Starting /dee2/code/volunteer_pipeline.sh SRR7170816 current disk space = 3088871829504 free memory = 1450181732 SRR7170816 SRAfilesize 23441d63f0522765c3000f0dc0bccc25 SRR7170816.sra SRR7170816.sra file validated SRR7170816 is paired end SRR7170816 is conventional basespace SRR7170816 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170816_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.952 34.0 33.0 34.0 32.0 34.0 2 33.2565 34.0 33.0 34.0 32.0 34.0 3 33.26225 34.0 33.0 34.0 33.0 34.0 4 33.18525 34.0 33.0 34.0 33.0 34.0 5 33.2465 34.0 33.0 34.0 32.0 34.0 6 36.68625 38.0 37.0 38.0 34.0 38.0 7 37.2225 38.0 38.0 38.0 36.0 38.0 8 37.3375 38.0 38.0 38.0 37.0 38.0 9 37.37475 38.0 38.0 38.0 37.0 38.0 10-14 37.42365 38.0 38.0 38.0 37.0 38.0 15-19 37.316700000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.24390000000001 38.0 38.0 38.0 36.6 38.0 25-29 37.22915 38.0 38.0 38.0 36.6 38.0 30-34 37.12735 38.0 38.0 38.0 36.2 38.0 35-39 37.07135 38.0 38.0 38.0 36.0 38.0 40-44 36.896449999999994 38.0 38.0 38.0 35.6 38.0 45-49 36.7635 38.0 38.0 38.0 35.4 38.0 50-54 36.6164 38.0 38.0 38.0 34.6 38.0 55-59 36.572799999999994 38.0 38.0 38.0 34.6 38.0 60-64 36.644549999999995 38.0 38.0 38.0 34.8 38.0 65-69 36.5929 38.0 38.0 38.0 34.6 38.0 70-74 36.446450000000006 38.0 38.0 38.0 34.0 38.0 75-79 35.97760000000001 38.0 38.0 38.0 33.4 38.0 80-84 35.622 38.0 37.0 38.0 32.6 38.0 85-89 35.47945 38.0 37.0 38.0 31.0 38.0 90-94 35.397299999999994 38.0 37.0 38.0 31.0 38.0 95-99 35.2568 38.0 37.0 38.0 30.2 38.0 100-104 35.0865 38.0 36.4 38.0 29.0 38.0 105-109 34.8152 38.0 36.0 38.0 28.4 38.0 110-114 34.57365 38.0 36.0 38.0 26.8 38.0 115-119 34.103449999999995 38.0 34.8 38.0 23.2 38.0 120-124 33.7356 38.0 33.8 38.0 21.4 38.0 125-129 33.37675 38.0 33.2 38.0 18.6 38.0 130-134 32.79795 38.0 33.0 38.0 14.8 38.0 135-139 32.078900000000004 38.0 31.2 38.0 13.0 38.0 140-144 31.279500000000002 37.2 30.0 38.0 12.6 38.0 145-149 30.21725 36.8 28.8 38.0 3.8 38.0 150-151 23.740499999999997 30.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 7.0 9 6.0 10 1.0 11 2.0 12 1.0 13 4.0 14 2.0 15 2.0 16 4.0 17 11.0 18 14.0 19 48.0 20 7.0 21 11.0 22 7.0 23 14.0 24 17.0 25 14.0 26 28.0 27 25.0 28 43.0 29 58.0 30 61.0 31 98.0 32 106.0 33 142.0 34 217.0 35 444.0 36 1062.0 37 1541.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.011378002528446 17.850821744627055 12.718078381795195 28.4197218710493 2 20.275000000000002 21.525 35.75 22.45 3 16.8 27.650000000000002 32.475 23.075000000000003 4 18.75 33.625 25.45 22.175 5 19.875 38.85 22.85 18.425 6 19.225 37.85 24.9 18.025 7 13.075000000000001 25.474999999999998 44.85 16.6 8 15.825 28.275 29.075 26.825 9 17.549999999999997 25.775 31.2 25.474999999999998 10-14 18.98 31.255 26.229999999999997 23.535 15-19 18.85 30.159999999999997 27.845 23.145 20-24 18.65 30.53 27.584999999999997 23.235 25-29 18.845 31.019999999999996 27.11 23.025000000000002 30-34 18.59 30.075000000000003 28.24 23.095 35-39 19.39 30.205 26.724999999999998 23.68 40-44 19.595979798989948 30.916545827291365 27.151357567878392 22.33611680584029 45-49 19.595979798989948 30.07650382519126 27.251362568128407 23.076153807690382 50-54 19.375 30.009999999999998 27.275 23.34 55-59 18.705 29.23 27.82 24.245 60-64 19.235 29.404999999999998 28.055000000000003 23.305 65-69 19.38 30.34 26.68 23.599999999999998 70-74 18.834999999999997 31.72 26.369999999999997 23.075000000000003 75-79 