Starting /dee2/code/volunteer_pipeline.sh SRR7170815 current disk space = 3088900730880 free memory = 1454510104 SRR7170815 SRAfilesize ca099fd12ef391b871acb2434fa1bcb1 SRR7170815.sra SRR7170815.sra file validated SRR7170815 is paired end SRR7170815 is conventional basespace SRR7170815 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170815_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.335 34.0 33.0 34.0 32.0 34.0 2 33.12325 34.0 33.0 34.0 32.0 34.0 3 33.07125 34.0 33.0 34.0 32.0 34.0 4 33.17475 34.0 33.0 34.0 31.0 34.0 5 33.24475 34.0 33.0 34.0 33.0 34.0 6 36.68025 38.0 37.0 38.0 34.0 38.0 7 37.10075 38.0 38.0 38.0 36.0 38.0 8 37.22525 38.0 38.0 38.0 36.0 38.0 9 37.36275 38.0 38.0 38.0 37.0 38.0 10-14 37.2919 38.0 38.0 38.0 36.8 38.0 15-19 37.21615 38.0 38.0 38.0 36.4 38.0 20-24 37.16035000000001 38.0 38.0 38.0 36.4 38.0 25-29 37.17614999999999 38.0 38.0 38.0 36.0 38.0 30-34 37.064949999999996 38.0 38.0 38.0 35.8 38.0 35-39 36.9501 38.0 38.0 38.0 35.6 38.0 40-44 36.97455 38.0 38.0 38.0 35.6 38.0 45-49 36.7798 38.0 38.0 38.0 35.0 38.0 50-54 36.6334 38.0 38.0 38.0 34.6 38.0 55-59 36.4827 38.0 38.0 38.0 34.0 38.0 60-64 36.3918 38.0 37.8 38.0 33.8 38.0 65-69 36.388099999999994 38.0 38.0 38.0 34.0 38.0 70-74 36.33035 38.0 37.6 38.0 33.6 38.0 75-79 36.26125 38.0 37.2 38.0 33.8 38.0 80-84 35.87010000000001 38.0 37.0 38.0 32.2 38.0 85-89 35.826800000000006 38.0 37.0 38.0 31.8 38.0 90-94 35.63045 38.0 37.0 38.0 31.0 38.0 95-99 35.379949999999994 38.0 36.4 38.0 29.2 38.0 100-104 34.9645 38.0 35.8 38.0 27.6 38.0 105-109 34.4797 38.0 34.6 38.0 25.0 38.0 110-114 34.0736 38.0 33.8 38.0 22.4 38.0 115-119 33.83845 38.0 33.6 38.0 21.6 38.0 120-124 33.5104 38.0 33.0 38.0 19.0 38.0 125-129 32.4116 37.6 31.6 38.0 14.4 38.0 130-134 31.8773 37.0 30.4 38.0 13.8 38.0 135-139 31.017699999999998 36.4 28.4 38.0 13.0 38.0 140-144 30.37525 36.0 28.0 38.0 9.8 38.0 145-149 28.4219 35.0 23.8 38.0 2.0 38.0 150-151 21.649875 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 3.0 12 2.0 13 2.0 14 2.0 15 4.0 16 2.0 17 10.0 18 7.0 19 16.0 20 11.0 21 16.0 22 13.0 23 20.0 24 23.0 25 29.0 26 46.0 27 44.0 28 62.0 29 69.0 30 76.0 31 111.0 32 149.0 33 200.0 34 282.0 35 493.0 36 1080.0 37 1226.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.36246786632391 16.786632390745503 9.897172236503856 31.953727506426738 2 21.125 20.724999999999998 35.425000000000004 22.725 3 16.629100926621586 28.750313047833707 29.501627848735286 25.118958176809414 4 20.225 33.025 24.675 22.075 5 19.5 37.4 24.675 18.425 6 17.8 36.525 26.025 19.650000000000002 7 14.025000000000002 23.3 43.85 18.825 8 18.05 24.075 29.325000000000003 28.549999999999997 9 18.4 23.599999999999998 31.275 26.724999999999998 10-14 20.405 28.749999999999996 27.26 23.585 15-19 19.82 28.000000000000004 28.494999999999997 23.685000000000002 20-24 19.470000000000002 29.315 28.110000000000003 23.105 25-29 19.435 28.595 28.325 23.645 30-34 19.139999999999997 29.265 28.02 23.575 35-39 19.755 28.725 28.299999999999997 23.22 40-44 19.78 29.185 27.900000000000002 23.135 45-49 20.49 29.09 27.13 23.29 50-54 20.48 28.705000000000002 27.685 23.13 55-59 19.6 29.134999999999998 27.855 23.41 60-64 20.03 28.139999999999997 28.294999999999998 23.535 65-69 19.48 29.32 28.24 22.96 70-74 19.755 29.255 27.765 23.225 75-79 19.79 28.505000000000003 28.060000000000002 23.645 80-84 