Starting /dee2/code/volunteer_pipeline.sh SRR7170817 current disk space = 3088725757952 free memory = 1408128404 SRR7170817 SRAfilesize 551ea9eda7d5201f0990abef25111c86 SRR7170817.sra SRR7170817.sra file validated SRR7170817 is paired end SRR7170817 is conventional basespace SRR7170817 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170817_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08225 34.0 33.0 34.0 33.0 34.0 2 33.2995 34.0 33.0 34.0 32.0 34.0 3 33.2855 34.0 33.0 34.0 33.0 34.0 4 33.49775 34.0 34.0 34.0 33.0 34.0 5 33.49825 34.0 33.0 34.0 33.0 34.0 6 37.077 38.0 37.0 38.0 36.0 38.0 7 37.3745 38.0 38.0 38.0 37.0 38.0 8 37.4925 38.0 38.0 38.0 37.0 38.0 9 37.527 38.0 38.0 38.0 37.0 38.0 10-14 37.5467 38.0 38.0 38.0 38.0 38.0 15-19 37.53615 38.0 38.0 38.0 37.8 38.0 20-24 37.51965 38.0 38.0 38.0 37.6 38.0 25-29 37.453149999999994 38.0 38.0 38.0 37.2 38.0 30-34 37.41155 38.0 38.0 38.0 37.0 38.0 35-39 37.38185 38.0 38.0 38.0 37.0 38.0 40-44 37.300200000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2817 38.0 38.0 38.0 36.8 38.0 50-54 37.158100000000005 38.0 38.0 38.0 36.2 38.0 55-59 37.048350000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.018150000000006 38.0 38.0 38.0 36.0 38.0 65-69 37.01604999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.873 38.0 38.0 38.0 35.6 38.0 75-79 36.767 38.0 38.0 38.0 35.4 38.0 80-84 36.623400000000004 38.0 38.0 38.0 34.6 38.0 85-89 36.4841 38.0 38.0 38.0 34.2 38.0 90-94 36.34475 38.0 37.8 38.0 33.8 38.0 95-99 36.172399999999996 38.0 37.2 38.0 33.8 38.0 100-104 36.0957 38.0 37.2 38.0 33.4 38.0 105-109 35.935399999999994 38.0 37.0 38.0 32.6 38.0 110-114 35.82945 38.0 37.0 38.0 32.2 38.0 115-119 35.61475 38.0 36.6 38.0 31.0 38.0 120-124 35.39835 38.0 36.0 38.0 30.4 38.0 125-129 34.9853 38.0 35.6 38.0 28.2 38.0 130-134 34.6392 38.0 34.8 38.0 27.2 38.0 135-139 34.2202 38.0 34.4 38.0 24.6 38.0 140-144 33.6262 38.0 33.0 38.0 21.8 38.0 145-149 32.7664 38.0 33.0 38.0 16.6 38.0 150-151 28.07575 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 2.0 7 0.0 8 0.0 9 2.0 10 1.0 11 1.0 12 1.0 13 2.0 14 2.0 15 1.0 16 1.0 17 2.0 18 4.0 19 10.0 20 0.0 21 6.0 22 3.0 23 9.0 24 6.0 25 6.0 26 18.0 27 21.0 28 24.0 29 41.0 30 51.0 31 67.0 32 84.0 33 114.0 34 194.0 35 302.0 36 837.0 37 2188.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.84675938073996 15.79637890317502 12.0703227499344 28.286538966150616 2 19.625 18.224999999999998 37.45 24.7 3 17.675 27.200000000000003 29.599999999999998 25.525 4 20.5 33.15 24.175 22.175 5 19.725 38.4 23.974999999999998 17.9 6 18.0 35.425000000000004 26.450000000000003 20.125 7 13.350000000000001 23.400000000000002 42.475 20.775 8 17.57939484871218 24.431107776944234 30.282570642660666 27.70692673168292 9 17.125 24.875 31.8 26.200000000000003 10-14 19.655 29.79 26.33 24.224999999999998 15-19 19.1 28.92 28.48 23.5 20-24 19.79 28.84 27.76 23.61 25-29 19.634999999999998 29.595 27.495000000000005 23.275000000000002 30-34 19.54 28.99 28.189999999999998 23.28 35-39 19.641964196419643 28.702870287028702 27.482748274827486 24.172417241724172 40-44 19.97 29.744999999999997 27.145000000000003 23.14 45-49 20.357035703570357 28.512851285128516 27.462746274627463 23.667366736673667 50-54 