19.16 30.769999999999996 26.865 23.205000000000002 80-84 19.16 30.080000000000002 27.189999999999998 23.57 85-89 19.29 30.464999999999996 27.07 23.175 90-94 19.805 30.025000000000002 26.784999999999997 23.385 95-99 19.650000000000002 29.435 26.775 24.14 100-104 20.015 29.909999999999997 26.729999999999997 23.345 105-109 20.325 29.93 26.13 23.615 110-114 20.005 29.535 27.195000000000004 23.265 115-119 20.195 29.325000000000003 26.08 24.4 120-124 20.419999999999998 29.755 26.150000000000002 23.674999999999997 125-129 20.443066459968996 29.35940391058659 25.713857078561787 24.48367255088263 130-134 20.594118823764752 29.46089217843569 25.31006201240248 24.63492698539708 135-139 20.83520880220055 28.762190547636905 25.896474118529632 24.50612653163291 140-144 20.718107716157423 28.819322898434763 25.058758813822074 25.403810571585737 145-149 20.8970897089709 28.722872287228725 25.757575757575758 24.62246224622462 150-151 20.80260032504063 29.078634829353668 24.803100387548444 25.315664458057256 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.5 3 0.5 4 0.0 5 1.0 6 1.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.5 16 1.0 17 0.5 18 2.0 19 2.0 20 1.0 21 1.5 22 3.5 23 4.5 24 3.5 25 4.0 26 6.5 27 10.5 28 17.5 29 28.0 30 41.0 31 54.0 32 73.5 33 86.5 34 92.0 35 113.5 36 137.0 37 161.0 38 172.0 39 183.0 40 203.0 41 207.0 42 209.5 43 225.5 44 238.0 45 231.5 46 205.0 47 193.0 48 204.5 49 173.5 50 142.5 51 125.5 52 97.0 53 83.0 54 65.0 55 41.5 56 42.5 57 40.0 58 20.5 59 13.0 60 10.0 61 5.5 62 3.5 63 4.0 64 2.0 65 0.5 66 0.0 67 0.0 68 1.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.02 135-139 0.025 140-144 0.015 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.63084474296048 95.45 2 1.0849909584086799 2.1 3 0.12916559028674762 0.375 4 0.10333247222939809 0.4 5 0.0 0.0 6 0.0 0.0 7 0.025833118057349523 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.025833118057349523 1.5 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 60 1.5 TruSeq Adapter, Index 6 (97% over 36bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.5 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.8125 0.0 0.0 0.0 0.0 96-97 2.175 0.0 0.0 0.0 0.0 98-99 2.4749999999999996 0.0 0.0 0.0 0.0 100-101 2.7750000000000004 0.0 0.0 0.0 0.0 102-103 3.15 0.0 0.0 0.0 0.0 104-105 3.6375 0.0 0.0 0.0 0.0 106-107 4.125 0.0 0.0 0.0 0.0 108-109 4.775 0.0 0.0 0.0 0.0 110-111 5.3125 0.0 0.0 0.0 0.0 112-113 5.8875 0.0 0.0 0.0 0.0 114-115 6.487500000000001 0.0 0.0 0.0 0.0 116-117 7.275 0.0 0.0 0.0 0.0 118-119 8.2 0.0 0.0 0.0 0.0 120-121 9.0375 0.0 0.0 0.0 0.0 122-123 9.6875 0.0 0.0 0.0 0.0 124-125 10.3125 0.0 0.0 0.0 0.0 126-127 11.1125 0.0 0.0 0.0 0.0 128-129 12.05 0.0 0.0 0.0 0.0 130-131 13.0 0.0 0.0 0.0 0.0 132-133 13.8125 0.0 0.0 0.0 0.0 134-135 14.649999999999999 0.0 0.0 0.0 0.0 136-137 15.4625 0.0 0.0 0.0 0.0 138-139 16.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 185 1.633059E-5 9.405405 65-69 >>END_MODULE SRR7170816 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170816_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76375 33.0 33.0 34.0 32.0 34.0 2 32.873 33.0 33.0 34.0 32.0 34.0 3 32.83 34.0 33.0 34.0 32.0 34.0 4 32.81075 34.0 33.0 34.0 32.0 34.0 5 32.9045 34.0 33.0 34.0 32.0 34.0 6 37.02675 38.0 38.0 38.0 37.0 38.0 7 37.05175 38.0 38.0 38.0 37.0 38.0 8 37.01875 38.0 38.0 38.0 37.0 38.0 9 37.026 38.0 38.0 38.0 37.0 38.0 10-14 