19.775000000000002 28.1 27.805000000000003 24.32 85-89 20.235 28.785 27.465 23.515 90-94 20.695 28.4 27.35 23.555 95-99 20.8 28.294999999999998 27.400000000000002 23.505000000000003 100-104 20.544999999999998 29.28 27.060000000000002 23.115 105-109 20.215 28.694999999999997 27.785 23.305 110-114 20.48 28.865000000000002 27.565 23.09 115-119 20.105 29.315 26.87 23.71 120-124 20.935000000000002 28.99 27.315 22.759999999999998 125-129 21.09 28.275 27.279999999999998 23.355 130-134 20.7 28.720000000000002 26.61 23.97 135-139 21.224999999999998 28.549999999999997 27.245 22.98 140-144 21.245 28.09 27.08 23.585 145-149 20.544999999999998 28.515 27.26 23.68 150-151 20.724999999999998 28.3625 27.5625 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 1.5 20 2.0 21 1.0 22 2.0 23 4.0 24 4.5 25 5.0 26 7.0 27 11.0 28 17.0 29 18.5 30 24.5 31 40.0 32 47.5 33 48.5 34 56.5 35 79.5 36 103.5 37 132.0 38 156.5 39 171.0 40 181.0 41 215.0 42 245.5 43 252.0 44 259.5 45 259.0 46 248.5 47 226.0 48 206.0 49 204.0 50 181.0 51 129.0 52 101.0 53 84.0 54 70.5 55 55.0 56 42.5 57 31.5 58 22.0 59 19.5 60 12.0 61 6.5 62 5.5 63 4.0 64 1.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.75 2 0.0 3 0.17500000000000002 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44542475422233 98.625 2 0.4789513486261659 0.95 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025207965717166627 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 7 (97% over 35bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.2000000000000002 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.6125 0.0 0.0 0.0 0.0 98-99 1.7999999999999998 0.0 0.0 0.0 0.0 100-101 1.9874999999999998 0.0 0.0 0.0 0.0 102-103 2.175 0.0 0.0 0.0 0.0 104-105 2.4625 0.0 0.0 0.0 0.0 106-107 2.8375 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.375 0.0 0.0 0.0 0.0 116-117 4.7625 0.0 0.0 0.0 0.0 118-119 5.25 0.0 0.0 0.0 0.0 120-121 5.7125 0.0 0.0 0.0 0.0 122-123 6.25 0.0 0.0 0.0 0.0 124-125 6.6875 0.0 0.0 0.0 0.0 126-127 7.199999999999999 0.0 0.0 0.0 0.0 128-129 7.7375 0.0 0.0 0.0 0.0 130-131 8.3625 0.0 0.0 0.0 0.0 132-133 9.15 0.0 0.0 0.0 0.0 134-135 9.8125 0.0 0.0 0.0 0.0 136-137 10.5 0.0 0.0 0.0 0.0 138-139 11.287500000000001 0.0125 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGCAAT 10 0.0068378756 144.95 9 >>END_MODULE SRR7170815 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170815_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8975 33.0 33.0 34.0 32.0 34.0 2 32.90875 33.0 33.0 34.0 32.0 34.0 3 32.935 34.0 33.0 34.0 32.0 34.0 4 32.99425 34.0 33.0 34.0 32.0 34.0 5 33.00425 34.0 33.0 34.0 32.0 34.0 6 37.229 38.0 38.0 38.0 37.0 38.0 7 37.22375 38.0 38.0 38.0 37.0 38.0 8 37.1605 38.0 38.0 38.0 37.0 38.0 9 37.1545 38.0 38.0 38.0 37.0 38.0 10-14 37.11225 38.0 38.0 38.0 36.8 38.0 15-19 37.13045 38.0 38.0 38.0 36.8 38.0 20-24 37.03705 38.0 38.0 38.0 36.8 38.0 25-29 36.9768 38.0 38.0 38.0 36.6 38.0 30-34 36.92975 38.0 38.0 38.0 36.4 38.0 35-39 36.92415 38.0 38.0 38.0 36.0 38.0 40-44 36.945 38.0 38.0 38.0 36.2 38.0 45-49 36.96464999999999 38.0 38.0 38.0 36.2 38.0 50-54 36.87735 38.0 38.0 38.0 36.0 38.0 55-59 36.82985 38.0 38.0 38.0 36.0 38.0 60-64 36.808350000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.7263 38.0 38.0 38.0 35.8 38.0 70-74 36.603899999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.52595 38.0 38.0 38.0 