Starting /dee2/code/volunteer_pipeline.sh SRR7170818 current disk space = 3088646549504 free memory = 1496904964 SRR7170818 SRAfilesize ea8c8ae0e61d3bee1caba39c5941f789 SRR7170818.sra SRR7170818.sra file validated SRR7170818 is paired end SRR7170818 is conventional basespace SRR7170818 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170818_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86775 34.0 33.0 34.0 32.0 34.0 2 33.222 34.0 33.0 34.0 32.0 34.0 3 33.20875 34.0 33.0 34.0 31.0 34.0 4 33.22275 34.0 33.0 34.0 33.0 34.0 5 33.26375 34.0 33.0 34.0 33.0 34.0 6 36.65475 38.0 37.0 38.0 34.0 38.0 7 37.203 38.0 38.0 38.0 36.0 38.0 8 37.322 38.0 38.0 38.0 37.0 38.0 9 37.45575 38.0 38.0 38.0 37.0 38.0 10-14 37.39045 38.0 38.0 38.0 37.0 38.0 15-19 37.29565 38.0 38.0 38.0 37.0 38.0 20-24 37.22905 38.0 38.0 38.0 36.4 38.0 25-29 37.23315 38.0 38.0 38.0 36.6 38.0 30-34 37.195899999999995 38.0 38.0 38.0 36.4 38.0 35-39 37.12615 38.0 38.0 38.0 36.0 38.0 40-44 36.99985 38.0 38.0 38.0 35.8 38.0 45-49 36.8451 38.0 38.0 38.0 35.4 38.0 50-54 36.71905 38.0 38.0 38.0 34.8 38.0 55-59 36.6888 38.0 38.0 38.0 34.8 38.0 60-64 36.69385 38.0 38.0 38.0 34.8 38.0 65-69 36.633799999999994 38.0 38.0 38.0 34.2 38.0 70-74 36.4716 38.0 38.0 38.0 34.0 38.0 75-79 36.313700000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.108399999999996 38.0 37.4 38.0 33.4 38.0 85-89 35.995000000000005 38.0 37.2 38.0 32.8 38.0 90-94 35.87060000000001 38.0 37.0 38.0 32.6 38.0 95-99 35.79485 38.0 37.0 38.0 32.4 38.0 100-104 35.5856 38.0 37.0 38.0 30.6 38.0 105-109 35.2432 38.0 36.0 38.0 29.0 38.0 110-114 35.040000000000006 38.0 35.8 38.0 28.4 38.0 115-119 34.64835 38.0 35.0 38.0 26.6 38.0 120-124 34.34405 38.0 34.2 38.0 24.8 38.0 125-129 33.881899999999995 38.0 33.0 38.0 22.8 38.0 130-134 33.45399999999999 38.0 33.0 38.0 20.8 38.0 135-139 32.6906 38.0 32.8 38.0 15.2 38.0 140-144 31.846799999999995 37.6 31.0 38.0 13.2 38.0 145-149 30.81225 37.0 30.0 38.0 6.2 38.0 150-151 24.591 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 1.0 9 0.0 10 3.0 11 2.0 12 2.0 13 2.0 14 0.0 15 4.0 16 4.0 17 4.0 18 10.0 19 14.0 20 8.0 21 5.0 22 7.0 23 14.0 24 17.0 25 15.0 26 28.0 27 44.0 28 34.0 29 46.0 30 67.0 31 104.0 32 112.0 33 154.0 34 222.0 35 398.0 36 1042.0 37 1635.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.0 16.860759493670884 10.329113924050633 28.810126582278485 2 21.475 20.225 35.175 23.125 3 18.375 27.6 30.125 23.9 4 19.6 34.300000000000004 24.9 21.2 5 20.225 37.6 23.974999999999998 18.2 6 18.95 34.675 26.150000000000002 20.225 7 14.299999999999999 22.975 43.95 18.775 8 18.725 22.975 30.5 27.800000000000004 9 17.474999999999998 24.675 31.6 26.25 10-14 20.34 28.625 27.095000000000002 23.94 15-19 20.36 28.075 28.084999999999997 23.48 20-24 19.475 29.205 28.360000000000003 22.96 25-29 20.06 27.994999999999997 28.4 23.544999999999998 30-34 19.615 28.915000000000003 28.360000000000003 23.11 35-39 20.145 28.065 28.08 23.71 40-44 20.064999999999998 28.794999999999998 27.689999999999998 23.45 45-49 20.080000000000002 28.444999999999997 28.050000000000004 23.425 50-54 19.755 28.425 28.205000000000002 23.615 55-59 20.025000000000002 27.77 28.33 23.875 60-64 20.11 28.904999999999998 27.66 23.325000000000003 65-69 20.305 