36.984249999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.04505 38.0 38.0 38.0 36.8 38.0 20-24 36.9501 38.0 38.0 38.0 36.6 38.0 25-29 36.870799999999996 38.0 38.0 38.0 36.2 38.0 30-34 36.8029 38.0 38.0 38.0 36.0 38.0 35-39 36.752449999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.804199999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.823299999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.74245 38.0 38.0 38.0 36.0 38.0 55-59 36.73325 38.0 38.0 38.0 36.0 38.0 60-64 36.64594999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.64 38.0 38.0 38.0 35.2 38.0 70-74 36.61005 38.0 38.0 38.0 35.2 38.0 75-79 36.493849999999995 38.0 38.0 38.0 35.0 38.0 80-84 35.82935 38.0 38.0 38.0 33.6 38.0 85-89 35.69885 38.0 38.0 38.0 33.4 38.0 90-94 35.44775 38.0 37.8 38.0 31.8 38.0 95-99 35.467200000000005 38.0 38.0 38.0 32.6 38.0 100-104 35.26965 38.0 37.0 38.0 30.6 38.0 105-109 35.11685 38.0 37.0 38.0 30.0 38.0 110-114 34.888549999999995 38.0 36.8 38.0 28.6 38.0 115-119 34.66445 38.0 36.2 38.0 27.4 38.0 120-124 34.43695 38.0 36.0 38.0 25.6 38.0 125-129 33.94635 38.0 35.2 38.0 21.8 38.0 130-134 33.48225 38.0 34.0 38.0 18.6 38.0 135-139 32.9012 38.0 33.0 38.0 14.4 38.0 140-144 32.17955 38.0 33.0 38.0 13.0 38.0 145-149 31.264249999999997 38.0 31.6 38.0 5.8 38.0 150-151 25.69075 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 4.0 4 2.0 5 2.0 6 0.0 7 4.0 8 3.0 9 4.0 10 0.0 11 1.0 12 2.0 13 5.0 14 11.0 15 4.0 16 4.0 17 10.0 18 12.0 19 14.0 20 55.0 21 8.0 22 12.0 23 11.0 24 24.0 25 13.0 26 17.0 27 24.0 28 35.0 29 41.0 30 40.0 31 53.0 32 89.0 33 100.0 34 169.0 35 267.0 36 698.0 37 2246.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.0 21.25 13.4 19.35 2 28.128128128128125 25.075075075075077 29.57957957957958 17.217217217217218 3 22.127659574468083 26.883604505632043 33.116395494367964 17.872340425531917 4 24.024024024024023 34.48448448448448 22.57257257257257 18.91891891891892 5 25.25025025025025 36.26126126126126 21.396396396396398 17.09209209209209 6 23.036518259129565 36.46823411705853 22.086043021510758 18.409204602301152 7 19.534767383691847 22.311155577788895 37.843921960980495 20.31015507753877 8 23.067300475356518 26.244683512634477 25.268951713785338 25.41906429822367 9 23.536768384192097 24.337168584292147 28.08904452226113 24.037018509254626 10-14 24.457119983988793 28.144701290903633 26.43350345241669 20.964675272690883 15-19 23.334834609418007 27.82865435620277 28.459190311765 20.377320722614222 20-24 24.385481852315394 28.615769712140178 27.16896120150188 19.829787234042552 25-29 23.416295257649356 28.56427462566979 28.098552756773 19.920877359907855 30-34 23.072301221710394 27.102944121770477 29.09573402763869 20.72902062888043 35-39 23.171342685370742 27.249498997995993 27.600200400801604 21.97895791583166 40-44 23.687374749499 26.998997995991985 29.248496993987978 20.06513026052104 45-49 23.291583166332668 28.226452905811623 28.166332665330664 20.31563126252505 50-54 23.82168795391936 26.922113698973206 28.900576008014024 20.35562233909341 55-59 23.862725450901802 27.124248496993985 28.491983967935873 20.521042084168336 60-64 23.684078729904343 26.96449141082787 28.742425001252066 20.609004858015727 65-69 22.975951903807616 28.016032064128254 29.238476953907817 19.769539078156313 70-74 22.857285979061263 28.542804187747333 28.08195161047939 20.517958222712018 75-79 23.716246681028004 28.61079104253294 27.418466008716997 