34.6 38.0 80-84 36.401300000000006 38.0 38.0 38.0 34.6 38.0 85-89 36.248400000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.140049999999995 38.0 38.0 38.0 34.0 38.0 95-99 35.920950000000005 38.0 38.0 38.0 33.2 38.0 100-104 35.859899999999996 38.0 38.0 38.0 33.0 38.0 105-109 35.7071 38.0 37.2 38.0 32.0 38.0 110-114 35.46005 38.0 37.0 38.0 31.0 38.0 115-119 35.18075 38.0 36.8 38.0 28.8 38.0 120-124 34.855999999999995 38.0 36.2 38.0 27.2 38.0 125-129 34.2759 38.0 35.0 38.0 24.0 38.0 130-134 33.70925 38.0 33.8 38.0 20.6 38.0 135-139 33.2855 38.0 33.0 38.0 18.6 38.0 140-144 32.39015 38.0 33.0 38.0 13.2 38.0 145-149 31.280150000000003 38.0 32.0 38.0 6.2 38.0 150-151 25.442875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 5.0 5 2.0 6 0.0 7 2.0 8 1.0 9 1.0 10 1.0 11 4.0 12 5.0 13 1.0 14 2.0 15 4.0 16 4.0 17 2.0 18 8.0 19 16.0 20 14.0 21 7.0 22 14.0 23 18.0 24 10.0 25 24.0 26 30.0 27 28.0 28 36.0 29 44.0 30 52.0 31 68.0 32 83.0 33 99.0 34 156.0 35 301.0 36 727.0 37 2221.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.625 20.95 12.375 23.05 2 26.650000000000002 25.0 30.85 17.5 3 19.8 29.049999999999997 33.275 17.875 4 23.65 34.875 23.849999999999998 17.625 5 23.425 38.125 20.825 17.625 6 19.8 38.125 23.799999999999997 18.275 7 19.375 19.400000000000002 41.025 20.200000000000003 8 20.875 24.675 28.275 26.174999999999997 9 22.225 24.2 29.2 24.375 10-14 23.085 28.98 26.56 21.375 15-19 22.68 28.235 28.51 20.575 20-24 22.7 28.575 28.035 20.69 25-29 22.869999999999997 28.325 28.065 20.74 30-34 22.275 28.134999999999998 28.825 20.765 35-39 22.835 27.99 28.299999999999997 20.875 40-44 22.375 28.849999999999998 28.249999999999996 20.525 45-49 22.82 28.000000000000004 28.59 20.59 50-54 22.23 28.07 28.96 20.74 55-59 23.119999999999997 27.82 28.515 20.544999999999998 60-64 22.59 27.465 29.099999999999998 20.845 65-69 23.11 27.725 28.725 20.44 70-74 23.915 27.794999999999998 27.200000000000003 21.09 75-79 22.545 28.335 27.735 21.385 80-84 22.905 28.299999999999997 27.675 21.12 85-89 23.799999999999997 27.73 27.83 20.64 90-94 23.169999999999998 28.32 28.465 20.044999999999998 95-99 23.56 27.77 28.09 20.580000000000002 100-104 23.630000000000003 27.689999999999998 27.775 20.905 105-109 24.365000000000002 27.810000000000002 27.685 20.14 110-114 23.52 28.799999999999997 27.644999999999996 20.035 115-119 24.275 28.794999999999998 27.105 19.825 120-124 23.945 28.384999999999998 27.705000000000002 19.965 125-129 24.2 28.694999999999997 27.084999999999997 20.02 130-134 24.66 28.455000000000002 27.36 19.525000000000002 135-139 24.36 28.005000000000003 28.000000000000004 19.634999999999998 140-144 25.264999999999997 28.134999999999998 27.189999999999998 19.41 145-149 25.31 28.21 27.639999999999997 18.84 150-151 25.6 28.275 27.700000000000003 18.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 2.5 24 3.5 25 4.5 26 5.0 27 5.5 28 10.0 29 19.0 30 27.5 31 25.0 32 27.5 33 40.5 34 50.5 35 70.5 36 98.5 37 117.0 38 135.5 39 168.0 40 196.0 41 220.5 42 259.0 43 285.0 44 276.5 45 265.5 46 264.5 47 252.0 48 218.5 49 186.0 50 160.5 51 141.0 52 119.0 53 84.0 54 72.0 55 61.0 56 40.5 57 27.0 58 18.5 59 12.5 60 7.5 61 5.0 62 2.5 63 3.0 64 1.5 65 0.5 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16413373860182 97.875 2 0.60790273556231 1.2 3 0.12664640324214793 0.375 4 0.050658561296859174 0.2 