28.46 27.950000000000003 23.285 70-74 20.080000000000002 28.860000000000003 27.800000000000004 23.26 75-79 20.155 29.035 27.49 23.32 80-84 20.825 28.595 27.79 22.79 85-89 20.535 29.110000000000003 27.065 23.29 90-94 20.575 28.494999999999997 27.305 23.625 95-99 20.645 28.945 27.250000000000004 23.16 100-104 20.865000000000002 28.99 26.895000000000003 23.25 105-109 20.395 28.565 27.425 23.615 110-114 20.445 28.625 27.560000000000002 23.369999999999997 115-119 21.015 28.705000000000002 26.605 23.674999999999997 120-124 21.055 28.199999999999996 26.584999999999997 24.16 125-129 20.919999999999998 28.375 26.41 24.295 130-134 21.141057052852645 27.92139606980349 26.96634831741587 23.971198559928 135-139 21.391069553477674 28.261413070653536 25.42127106355318 24.926246312315616 140-144 20.841042052102605 28.0114005700285 26.276313815690784 24.87124356217811 145-149 21.075 28.189999999999998 25.885 24.85 150-151 20.575 29.25 25.837500000000002 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 1.0 3 1.5 4 0.5 5 0.0 6 1.0 7 2.0 8 1.0 9 1.0 10 1.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.5 21 2.5 22 2.5 23 3.0 24 5.5 25 5.0 26 7.5 27 13.5 28 17.0 29 19.0 30 22.0 31 27.0 32 39.0 33 50.0 34 54.5 35 76.0 36 99.0 37 120.0 38 137.0 39 148.0 40 180.0 41 223.0 42 232.5 43 250.0 44 282.0 45 274.0 46 248.5 47 229.0 48 221.0 49 198.0 50 160.0 51 136.5 52 114.0 53 86.0 54 75.5 55 57.0 56 42.0 57 37.5 58 23.5 59 14.0 60 12.5 61 16.0 62 11.0 63 3.0 64 0.5 65 1.5 66 2.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.005 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.23819197562214 97.7 2 0.5586592178770949 1.0999999999999999 3 0.07618080243778569 0.22499999999999998 4 0.07618080243778569 0.3 5 0.0 0.0 6 0.025393600812595223 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025393600812595223 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 21 0.525 TruSeq Adapter, Index 8 (97% over 36bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.6625000000000001 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.0499999999999998 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.35 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.325 0.0 0.0 0.0 0.0 100-101 2.675 0.0 0.0 0.0 0.0 102-103 3.175 0.0 0.0 0.0 0.0 104-105 3.5625 0.0 0.0 0.0 0.0 106-107 4.1 0.0 0.0 0.0 0.0 108-109 4.7125 0.0 0.0 0.0 0.0 110-111 5.25 0.0 0.0 0.0 0.0 112-113 5.775 0.0 0.0 0.0 0.0 114-115 6.5125 0.0 0.0 0.0 0.0 116-117 7.3125 0.0 0.0 0.0 0.0 118-119 7.9875 0.0 0.0 0.0 0.0 120-121 8.6125 0.0 0.0 0.0 0.0 122-123 9.325 0.0 0.0 0.0 0.0 124-125 10.0 0.0 0.0 0.0 0.0 126-127 10.8125 0.0 0.0 0.0 0.0 128-129 11.825 0.0 0.0 0.0 0.0 130-131 12.600000000000001 0.0 0.0 0.0 0.0 132-133 13.5375 0.0 0.0 0.0 0.0 134-135 14.2625 0.0 0.0 0.0 0.0 136-137 15.175 0.0 0.0 0.0 0.0 138-139 16.112499999999997 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGGAA 10 0.006832588 144.9875 3 >>END_MODULE SRR7170818 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170818_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.761 33.0 33.0 34.0 32.0 34.0 2 32.8895 33.0 33.0 34.0 32.0 34.0 3 32.9165 34.0 33.0 34.0 32.0 34.0 4 32.86825 34.0 33.0 34.0 32.0 34.0 5 32.9595 34.0 33.0 34.0 32.0 34.0 6 37.017 38.0 38.0 38.0 36.0 