20.13 28.615000000000002 27.915 23.34 55-59 19.48 29.21 27.52 23.79 60-64 19.865 28.77 28.08 23.285 65-69 19.38 29.01 27.375 24.235 70-74 20.02 28.79 27.815 23.375 75-79 19.575 28.92 27.894999999999996 23.61 80-84 20.19 29.060000000000002 27.3 23.45 85-89 19.945 28.77 27.779999999999998 23.505000000000003 90-94 19.585 28.515 27.66 24.240000000000002 95-99 20.525 28.255000000000003 27.860000000000003 23.36 100-104 19.89 28.675 27.815 23.62 105-109 20.145 28.42 27.98 23.455000000000002 110-114 19.88 28.79 28.395 22.935 115-119 19.8 28.189999999999998 28.144999999999996 23.865 120-124 20.1 29.630000000000003 26.884999999999998 23.385 125-129 20.015 28.52 27.495000000000005 23.97 130-134 20.549999999999997 28.485 27.115000000000002 23.849999999999998 135-139 20.18 28.21 28.04 23.57 140-144 20.635 28.535 27.644999999999996 23.185 145-149 20.235 28.825 27.485 23.455000000000002 150-151 20.275000000000002 29.012500000000003 27.5875 23.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 3.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 2.0 21 1.5 22 2.5 23 4.0 24 6.0 25 6.0 26 4.0 27 11.0 28 16.5 29 18.5 30 24.0 31 35.5 32 42.5 33 53.0 34 73.0 35 91.0 36 108.5 37 114.0 38 144.0 39 181.0 40 181.0 41 197.0 42 222.5 43 244.0 44 244.0 45 242.0 46 253.0 47 236.5 48 234.0 49 213.5 50 167.0 51 143.0 52 114.5 53 83.5 54 76.0 55 65.0 56 45.0 57 29.5 58 18.0 59 12.5 60 8.5 61 5.0 62 4.5 63 3.5 64 1.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18987341772151 97.95 2 0.6075949367088608 1.2 3 0.10126582278481014 0.3 4 0.025316455696202535 0.1 5 0.05063291139240507 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025316455696202535 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 8 0.2 TruSeq Adapter, Index 1 (97% over 36bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5375000000000001 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.65 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.0875 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.4125 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 1.7875 0.0 0.0 0.0 0.0 138-139 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGAG 10 0.0068396386 144.9375 9 >>END_MODULE SRR7170817 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170817_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9295 33.0 33.0 34.0 32.0 34.0 2 33.01825 34.0 33.0 34.0 32.0 34.0 3 33.0745 34.0 33.0 34.0 33.0 34.0 4 32.937 34.0 33.0 34.0 32.0 34.0 5 32.98075 34.0 33.0 34.0 32.0 34.0 6 37.05575 38.0 38.0 38.0 37.0 38.0 7 37.0635 38.0 38.0 38.0 37.0 38.0 8 37.03225 38.0 38.0 38.0 37.0 38.0 9 37.126 38.0 38.0 38.0 37.0 38.0 10-14 37.057300000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.0629 38.0 38.0 38.0 37.0 38.0 20-24 36.98705 38.0 38.0 38.0 36.8 38.0 25-29 36.99380000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.92 38.0 38.0 38.0 36.8 38.0 35-39 36.884249999999994 38.0 38.0 38.0 36.2 38.0 40-44 36.854949999999995 38.0 38.0 38.0 36.2 38.0 45-49 36.84025 38.0 38.0 38.0 36.4 38.0 50-54 36.7613 38.0 38.0 38.0 36.0 38.0 55-59 36.774950000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.71145 38.0 38.0 38.0 36.0 38.0 65-69 36.65965 38.0 38.0 38.0 36.0 38.0 70-74 