 38.0 145-149 31.935700000000004 38.0 33.0 38.0 8.4 38.0 150-151 26.749499999999998 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 0.0 5 2.0 6 1.0 7 1.0 8 3.0 9 0.0 10 4.0 11 1.0 12 2.0 13 2.0 14 8.0 15 2.0 16 5.0 17 5.0 18 2.0 19 10.0 20 11.0 21 15.0 22 11.0 23 10.0 24 13.0 25 17.0 26 23.0 27 25.0 28 34.0 29 31.0 30 30.0 31 58.0 32 70.0 33 94.0 34 149.0 35 286.0 36 612.0 37 2453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.475 20.9 9.4 23.225 2 24.143107330497873 25.794345759319487 32.49937453089817 17.563172379284463 3 21.115836877658246 27.09532149111834 32.724543407555664 19.06429822366775 4 24.15 35.675000000000004 21.5 18.675 5 23.517638228671505 39.57968476357268 20.340255191393545 16.56242181636227 6 20.525 39.425 21.65 18.4 7 19.475 19.8 39.800000000000004 20.925 8 20.125 25.25 27.875 26.75 9 22.225 24.125 28.95 24.7 10-14 23.505000000000003 28.7 26.38 21.415 15-19 23.544999999999998 27.985 27.750000000000004 20.72 20-24 22.965 28.24 27.815 20.979999999999997 25-29 22.703162530024017 28.65792634107286 28.157526020816654 20.48138510808647 30-34 22.715678919729932 28.64216054013503 27.741935483870968 20.900225056264066 35-39 22.827282728272827 27.912791279127912 28.252825282528253 21.007100710071008 40-44 22.686343171585793 28.479239619809903 27.818909454727365 21.01550775387694 45-49 22.422847996798883 28.189866453258638 28.01980693242635 21.36747861751613 50-54 22.93844076611492 27.954193128969347 28.449267390108517 20.65809871480722 55-59 22.958443766564983 27.88418262739411 27.74916237435615 21.408211231684753 60-64 22.89 27.505000000000003 28.389999999999997 21.215 65-69 23.178476771515726 27.88418262739411 28.164224633695056 20.77311596739511 70-74 22.591129556477824 27.936396819840994 28.511425571278565 20.96104805240262 75-79 23.119999999999997 28.144999999999996 27.560000000000002 21.175 80-84 22.668400260039007 27.959193879081862 28.09921488223234 21.2731909786468 85-89 22.68 28.389999999999997 27.944999999999997 20.985 90-94 23.89 27.834999999999997 27.305 20.97 95-99 23.585 28.29 27.544999999999998 20.580000000000002 100-104 23.646182309115456 27.83639181959098 27.85639281964098 20.661033051652584 105-109 23.68855328299245 28.339250887633145 27.544131619742963 20.428064209631444 110-114 23.755000000000003 27.445000000000004 27.775 21.025 115-119 24.315 28.194999999999997 27.555000000000003 19.935 120-124 24.23 28.449999999999996 27.265 20.055 125-129 24.89624481224061 28.39641982099105 27.10635531776589 19.60098004900245 130-134 25.765 27.575 26.99 19.67 135-139 25.523828574286146 27.549132369855478 27.24908736310447 19.677951692753915 140-144 25.31 28.189999999999998 27.615000000000002 18.884999999999998 145-149 25.786289314465723 27.961398069903492 27.011350567528375 19.240962048102407 150-151 26.3 28.225 26.8375 18.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.5 25 4.5 26 7.0 27 7.0 28 10.0 29 14.0 30 14.5 31 21.0 32 30.5 33 36.5 34 50.5 35 67.5 36 94.0 37 123.0 38 140.0 39 153.0 40 187.0 41 227.0 42 252.5 43 269.5 44 272.5 45 274.5 46 257.5 47 234.5 48 222.5 49 199.5 50 167.0 51 141.5 52 113.5 53 90.5 54 80.0 55 64.5 56 51.5 57 36.0 58 22.5 59 18.5 60 12.0 61 8.0 62 9.0 63 6.0 64 1.5 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.0 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.08 30-34 0.025 35-39 0.01 40-44 0.05 45-49 0.034999999999999996 50-54 0.015 55-59 0.015 60-64 0.0 65-69 0.015 70-74 