38.0 7 37.04525 38.0 38.0 38.0 37.0 38.0 8 37.09525 38.0 38.0 38.0 37.0 38.0 9 37.159 38.0 38.0 38.0 37.0 38.0 10-14 37.0441 38.0 38.0 38.0 36.8 38.0 15-19 37.0089 38.0 38.0 38.0 37.0 38.0 20-24 36.93765 38.0 38.0 38.0 36.2 38.0 25-29 36.90065 38.0 38.0 38.0 36.2 38.0 30-34 36.823600000000006 38.0 38.0 38.0 36.2 38.0 35-39 36.7897 38.0 38.0 38.0 35.8 38.0 40-44 36.86165 38.0 38.0 38.0 36.4 38.0 45-49 36.86015 38.0 38.0 38.0 36.0 38.0 50-54 36.78835 38.0 38.0 38.0 36.0 38.0 55-59 36.83434999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.708 38.0 38.0 38.0 35.6 38.0 65-69 36.712199999999996 38.0 38.0 38.0 35.4 38.0 70-74 36.628550000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.511700000000005 38.0 38.0 38.0 34.8 38.0 80-84 36.32165 38.0 38.0 38.0 34.8 38.0 85-89 36.1983 38.0 38.0 38.0 34.0 38.0 90-94 35.9206 38.0 38.0 38.0 33.2 38.0 95-99 35.901650000000004 38.0 38.0 38.0 33.4 38.0 100-104 35.76995000000001 38.0 37.6 38.0 32.6 38.0 105-109 35.6963 38.0 37.2 38.0 32.0 38.0 110-114 35.421549999999996 38.0 37.0 38.0 30.6 38.0 115-119 35.12725 38.0 36.4 38.0 29.2 38.0 120-124 34.9052 38.0 36.0 38.0 27.8 38.0 125-129 34.44015 38.0 35.6 38.0 25.2 38.0 130-134 34.0022 38.0 34.0 38.0 23.2 38.0 135-139 33.326499999999996 38.0 33.0 38.0 19.6 38.0 140-144 32.6238 38.0 33.0 38.0 13.2 38.0 145-149 31.48025 38.0 32.2 38.0 6.0 38.0 150-151 25.865000000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 5.0 5 2.0 6 1.0 7 3.0 8 2.0 9 2.0 10 0.0 11 4.0 12 1.0 13 4.0 14 3.0 15 1.0 16 7.0 17 6.0 18 9.0 19 4.0 20 23.0 21 9.0 22 8.0 23 16.0 24 17.0 25 18.0 26 31.0 27 23.0 28 31.0 29 51.0 30 55.0 31 63.0 32 67.0 33 115.0 34 138.0 35 264.0 36 736.0 37 2266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.125 20.225 11.700000000000001 20.95 2 27.120340255191394 23.34250688016012 31.123342506880157 18.413810357768327 3 22.597597597597595 26.8018018018018 32.45745745745746 18.143143143143142 4 24.312156078039017 34.417208604302154 22.28614307153577 18.98449224612306 5 23.08654327163582 37.693846923461734 21.335667833916958 17.883941970985493 6 20.885442721360683 37.793896948474234 23.06153076538269 18.25912956478239 7 18.42960740185046 19.72993248312078 40.36009002250563 21.48037009252313 8 20.31015507753877 24.23711855927964 28.23911955977989 27.213606803401703 9 21.585792896448226 25.012506253126567 30.115057528764382 23.28664332166083 10-14 23.94197098549275 28.559279639819913 26.133066533266636 21.36568284142071 15-19 23.38403041825095 27.95677406443866 27.71162697618571 20.947568541124674 20-24 23.473473473473476 28.313313313313316 27.872872872872872 20.34034034034034 25-29 23.383059671605928 28.56427713255907 27.748297957549056 20.304365238285943 30-34 22.926365320118137 27.882064374030136 28.617910597186764 20.573659708664966 35-39 22.823529411764707 27.97997496871089 28.120150187734666 21.076345431789736 40-44 23.198998748435546 27.614518147684606 28.355444305381727 20.83103879849812 45-49 22.573216520650814 28.35043804755945 28.275344180225282 20.801001251564454 50-54 23.04881101376721 27.274092615769714 28.77596996245307 20.90112640801001 55-59 23.554443053817273 27.88485607008761 27.524405506883603 21.036295369211512 60-64 23.028785982478098 27.779724655819777 28.11013767209011 