36.552800000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.53035 38.0 38.0 38.0 35.0 38.0 80-84 36.33539999999999 38.0 38.0 38.0 34.4 38.0 85-89 36.2663 38.0 38.0 38.0 34.0 38.0 90-94 36.1149 38.0 38.0 38.0 33.8 38.0 95-99 36.0058 38.0 38.0 38.0 33.6 38.0 100-104 35.8672 38.0 38.0 38.0 33.0 38.0 105-109 35.722249999999995 38.0 37.4 38.0 32.6 38.0 110-114 35.5755 38.0 37.2 38.0 31.8 38.0 115-119 35.41115 38.0 37.0 38.0 30.6 38.0 120-124 35.158249999999995 38.0 36.4 38.0 29.6 38.0 125-129 34.812850000000005 38.0 36.0 38.0 27.6 38.0 130-134 34.320299999999996 38.0 35.0 38.0 24.0 38.0 135-139 33.70085 38.0 33.8 38.0 21.8 38.0 140-144 33.25064999999999 38.0 33.0 38.0 19.6 38.0 145-149 32.411950000000004 38.0 33.0 38.0 11.0 38.0 150-151 27.593125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 3.0 5 3.0 6 1.0 7 2.0 8 4.0 9 2.0 10 3.0 11 3.0 12 3.0 13 3.0 14 5.0 15 7.0 16 5.0 17 4.0 18 5.0 19 11.0 20 14.0 21 9.0 22 9.0 23 11.0 24 26.0 25 11.0 26 17.0 27 26.0 28 25.0 29 28.0 30 39.0 31 64.0 32 58.0 33 89.0 34 128.0 35 287.0 36 640.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.85 21.275 12.65 20.225 2 24.3 24.0 32.525 19.175 3 20.5 28.375 32.75 18.375 4 23.575 34.050000000000004 23.75 18.625 5 22.400000000000002 37.75 21.6 18.25 6 20.474999999999998 36.675000000000004 24.525 18.325 7 19.125 20.150000000000002 39.125 21.6 8 19.2 24.474999999999998 28.499999999999996 27.825 9 21.5 24.95 28.599999999999998 24.95 10-14 22.8 28.83 26.735 21.634999999999998 15-19 22.495 27.47 28.925 21.11 20-24 22.745 28.435 27.825 20.995 25-29 22.31 28.625 27.875 21.19 30-34 22.52 28.04 28.499999999999996 20.94 35-39 22.285 28.025 28.485 21.205 40-44 22.455 27.400000000000002 28.405 21.740000000000002 45-49 22.225 27.52 29.160000000000004 21.095 50-54 22.7 27.355 29.01 20.935000000000002 55-59 22.665 27.27 28.285 21.78 60-64 22.54 27.834999999999997 27.96 21.665 65-69 22.23 27.900000000000002 28.050000000000004 21.82 70-74 22.805 27.77 28.134999999999998 21.29 75-79 22.335 27.894999999999996 28.544999999999998 21.224999999999998 80-84 22.755 28.585 27.389999999999997 21.27 85-89 22.935 28.13 27.87 21.065 90-94 22.98 28.49 27.779999999999998 20.75 95-99 23.085 28.050000000000004 27.88 20.985 100-104 23.200000000000003 28.27 27.644999999999996 20.885 105-109 23.23 27.515 28.48 20.775 110-114 23.48 27.839999999999996 27.87 20.810000000000002 115-119 23.015 28.105000000000004 28.465 20.415 120-124 23.24 28.1 28.355000000000004 20.305 125-129 23.73 28.139999999999997 28.055000000000003 20.075000000000003 130-134 22.58 28.125 28.465 20.830000000000002 135-139 23.305 27.389999999999997 28.615000000000002 20.69 140-144 22.965 28.349999999999998 28.38 20.305 145-149 23.835 28.055000000000003 27.675 20.435 150-151 23.674999999999997 27.575 28.749999999999996 20.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.5 12 1.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.5 20 2.0 21 2.0 22 2.0 23 2.0 24 3.0 25 5.0 26 6.5 27 8.0 28 10.5 29 14.0 30 18.5 31 26.0 32 30.5 33 42.0 34 61.5 35 67.0 36 83.0 37 107.5 38 130.5 39 159.0 40 194.5 41 222.5 42 247.5 43 262.0 44 265.0 45 276.5 46 260.0 47 243.5 48 232.0 49 197.0 50 159.5 51 139.5 52 112.0 53 86.5 54 83.5 55 66.0 56 45.5 57 38.0 58 30.5 59 19.0 60 10.0 61 5.5 62 5.0 63 4.5 64 2.