0.005 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.015 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.015 140-144 0.0 145-149 0.005 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19028340080972 98.0 2 0.5819838056680162 1.15 3 0.15182186234817813 0.44999999999999996 4 0.025303643724696356 0.1 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.025303643724696356 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 7 0.17500000000000002 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 1.9749999999999999 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.925 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.8 0.0 0.0 0.0 0.0 114-115 4.4 0.0 0.0 0.0 0.0 116-117 4.925000000000001 0.0 0.0 0.0 0.0 118-119 5.325 0.0 0.0 0.0 0.0 120-121 5.75 0.0 0.0 0.0 0.0 122-123 6.237500000000001 0.0 0.0 0.0 0.0 124-125 6.8125 0.0 0.0 0.0 0.0 126-127 7.2 0.0 0.0 0.0 0.0 128-129 7.675000000000001 0.0 0.0 0.0 0.0 130-131 8.225 0.0 0.0 0.0 0.0 132-133 8.725 0.0 0.0 0.0 0.0 134-135 9.3625 0.0 0.0 0.0 0.0 136-137 9.95 0.0 0.0 0.0 0.0 138-139 10.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798614 spots for SRR7170814.sra Written 798614 spots for SRR7170814.sra Read 798619 spots for SRR7170814.sra Written 798619 spots for SRR7170814.sra SRR ids: ['SRR7170814.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uyf0y9rf SRR7170814.sra spots: 15972285 blocks: [[1, 798614], [798615, 1597228], [1597229, 2395842], [2395843, 3194456], [3194457, 3993070], [3993071, 4791684], [4791685, 5590298], [5590299, 6388912], [6388913, 7187526], [7187527, 7986140], [7986141, 8784754], [8784755, 9583368], [9583369, 10381982], [10381983, 11180596], [11180597, 11979210], [11979211, 12777824], [12777825, 13576438], [13576439, 14375052], [14375053, 15173666], [15173667, 15972285]] SRR7170814 file size 5390782 SRR7170814 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170814 SRR7170814_1.fastq SRR7170814_2.fastq Input file: SRR7170814_1.fastq Paired file: SRR7170814_2.fastq trimmed: SRR7170814-trimmed-pair1.fastq, SRR7170814-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:53:42 2025 >> started Thu Feb 13 16:54:00 2025 >> done (18.139s) 15972285 read pairs processed; of these: 22407 ( 0.14%) short read pairs filtered out after trimming by size control 59242 ( 0.37%) empty read pairs filtered out after trimming by size control 15890636 (99.49%) read pairs available; of these: 10734557 (67.55%) trimmed read pairs available after processing 5156079 (32.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 23 0.00% 20 40 0.00% 21 34 0.00% 22 40 0.00% 23 30 0.00% 24 40 0.00% 25 56 0.00% 26 47 0.00% 27 46 0.00% 28 48 0.00% 29 50 0.00% 30 70 0.00% 31 62 0.00% 32 61 0.00% 33 58 0.00% 34 63 0.00% 35 63 0.00% 36 64 0.00% 37 67 0.00% 38 77 0.00% 39 110 0.00% 40 127 0.00% 41 143 0.00% 42 150 0.00% 43 131 0.00% 44 139 0.00% 45 180 0.00% 46 219 0.00% 47 229 0.00% 48 270 0.00% 49 303 0.00% 50 393 0.00% 51 461 0.00% 52 513 0.00% 53 513 0.00% 54 542 0.00% 55 571 0.00% 56 593 0.00% 57 716 0.00% 58 786 0.00% 59 888 0.01% 60 1012 0.01% 61 1136 0.01% 62 1268 0.01% 63 1458 0.01% 64 1477 0.01% 65 1596 0.01% 66 1673 0.01% 67 1853 0.01% 68 2015 0.01% 69 2341 0.01% 70 2863 0.02% 71 3276 0.02% 72 4072 0.03% 73 4470 0.03% 74 5026 0.03% 75 5703 0.04% 76 9315 0.06% 77 8518 0.05% 78 6248 0.04% 79 6530 0.04% 80 7028 0.04% 81 8144 0.05% 82 9336 0.06% 83 10885 0.07% 84 12858 0.08% 85 12160 