20.254496267722057 80-84 23.100806249687015 28.368971906455005 28.41904952676649 20.11117231709149 85-89 23.56298818345684 28.194472261165632 28.590026036451032 19.652513518926497 90-94 23.37675350701403 28.176352705410824 28.38677354709419 20.060120240480963 95-99 24.203406813627254 27.630260521042082 27.925851703406813 20.240480961923847 100-104 24.2398437108651 28.292340830536496 27.79642338325903 19.671392075339377 105-109 24.243486973947896 26.93386773547094 28.712424849699396 20.11022044088176 110-114 24.804609218436873 28.00100200400802 28.031062124248496 19.163326653306616 115-119 24.485297800931725 28.167109151931076 27.836497520412763 19.51109552672444 120-124 24.680659219556176 27.786404848970598 28.21219255622902 19.320743375244202 125-129 24.62925851703407 28.537074148296593 28.0561122244489 18.77755511022044 130-134 25.651302605210418 27.655310621242485 27.745490981963925 18.947895791583168 135-139 25.626252505010022 27.424849699398795 27.990981963927858 18.95791583166333 140-144 25.516032064128257 27.199398797595194 28.161322645290582 19.12324649298597 145-149 26.20955624561755 26.404888310127216 28.0076129420014 19.37794250225383 150-151 26.790185277916873 26.677516274411616 28.054581872809216 18.477716574862292 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 1.0 5 1.5 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 1.0 22 2.5 23 5.0 24 4.0 25 3.5 26 3.5 27 3.5 28 8.0 29 10.0 30 19.5 31 30.5 32 31.5 33 38.5 34 51.0 35 72.5 36 102.0 37 117.5 38 128.0 39 156.5 40 189.0 41 213.5 42 227.5 43 250.5 44 279.5 45 277.5 46 244.5 47 227.0 48 231.5 49 218.5 50 187.0 51 147.0 52 115.0 53 96.5 54 85.0 55 61.0 56 39.0 57 33.0 58 23.5 59 16.0 60 11.0 61 6.5 62 3.5 63 5.5 64 6.0 65 1.5 66 1.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.125 4 0.1 5 0.1 6 0.05 7 0.05 8 0.075 9 0.05 10-14 0.06999999999999999 15-19 0.08499999999999999 20-24 0.125 25-29 0.155 30-34 0.13999999999999999 35-39 0.2 40-44 0.2 45-49 0.2 50-54 0.17500000000000002 55-59 0.2 60-64 0.165 65-69 0.2 70-74 0.185 75-79 0.19499999999999998 80-84 0.155 85-89 0.13999999999999999 90-94 0.2 95-99 0.2 100-104 0.185 105-109 0.2 110-114 0.2 115-119 0.185 120-124 0.185 125-129 0.2 130-134 0.2 135-139 0.2 140-144 0.2 145-149 0.16999999999999998 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09817057459418 96.15 2 0.6699304303014687 1.3 3 0.07729966503478485 0.22499999999999998 4 0.02576655501159495 0.1 5 0.02576655501159495 0.125 6 0.02576655501159495 0.15 7 0.02576655501159495 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02576655501159495 0.3 >50 0.02576655501159495 1.4749999999999999 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 59 1.4749999999999999 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 12 0.3 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.475 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 90-91 1.1375 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.7625 0.0 0.0 0.0 0.0 96-97 2.1125 0.0 0.0 0.0 0.0 98-99 2.425 0.0 0.0 0.0 0.0 100-101 2.7249999999999996 0.0 0.0 0.0 0.0 102-103 3.0625 0.0 0.0 0.0 0.0 104-105 3.5625 0.0 0.0 0.0 0.0 106-107 3.9875 0.0 0.0 0.0 0.0 108-109 4.6 0.0 0.0 0.0 0.0 110-111 5.137499999999999 0.0 0.0 0.0 0.0 112-113 5.675000000000001 0.0 0.0 0.0 0.0 114-115 6.2875 0.0 0.0 0.0 0.0 116-117 7.1 0.0 0.0 0.0 0.0 118-119 8.025 0.0 0.0 0.0 0.0 120-121 8.8375 0.0 0.0 0.0 0.0 122-123 9.412500000000001 0.0 