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08814589665653 97.8 2 0.7345491388044579 1.4500000000000002 3 0.10131712259371835 0.3 4 0.025329280648429587 0.1 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.025329280648429587 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.85 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.7625 0.0 0.0 0.0 0.0 138-139 1.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678901 spots for SRR7170817.sra Written 678901 spots for SRR7170817.sra Read 678915 spots for SRR7170817.sra Written 678915 spots for SRR7170817.sra SRR ids: ['SRR7170817.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2vbn15gz SRR7170817.sra spots: 13578034 blocks: [[1, 678901], [678902, 1357802], [1357803, 2036703], [2036704, 2715604], [2715605, 3394505], [3394506, 4073406], [4073407, 4752307], [4752308, 5431208], [5431209, 6110109], [6110110, 6789010], [6789011, 7467911], [7467912, 8146812], [8146813, 8825713], [8825714, 9504614], [9504615, 10183515], [10183516, 10862416], [10862417, 11541317], [11541318, 12220218], [12220219, 12899119], [12899120, 13578034]] SRR7170817 file size 4579449 SRR7170817 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170817 SRR7170817_1.fastq SRR7170817_2.fastq Input file: SRR7170817_1.fastq Paired file: SRR7170817_2.fastq trimmed: SRR7170817-trimmed-pair1.fastq, SRR7170817-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:03:13 2025 >> started Thu Feb 13 17:03:27 2025 >> done (14.058s) 13578034 read pairs processed; of these: 39938 ( 0.29%) short read pairs filtered out after trimming by size control 62189 ( 0.46%) empty read pairs filtered out after trimming by size control 13475907 (99.25%) read pairs available; of these: 8047593 (59.72%) trimmed read pairs available after processing 5428314 (40.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 20 0.00% 20 23 0.00% 21 31 0.00% 22 30 0.00% 23 41 0.00% 24 42 0.00% 25 34 0.00% 26 49 0.00% 27 40 0.00% 28 39 0.00% 29 60 0.00% 30 39 0.00% 31 42 0.00% 32 46 0.00% 33 57 0.00% 34 40 0.00% 35 49 0.00% 36 45 0.00% 37 41 0.00% 38 72 0.00% 39 62 0.00% 40 65 0.00% 41 59 0.00% 42 77 0.00% 43 66 0.00% 44 80 0.00% 45 71 0.00% 46 73 0.00% 47 99 0.00% 48 111 0.00% 49 118 0.00% 50 113 0.00% 51 131 0.00% 52 151 0.00% 53 164 0.00% 54 153 0.00% 55 157 0.00% 56 167 0.00% 57 197 0.00% 58 236 0.00% 59 233 0.00% 60 254 0.00% 61 296 0.00% 62 345 0.00% 63 325 0.00% 64 316 0.00% 65 354 0.00% 66 328 0.00% 67 382 0.00% 68 402 0.00% 69 466 0.00% 70 526 0.00% 71 631 0.00% 72 893 0.01% 73 856 0.01% 74 1151 0.01% 75 1444 0.01% 76 4573 0.03% 77 4409 0.03% 78 1933 0.01% 79 1601 0.01% 80 1675 0.01% 81 1769 0.01% 82 2029 0.02% 83 2274 0.02% 84 3682 0.03% 85 4359 0.03% 86 4633 0.03% 87 5019 0.04% 88 5208 0.04% 89 5318 0.04% 90 5465 0.04% 91 5416 0.04% 92 5699 0.04% 93 5807 0.04% 94 6002 0.04% 95 6044 0.04% 96 6053 0.04% 97 6242 0.05% 98 6388 0.05% 99 6479 0.05% 100 6903 0.05% 101 7133 0.05% 102 7729 0.06% 103 8045 0.06% 104 8498 0.06% 105 8778 0.07% 106 9178 0.07% 107 9319 0.07% 108 9817 0.07% 109 9891 0.07% 110 10659 0.08% 111 11295 0.08% 112 12039 0.09% 113 12824 0.10% 114 13761 0.10% 115 14457 0.11% 116 15106 0.11% 117 15636 0.12% 