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025329280648429587 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.1375 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.525 0.0 0.0 0.0 0.0 98-99 1.7000000000000002 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.8 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.35 0.0 0.0 0.0 0.0 112-113 3.8375000000000004 0.0 0.0 0.0 0.0 114-115 4.324999999999999 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.675000000000001 0.0 0.0 0.0 0.0 122-123 6.225 0.0 0.0 0.0 0.0 124-125 6.699999999999999 0.0 0.0 0.0 0.0 126-127 7.2625 0.0 0.0 0.0 0.0 128-129 7.8 0.0 0.0 0.0 0.0 130-131 8.412500000000001 0.0 0.0 0.0 0.0 132-133 9.2 0.0 0.0 0.0 0.0 134-135 9.85 0.0 0.0 0.0 0.0 136-137 10.5625 0.0 0.0 0.0 0.0 138-139 11.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGACGT 10 0.006830828 145.0 3 >>END_MODULE Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra Read 768635 spots for SRR7170815.sra Written 768635 spots for SRR7170815.sra SRR ids: ['SRR7170815.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6i376gwo SRR7170815.sra spots: 15372700 blocks: [[1, 768635], [768636, 1537270], [1537271, 2305905], [2305906, 3074540], [3074541, 3843175], [3843176, 4611810], [4611811, 5380445], [5380446, 6149080], [6149081, 6917715], [6917716, 7686350], [7686351, 8454985], [8454986, 9223620], [9223621, 9992255], [9992256, 10760890], [10760891, 11529525], [11529526, 12298160], [12298161, 13066795], [13066796, 13835430], [13835431, 14604065], [14604066, 15372700]] SRR7170815 file size 5187603 SRR7170815 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170815 SRR7170815_1.fastq SRR7170815_2.fastq Input file: SRR7170815_1.fastq Paired file: SRR7170815_2.fastq trimmed: SRR7170815-trimmed-pair1.fastq, SRR7170815-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:55:19 2025 >> started Thu Feb 13 16:55:39 2025 >> done (20.231s) 15372700 read pairs processed; of these: 20685 ( 0.13%) short read pairs filtered out after trimming by size control 50205 ( 0.33%) empty read pairs filtered out after trimming by size control 15301810 (99.54%) read pairs available; of these: 10753547 (70.28%) trimmed read pairs available after processing 4548263 (29.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 16 0.00% 20 14 0.00% 21 16 0.00% 22 7 0.00% 23 14 0.00% 24 11 0.00% 25 15 0.00% 26 21 0.00% 27 22 0.00% 28 21 0.00% 29 18 0.00% 30 18 0.00% 31 24 0.00% 32 22 0.00% 33 19 0.00% 34 11 0.00% 35 29 0.00% 36 33 0.00% 37 35 0.00% 38 29 0.00% 39 51 0.00% 40 53 0.00% 41 54 0.00% 42 64 0.00% 43 73 0.00% 44 67 0.00% 45 106 0.00% 46 93 0.00% 47 101 0.00% 48 118 0.00% 49 150 0.00% 50 185 0.00% 51 185 0.00% 52 247 0.00% 53 272 0.00% 54 305 0.00% 55 276 0.00% 56 322 0.00% 57 347 0.00% 58 427 0.00% 59 501 0.00% 60 578 0.00% 61 686 0.00% 62 850 0.01% 63 910 0.01% 64 947 0.01% 65 981 0.01% 66 1091 0.01% 67 1171 0.01% 68 1335 0.01% 69 1550 0.01% 70 1816 0.01% 71 2117 0.01% 72 2563 0.02% 73 3054 0.02% 74 3275 0.02% 75 3772 0.02% 76 5427 0.04% 77 5792 0.04% 78 4668 0.03% 79 4757 0.03% 80 5452 0.04% 81 6255 0.04% 82 7172 0.05% 83 8355 0.05% 84 9648 0.06% 85 10068 0.07% 86 10388 0.07% 87 10926 0.07% 88 11273 0.07% 89 11958 0.08% 90 13137 0.09% 91 14625 0.10% 92 16348 0.11% 93 17812 0.12% 94 19423 0.13% 95 20377 0.13% 96 20840 0.14% 97 21171 0.14% 98 21380 0.14% 99 