0.0 0.0 0.0 124-125 10.0 0.0 0.0 0.0 0.0 126-127 10.825 0.0 0.0 0.0 0.0 128-129 11.75 0.0 0.0 0.0 0.0 130-131 12.7375 0.0 0.0 0.0 0.0 132-133 13.6 0.0 0.0 0.0 0.0 134-135 14.4625 0.0 0.0 0.0 0.0 136-137 15.2375 0.0 0.0 0.0 0.0 138-139 15.887500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAAAC 10 0.006830828 145.0 1 >>END_MODULE Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808632 spots for SRR7170816.sra Written 808632 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra Read 808614 spots for SRR7170816.sra Written 808614 spots for SRR7170816.sra SRR ids: ['SRR7170816.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_008sgtsf SRR7170816.sra spots: 16172298 blocks: [[1, 808614], [808615, 1617228], [1617229, 2425842], [2425843, 3234456], [3234457, 4043070], [4043071, 4851684], [4851685, 5660298], [5660299, 6468912], [6468913, 7277526], [7277527, 8086140], [8086141, 8894754], [8894755, 9703368], [9703369, 10511982], [10511983, 11320596], [11320597, 12129210], [12129211, 12937824], [12937825, 13746438], [13746439, 14555052], [14555053, 15363666], [15363667, 16172298]] SRR7170816 file size 5458560 SRR7170816 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170816 SRR7170816_1.fastq SRR7170816_2.fastq Input file: SRR7170816_1.fastq Paired file: SRR7170816_2.fastq trimmed: SRR7170816-trimmed-pair1.fastq, SRR7170816-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 16:57:12 2025 >> started Thu Feb 13 16:57:39 2025 >> done (27.648s) 16172298 read pairs processed; of these: 34326 ( 0.21%) short read pairs filtered out after trimming by size control 270245 ( 1.67%) empty read pairs filtered out after trimming by size control 15867727 (98.12%) read pairs available; of these: 11570555 (72.92%) trimmed read pairs available after processing 4297172 (27.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 28 0.00% 20 25 0.00% 21 26 0.00% 22 36 0.00% 23 39 0.00% 24 49 0.00% 25 44 0.00% 26 56 0.00% 27 60 0.00% 28 48 0.00% 29 48 0.00% 30 55 0.00% 31 61 0.00% 32 66 0.00% 33 51 0.00% 34 54 0.00% 35 61 0.00% 36 68 0.00% 37 89 0.00% 38 115 0.00% 39 138 0.00% 40 110 0.00% 41 130 0.00% 42 150 0.00% 43 137 0.00% 44 161 0.00% 45 193 0.00% 46 261 0.00% 47 249 0.00% 48 307 0.00% 49 363 0.00% 50 373 0.00% 51 454 0.00% 52 532 0.00% 53 514 0.00% 54 606 0.00% 55 628 0.00% 56 734 0.00% 57 755 0.00% 58 903 0.01% 59 1128 0.01% 60 1324 0.01% 61 1514 0.01% 62 1751 0.01% 63 1873 0.01% 64 2002 0.01% 65 2147 0.01% 66 2212 0.01% 67 2416 0.02% 68 2628 0.02% 69 3133 0.02% 70 3709 0.02% 71 4561 0.03% 72 5789 0.04% 73 6421 0.04% 74 7255 0.05% 75 9460 0.06% 76 20969 0.13% 77 19349 0.12% 78 10262 0.06% 79 9603 0.06% 80 10523 0.07% 81 12544 0.08% 82 14179 0.09% 83 16278 0.10% 84 19522 0.12% 85 19582 0.12% 86 20332 0.13% 87 21489 0.14% 88 22334 0.14% 89 23245 0.15% 90 25060 0.16% 91 27821 0.18% 92 30143 0.19% 93 33549 0.21% 94 35878 0.23% 95 36697 0.23% 96 36290 0.23% 97 36101 0.23% 98 35378 0.22% 99 36880 0.23% 100 39152 0.25% 101 41823 0.26% 102 46649 0.29% 103 50589 0.32% 104 53421 0.34% 105 55148 0.35% 106 54781 0.35% 107 54424 0.34% 108 54082 0.34% 109 53380 0.34% 110 54457 0.34% 111 57830 0.36% 112 62189 0.39% 113 66511 0.42% 114 71497 0.45% 115 73451 0.46% 116 74402 0.47% 117 74060 0.47% 118 72682 0.46% 119 71621 0.45% 120 72731 0.46% 121 76065 0.48% 122 79878 0.50% 123 84359 0.53% 124 90932 0.57% 125 93935 0.59% 126 96854 0.61% 127 96884 0.61% 128 97174 