118 16487 0.12% 119 17311 0.13% 120 18280 0.14% 121 19618 0.15% 122 20914 0.16% 123 22668 0.17% 124 24341 0.18% 125 25733 0.19% 126 27790 0.21% 127 29314 0.22% 128 31428 0.23% 129 33547 0.25% 130 36139 0.27% 131 38410 0.29% 132 42232 0.31% 133 45811 0.34% 134 50207 0.37% 135 55054 0.41% 136 60106 0.45% 137 66315 0.49% 138 72054 0.53% 139 80175 0.59% 140 90474 0.67% 141 102144 0.76% 142 117783 0.87% 143 140482 1.04% 144 167847 1.25% 145 207265 1.54% 146 267451 1.98% 147 369304 2.74% 148 567547 4.21% 149 1090149 8.09% 150 3781654 28.06% 151 5428314 40.28% 13475907 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=19 prefix-density=0.71 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=34.22 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.6 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTG criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=20 prefix-density=0.96 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=23 fanout-score=20.53 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=6.8 sequence=GCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170817 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:04:11 Started mapping on | Feb 13 17:04:11 Finished on | Feb 13 17:05:39 Mapping speed, Million of reads per hour | 551.29 Number of input reads | 13475907 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 12623694 Uniquely mapped reads % | 93.68% Average mapped length | 294.12 Number of splices: Total | 12593990 Number of splices: Annotated (sjdb) | 12298473 Number of splices: GT/AG | 12359175 Number of splices: GC/AG | 190036 Number of splices: AT/AC | 7904 Number of splices: Non-canonical | 36875 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 332583 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 38016 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.48% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 559406 559406 559406 N_multimapping 332583 332583 332583 N_noFeature 537519 12366506 629007 N_ambiguous 259944 908 93751 UnstrandedReadsAssigned:11826231 PositiveStrandReadsAssigned:256280 NegativeStrandReadsAssigned:11900936 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170817 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170817-trimmed-pair1.fastq SRR7170817-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,475,907 reads, 11,824,419 reads pseudoaligned [quant] estimated average fragment length: 294.871 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7170817.ke.tsv 34699 SRR7170817.se.tsv 87100 total ==> SRR7170817.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1724.13 651 25.4522 Potri.005G024800.1.v4.1 1035 741.129 227 20.6465 Potri.004G059700.1.v4.1 961 667.22 5 0.505144 Potri.007G009000.2.v4.1 1416 1122.13 0 0 Potri.003G141000.2.v4.1 2943 2649.13 788 20.051 Potri.016G087400.1.v4.1 270 63.4239 938 996.928 Potri.015G069301.1.v4.1 564 281.093 0 0 Potri.010G195200.1.v4.1 1773 1479.13 25 1.13933 Potri.012G127500.1.v4.1 977 683.21 62 6.11718 ==> SRR7170817.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 229 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 252 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7170817 completed mapping pipeline successfully