21.081351689612017 65-69 23.34918648310388 27.02377972465582 28.390488110137674 21.23654568210263 70-74 23.34918648310388 28.34543178973717 27.589486858573213 20.715894868585732 75-79 22.91364205256571 28.51564455569462 27.664580725907385 20.906132665832292 80-84 23.173967459324153 28.370463078848562 27.784730913642054 20.67083854818523 85-89 23.564455569461828 28.21026282853567 27.284105131414265 20.941176470588236 90-94 23.449311639549435 28.28535669586984 27.899874843554446 20.36545682102628 95-99 23.804755944931163 27.479349186483105 28.335419274092615 20.380475594493117 100-104 23.664580725907385 28.180225281602 27.59949937421777 20.55569461827284 105-109 24.245306633291612 28.010012515644554 27.614518147684606 20.130162703379224 110-114 24.28035043804756 27.5694618272841 27.589486858573213 20.56070087609512 115-119 24.750938673341675 28.435544430538172 27.304130162703377 19.50938673341677 120-124 24.86107634543179 27.79974968710889 27.739674593241553 19.59949937421777 125-129 25.30162703379224 28.270337922403005 26.518147684605758 19.909887359199 130-134 25.60700876095119 27.734668335419272 26.593241551939922 20.065081351689614 135-139 25.762202753441805 27.60450563204005 27.008760951188986 19.62453066332916 140-144 25.772215269086356 28.240300375469335 26.62828535669587 19.359198998748436 145-149 26.593241551939922 27.2540675844806 26.703379224030037 19.44931163954944 150-151 26.320400500625784 27.872340425531917 26.72090112640801 19.086357947434294 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 2.0 2 1.5 3 0.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 2.5 26 4.5 27 6.5 28 11.0 29 15.5 30 20.0 31 26.0 32 28.0 33 36.5 34 57.0 35 73.0 36 91.5 37 108.0 38 122.5 39 144.0 40 188.0 41 214.0 42 233.0 43 260.5 44 271.0 45 276.5 46 270.0 47 247.5 48 216.0 49 188.5 50 166.0 51 148.5 52 120.0 53 102.5 54 87.0 55 71.0 56 55.0 57 33.5 58 21.0 59 17.5 60 17.0 61 11.0 62 5.5 63 3.5 64 3.5 65 2.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.1 4 0.05 5 0.05 6 0.05 7 0.025 8 0.05 9 0.05 10-14 0.05 15-19 0.06 20-24 0.1 25-29 0.12 30-34 0.11499999999999999 35-39 0.125 40-44 0.125 45-49 0.125 50-54 0.125 55-59 0.125 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.125 85-89 0.125 90-94 0.125 95-99 0.125 100-104 0.125 105-109 0.125 110-114 0.125 115-119 0.125 120-124 0.125 125-129 0.125 130-134 0.125 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13617886178862 97.55 2 0.5589430894308943 1.0999999999999999 3 0.22865853658536583 0.675 4 0.05081300813008131 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025406504065040653 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 19 0.475 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.0499999999999998 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.35 0.0 0.0 0.0 0.0 100-101 2.7 0.0 0.0 0.0 0.0 102-103 3.175 0.0 0.0 0.0 0.0 104-105 3.55 0.0 0.0 0.0 0.0 106-107 4.075 0.0 0.0 0.0 0.0 108-109 4.75 0.0 0.0 0.0 0.0 110-111 5.275 0.0 0.0 0.0 0.0 112-113 5.8125 0.0 0.0 0.0 0.0 114-115 6.575 0.0 0.0 0.0 0.0 116-117 7.3875 0.0 0.0 0.0 0.0 118-119 8.05 0.0 0.0 0.0 0.0 120-121 8.6 0.0 0.0 0.0 0.0 122-123 9.2875 0.0 0.0 0.0 0.0 124-125 9.975 0.0 0.0 0.0 0.0 126-127 10.825 0.0 0.0 0.0 0.0 128-129 11.825 0.0 0.0 0.0 0.0 130-131 12.575 0.0 0.0 0.0 0.0 132-133 13.5125 0.0 0.0 0.0 0.0 134-135 14.25 0.0 0.0 0.0 0.0 136-137 15.2 0.0 0.0 0.0 0.0 138-139 16.