22300 0.15% 100 23769 0.16% 101 25826 0.17% 102 28072 0.18% 103 30378 0.20% 104 32101 0.21% 105 33858 0.22% 106 34310 0.22% 107 34486 0.23% 108 34608 0.23% 109 35363 0.23% 110 36589 0.24% 111 38865 0.25% 112 41330 0.27% 113 43848 0.29% 114 47380 0.31% 115 48730 0.32% 116 49834 0.33% 117 50698 0.33% 118 50745 0.33% 119 50832 0.33% 120 52475 0.34% 121 54933 0.36% 122 57658 0.38% 123 61948 0.40% 124 65223 0.43% 125 68445 0.45% 126 70809 0.46% 127 72784 0.48% 128 73921 0.48% 129 76894 0.50% 130 78939 0.52% 131 81950 0.54% 132 87382 0.57% 133 93681 0.61% 134 100254 0.66% 135 109094 0.71% 136 114932 0.75% 137 123550 0.81% 138 131285 0.86% 139 140064 0.92% 140 151246 0.99% 141 164908 1.08% 142 182709 1.19% 143 209307 1.37% 144 244114 1.60% 145 291877 1.91% 146 359236 2.35% 147 475776 3.11% 148 695365 4.54% 149 1263142 8.25% 150 3897363 25.47% 151 4548263 29.72% 15301810 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=11 prefix-density=0.52 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=28.12 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=54.16 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=12.1 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7170815 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:56:23 Started mapping on | Feb 13 16:56:23 Finished on | Feb 13 16:59:33 Mapping speed, Million of reads per hour | 289.93 Number of input reads | 15301810 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14327335 Uniquely mapped reads % | 93.63% Average mapped length | 287.22 Number of splices: Total | 13695489 Number of splices: Annotated (sjdb) | 13346271 Number of splices: GT/AG | 13439157 Number of splices: GC/AG | 191360 Number of splices: AT/AC | 9160 Number of splices: Non-canonical | 55812 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456225 % of reads mapped to multiple loci | 2.98% Number of reads mapped to too many loci | 36154 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.08% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 533401 533401 533401 N_multimapping 456225 456225 456225 N_noFeature 518831 14035486 645117 N_ambiguous 292224 1192 125969 UnstrandedReadsAssigned:13516280 PositiveStrandReadsAssigned:290657 NegativeStrandReadsAssigned:13556249 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170815 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170815-trimmed-pair1.fastq SRR7170815-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,301,810 reads, 13,507,925 reads pseudoaligned [quant] estimated average fragment length: 228.067 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR7170815.ke.tsv 34699 SRR7170815.se.tsv 87100 total ==> SRR7170815.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.93 1752 60.3417 Potri.005G024800.1.v4.1 1035 807.933 480 36.6462 Potri.004G059700.1.v4.1 961 733.967 9 0.756361 Potri.007G009000.2.v4.1 1416 1188.93 0 0 Potri.003G141000.2.v4.1 2943 2715.93 642 14.5807 Potri.016G087400.1.v4.1 270 92.6854 1340 891.777 Potri.015G069301.1.v4.1 564 342.838 0 0 Potri.010G195200.1.v4.1 1773 1545.93 277.962 11.0906 Potri.012G127500.1.v4.1 977 749.933 28 2.30302 ==> SRR7170815.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 633 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 177 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170815 completed mapping pipeline successfully