0.08% 86 12125 0.08% 87 12886 0.08% 88 12938 0.08% 89 14106 0.09% 90 15265 0.10% 91 16665 0.10% 92 18484 0.12% 93 20190 0.13% 94 21264 0.13% 95 22227 0.14% 96 22379 0.14% 97 22843 0.14% 98 22877 0.14% 99 24037 0.15% 100 25052 0.16% 101 27436 0.17% 102 30035 0.19% 103 31508 0.20% 104 32995 0.21% 105 34187 0.22% 106 34662 0.22% 107 34840 0.22% 108 35509 0.22% 109 35723 0.22% 110 37187 0.23% 111 38984 0.25% 112 41518 0.26% 113 43700 0.28% 114 46045 0.29% 115 47901 0.30% 116 48206 0.30% 117 49549 0.31% 118 49587 0.31% 119 50172 0.32% 120 51925 0.33% 121 54381 0.34% 122 56374 0.35% 123 60146 0.38% 124 63105 0.40% 125 65793 0.41% 126 68835 0.43% 127 69798 0.44% 128 71582 0.45% 129 73633 0.46% 130 75806 0.48% 131 78566 0.49% 132 83579 0.53% 133 89249 0.56% 134 95834 0.60% 135 102701 0.65% 136 109045 0.69% 137 115106 0.72% 138 122244 0.77% 139 130927 0.82% 140 140769 0.89% 141 154046 0.97% 142 173355 1.09% 143 197655 1.24% 144 230599 1.45% 145 272197 1.71% 146 340640 2.14% 147 449006 2.83% 148 674580 4.25% 149 1251824 7.88% 150 4036876 25.40% 151 5156079 32.45% 15890636 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=14 prefix-density=0.73 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=364.25 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=24 prefix-density=1.04 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=48.53 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170814 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:54:43 Started mapping on | Feb 13 16:54:44 Finished on | Feb 13 16:56:08 Mapping speed, Million of reads per hour | 681.03 Number of input reads | 15890636 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 15217928 Uniquely mapped reads % | 95.77% Average mapped length | 287.63 Number of splices: Total | 14441908 Number of splices: Annotated (sjdb) | 14119688 Number of splices: GT/AG | 14164594 Number of splices: GC/AG | 223144 Number of splices: AT/AC | 7432 Number of splices: Non-canonical | 46738 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 396782 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 32730 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 290029 290029 290029 N_multimapping 396782 396782 396782 N_noFeature 574560 14948543 712711 N_ambiguous 227815 1220 95751 UnstrandedReadsAssigned:14415553 PositiveStrandReadsAssigned:268165 NegativeStrandReadsAssigned:14409466 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7170814 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170814-trimmed-pair1.fastq SRR7170814-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,890,636 reads, 14,395,309 reads pseudoaligned [quant] estimated average fragment length: 234.355 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7170814.ke.tsv 34699 SRR7170814.se.tsv 87100 total ==> SRR7170814.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.65 465 18.3924 Potri.005G024800.1.v4.1 1035 801.645 195 17.1707 Potri.004G059700.1.v4.1 961 727.696 4 0.388013 Potri.007G009000.2.v4.1 1416 1182.65 0 0 Potri.003G141000.2.v4.1 2943 2709.65 791.773 20.6265 Potri.016G087400.1.v4.1 270 92.2798 734 561.469 Potri.015G069301.1.v4.1 564 337.134 0 0 Potri.010G195200.1.v4.1 1773 1539.65 4 0.18339 Potri.012G127500.1.v4.1 977 743.674 64 6.07482 ==> SRR7170814.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 674 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170814 completed mapping pipeline successfully