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840314 spots for SRR7170818.sra Written 840314 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra Read 840295 spots for SRR7170818.sra Written 840295 spots for SRR7170818.sra SRR ids: ['SRR7170818.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3ax54rdo SRR7170818.sra spots: 16805919 blocks: [[1, 840295], [840296, 1680590], [1680591, 2520885], [2520886, 3361180], [3361181, 4201475], [4201476, 5041770], [5041771, 5882065], [5882066, 6722360], [6722361, 7562655], [7562656, 8402950], [8402951, 9243245], [9243246, 10083540], [10083541, 10923835], [10923836, 11764130], [11764131, 12604425], [12604426, 13444720], [13444721, 14285015], [14285016, 15125310], [15125311, 15965605], [15965606, 16805919]] SRR7170818 file size 5673274 SRR7170818 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170818 SRR7170818_1.fastq SRR7170818_2.fastq Input file: SRR7170818_1.fastq Paired file: SRR7170818_2.fastq trimmed: SRR7170818-trimmed-pair1.fastq, SRR7170818-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:15:19 2025 >> started Thu Feb 13 17:15:38 2025 >> done (18.344s) 16805919 read pairs processed; of these: 36585 ( 0.22%) short read pairs filtered out after trimming by size control 80215 ( 0.48%) empty read pairs filtered out after trimming by size control 16689119 (99.31%) read pairs available; of these: 12136767 (72.72%) trimmed read pairs available after processing 4552352 (27.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 18 0.00% 20 23 0.00% 21 25 0.00% 22 24 0.00% 23 43 0.00% 24 37 0.00% 25 41 0.00% 26 51 0.00% 27 54 0.00% 28 42 0.00% 29 47 0.00% 30 51 0.00% 31 46 0.00% 32 55 0.00% 33 58 0.00% 34 62 0.00% 35 87 0.00% 36 58 0.00% 37 67 0.00% 38 109 0.00% 39 103 0.00% 40 127 0.00% 41 136 0.00% 42 138 0.00% 43 138 0.00% 44 155 0.00% 45 164 0.00% 46 216 0.00% 47 232 0.00% 48 275 0.00% 49 337 0.00% 50 378 0.00% 51 410 0.00% 52 448 0.00% 53 516 0.00% 54 519 0.00% 55 588 0.00% 56 665 0.00% 57 789 0.00% 58 876 0.01% 59 981 0.01% 60 1137 0.01% 61 1291 0.01% 62 1492 0.01% 63 1670 0.01% 64 1852 0.01% 65 1989 0.01% 66 2246 0.01% 67 2411 0.01% 68 2553 0.02% 69 3076 0.02% 70 3580 0.02% 71 4048 0.02% 72 4806 0.03% 73 5264 0.03% 74 6070 0.04% 75 6952 0.04% 76 9890 0.06% 77 9717 0.06% 78 8303 0.05% 79 8713 0.05% 80 9800 0.06% 81 11110 0.07% 82 12760 0.08% 83 14697 0.09% 84 17870 0.11% 85 18011 0.11% 86 18913 0.11% 87 20496 0.12% 88 21526 0.13% 89 22454 0.13% 90 24218 0.15% 91 25992 0.16% 92 27999 0.17% 93 30646 0.18% 94 32112 0.19% 95 33996 0.20% 96 34270 0.21% 97 34471 0.21% 98 35410 0.21% 99 37072 0.22% 100 39179 0.23% 101 41105 0.25% 102 45094 0.27% 103 47220 0.28% 104 50330 0.30% 105 51841 0.31% 106 52937 0.32% 107 52962 0.32% 108 53800 0.32% 109 54569 0.33% 110 56344 0.34% 111 58938 0.35% 112 61871 0.37% 113 65144 0.39% 114 69117 0.41% 115 70783 0.42% 116 72151 0.43% 117 72818 0.44% 118 73330 0.44% 119 73430 0.44% 120 75178 0.45% 121 78588 0.47% 122 81037 0.49% 123 86100 0.52% 124 89722 0.54% 125 92440 0.55% 126 96139 0.58% 127 96938 0.58% 128 98967 0.59% 129 101189 0.61% 130 103569 