0.61% 129 98218 0.62% 130 98808 0.62% 131 101182 0.64% 132 107677 0.68% 133 114898 0.72% 134 122462 0.77% 135 131115 0.83% 136 136761 0.86% 137 143381 0.90% 138 148938 0.94% 139 154813 0.98% 140 160196 1.01% 141 173388 1.09% 142 190228 1.20% 143 214088 1.35% 144 245198 1.55% 145 286493 1.81% 146 348741 2.20% 147 453532 2.86% 148 659239 4.15% 149 1187694 7.48% 150 3680423 23.19% 151 4297172 27.08% 15867727 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.91 fanout-score-rank=15 prefix-density=0.44 prefix-fanout=3.2 sequence=TTGCAGCCATTCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=95.68 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=9.3 sequence=TCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGAT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=10.99 fanout-score-rank=6 prefix-density=1.90 prefix-fanout=1.9 sequence=CACCTGCGACAACTGCGACTGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=35.90 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.2 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7170816 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 16:58:34 Started mapping on | Feb 13 16:58:34 Finished on | Feb 13 17:00:15 Mapping speed, Million of reads per hour | 565.58 Number of input reads | 15867727 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 15098949 Uniquely mapped reads % | 95.16% Average mapped length | 282.36 Number of splices: Total | 11820810 Number of splices: Annotated (sjdb) | 11521385 Number of splices: GT/AG | 11577566 Number of splices: GC/AG | 179859 Number of splices: AT/AC | 10309 Number of splices: Non-canonical | 53076 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.58 Insertion rate per base | 0.03% Insertion average length | 1.99 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410456 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 24344 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.04% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399017 399017 399017 N_multimapping 410456 410456 410456 N_noFeature 505519 14664049 660673 N_ambiguous 401447 1484 120821 UnstrandedReadsAssigned:14191983 PositiveStrandReadsAssigned:433416 NegativeStrandReadsAssigned:14317455 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=135 echo kmer=131 SRR7170816 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170816-trimmed-pair1.fastq SRR7170816-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,867,727 reads, 14,314,566 reads pseudoaligned [quant] estimated average fragment length: 203.407 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR7170816.ke.tsv 34699 SRR7170816.se.tsv 87100 total ==> SRR7170816.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1815.59 406 11.5886 Potri.005G024800.1.v4.1 1035 832.593 199 12.3864 Potri.004G059700.1.v4.1 961 758.614 8 0.546503 Potri.007G009000.2.v4.1 1416 1213.59 0 0 Potri.003G141000.2.v4.1 2943 2740.59 495 9.36018 Potri.016G087400.1.v4.1 270 101.706 918.296 467.909 Potri.015G069301.1.v4.1 564 364.474 0 0 Potri.010G195200.1.v4.1 1773 1570.59 28 0.923885 Potri.012G127500.1.v4.1 977 774.599 483 32.3142 ==> SRR7170816.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 513 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 564 Potri.001G212900.v4.1 65 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 147 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170816 completed mapping pipeline successfully