0.62% 131 107556 0.64% 132 112445 0.67% 133 119445 0.72% 134 126298 0.76% 135 135447 0.81% 136 141231 0.85% 137 148771 0.89% 138 157869 0.95% 139 165109 0.99% 140 174316 1.04% 141 187519 1.12% 142 207563 1.24% 143 233224 1.40% 144 265489 1.59% 145 310822 1.86% 146 379170 2.27% 147 492585 2.95% 148 719528 4.31% 149 1288873 7.72% 150 3920593 23.49% 151 4552352 27.28% 16689119 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=15 prefix-density=0.55 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=33.95 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=10.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCTGCAAATGCATCAGGATCATCAGCGAGGCCAAGTGGGTCAAAGGCACCGCCAGGATAAATGGGGTCAAGTCCTTCGCCAAGTGGCCCTCCACCCACTCTGTACCCTTCAACGAATCCCATAAGCACAACCTGGGAAGCCCAGATGGCGAGGATGCTCTGAGCATGGATGAGGTTGGGGTTGCCAAGGTAATCAAGGCCACCCTCTGAGAAGATTTGAGCTCCAGCCTTGAACCA criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=22 prefix-density=0.72 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.18 sequence-density-rank=19 fanout-score=14.17 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=5.2 sequence=AGCAATGGCAGCA SRR7170818 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:16:21 Started mapping on | Feb 13 17:16:21 Finished on | Feb 13 17:18:03 Mapping speed, Million of reads per hour | 589.03 Number of input reads | 16689119 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 15613626 Uniquely mapped reads % | 93.56% Average mapped length | 283.29 Number of splices: Total | 13986772 Number of splices: Annotated (sjdb) | 13635584 Number of splices: GT/AG | 13705433 Number of splices: GC/AG | 216328 Number of splices: AT/AC | 9473 Number of splices: Non-canonical | 55538 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 426164 % of reads mapped to multiple loci | 2.55% Number of reads mapped to too many loci | 101419 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 687609 687609 687609 N_multimapping 426164 426164 426164 N_noFeature 704073 15244616 865317 N_ambiguous 318639 1649 109667 UnstrandedReadsAssigned:14590914 PositiveStrandReadsAssigned:367361 NegativeStrandReadsAssigned:14638642 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR7170818 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170818-trimmed-pair1.fastq SRR7170818-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,689,119 reads, 14,698,493 reads pseudoaligned [quant] estimated average fragment length: 208.391 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR7170818.ke.tsv 34699 SRR7170818.se.tsv 87100 total ==> SRR7170818.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1810.61 438 13.8658 Potri.005G024800.1.v4.1 1035 827.609 119 8.24173 Potri.004G059700.1.v4.1 961 753.619 15 1.14087 Potri.007G009000.2.v4.1 1416 1208.61 0 0 Potri.003G141000.2.v4.1 2943 2735.61 611.716 12.8172 Potri.016G087400.1.v4.1 270 99.7715 716 411.343 Potri.015G069301.1.v4.1 564 360.942 0 0 Potri.010G195200.1.v4.1 1773 1565.61 25 0.915279 Potri.012G127500.1.v4.1 977 769.614 249 18.5448 ==> SRR7170818.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 828 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 457 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR7170818 completed mapping pipeline successfully