Starting /dee2/code/volunteer_pipeline.sh SRR7170819 current disk space = 3088619675648 free memory = 1582648820 SRR7170819 SRAfilesize 51c5d5ac168e439ee38cb30608061bb4 SRR7170819.sra SRR7170819.sra file validated SRR7170819 is paired end SRR7170819 is conventional basespace SRR7170819 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170819_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0115 34.0 33.0 34.0 33.0 34.0 2 33.2965 34.0 33.0 34.0 33.0 34.0 3 33.26075 34.0 33.0 34.0 33.0 34.0 4 33.21575 34.0 33.0 34.0 33.0 34.0 5 33.26275 34.0 33.0 34.0 33.0 34.0 6 36.6615 38.0 37.0 38.0 34.0 38.0 7 37.1305 38.0 38.0 38.0 36.0 38.0 8 37.23975 38.0 38.0 38.0 37.0 38.0 9 37.315 38.0 38.0 38.0 36.0 38.0 10-14 37.38589999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.346799999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.2421 38.0 38.0 38.0 36.6 38.0 25-29 37.22580000000001 38.0 38.0 38.0 36.6 38.0 30-34 37.21294999999999 38.0 38.0 38.0 36.0 38.0 35-39 37.178149999999995 38.0 38.0 38.0 36.0 38.0 40-44 37.03959999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.94385 38.0 38.0 38.0 35.6 38.0 50-54 36.87065 38.0 38.0 38.0 35.0 38.0 55-59 36.8109 38.0 38.0 38.0 35.2 38.0 60-64 36.75545 38.0 38.0 38.0 34.8 38.0 65-69 36.67885 38.0 38.0 38.0 34.2 38.0 70-74 36.6357 38.0 38.0 38.0 34.4 38.0 75-79 36.405449999999995 38.0 38.0 38.0 34.0 38.0 80-84 36.155 38.0 37.2 38.0 33.8 38.0 85-89 36.054449999999996 38.0 37.2 38.0 33.2 38.0 90-94 35.984249999999996 38.0 37.0 38.0 33.0 38.0 95-99 35.883950000000006 38.0 37.0 38.0 32.2 38.0 100-104 35.6551 38.0 37.0 38.0 31.8 38.0 105-109 35.39594999999999 38.0 36.0 38.0 29.8 38.0 110-114 35.18055 38.0 36.0 38.0 28.8 38.0 115-119 34.8266 38.0 35.0 38.0 27.4 38.0 120-124 34.31855 38.0 34.2 38.0 24.4 38.0 125-129 33.866150000000005 38.0 33.4 38.0 22.8 38.0 130-134 33.33305 38.0 33.0 38.0 20.0 38.0 135-139 32.6591 38.0 32.6 38.0 15.0 38.0 140-144 31.851599999999998 37.8 30.8 38.0 13.0 38.0 145-149 30.746450000000003 36.8 29.8 38.0 7.8 38.0 150-151 24.612875000000003 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 1.0 13 3.0 14 0.0 15 2.0 16 1.0 17 2.0 18 4.0 19 14.0 20 10.0 21 6.0 22 6.0 23 12.0 24 20.0 25 21.0 26 31.0 27 33.0 28 38.0 29 50.0 30 66.0 31 81.0 32 113.0 33 167.0 34 247.0 35 421.0 36 1025.0 37 1621.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.573447753659764 15.699141847551742 10.17163048965169 29.5557799091368 2 22.3 19.75 34.825 23.125 3 17.45 26.8 30.975 24.775 4 22.2 32.35 24.75 20.7 5 21.725 36.85 23.825 17.599999999999998 6 18.0 36.0 25.275 20.724999999999998 7 13.625000000000002 25.0 42.725 18.65 8 17.95 22.55 30.875000000000004 28.625 9 17.549999999999997 23.400000000000002 32.05 27.0 10-14 20.135 28.985 27.1 23.78 15-19 19.595000000000002 28.499999999999996 28.000000000000004 23.905 20-24 19.314999999999998 29.12 28.110000000000003 23.455000000000002 25-29 20.535 28.96 27.1 23.405 30-34 19.66 28.9 28.025 23.415 35-39 20.265 28.4 27.534999999999997 23.799999999999997 40-44 20.16 28.749999999999996 28.345 22.745 45-49 20.05 28.84 27.339999999999996 23.77 50-54 20.044999999999998 28.32 27.634999999999998 24.0 55-59 20.21 28.025 27.800000000000004 23.965 60-64 19.735 28.63 27.63 24.005000000000003 65-69 20.29 28.265 28.02 23.425 70-74 19.950000000000003 28.4 27.334999999999997 24.315 75-79 20.1 27.93 27.92 24.05 80-84 20.380000000000003 28.939999999999998 27.3 23.380000000000003 85-89 20.119999999999997 28.87 27.505000000000003 23.505000000000003 90-94 20.8 28.360000000000003 27.145000000000003 23.695 95-99 20.16 28.475 27.765 23.599999999999998 100-104 21.099999999999998 28.525 26.950000000000003 23.425 105-109 20.605 27.779999999999998 27.644999999999996 23.97 110-114 20.405 28.22 27.66 23.715 115-119 21.08 28.595 26.915 23.41 120-124 20.315 28.720000000000002 26.935 24.03 125-129 21.095 28.299999999999997 26.575 24.03 130-134 21.415 28.155 26.179999999999996 24.25 135-139 21.2 28.285 26.224999999999998 24.29 140-144 21.51 28.345 25.779999999999998 24.365000000000002 145-149 20.91 29.294999999999998 26.419999999999998 23.375 150-151 20.575 27.737499999999997 26.875 24.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 0.5 21 0.5 22 2.5 23 5.0 24 4.5 25 4.5 26 6.0 27 8.5 28 10.5 29 14.0 30 18.5 31 24.0 32 35.0 33 43.5 34 59.0 35 78.0 36 93.5 37 106.5 38 138.0 39 170.5 40 195.0 41 218.0 42 239.0 43 257.5 44 268.5 45 262.5 46 238.0 47 231.5 48 229.5 49 209.5 50 183.5 51 144.0 52 125.0 53 105.5 54 71.0 55 51.5 56 36.5 57 31.0 58 16.5 59 12.5 60 14.5 61 10.5 62 8.0 63 5.5 64 3.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.444724886421 98.5 2 0.4543160020191822 0.8999999999999999 3 0.0757193336698637 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025239777889954566 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 15 0.375 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.35 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.7000000000000002 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.325 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.475 0.0 0.0 0.0 0.0 110-111 3.825 0.0 0.0 0.0 0.0 112-113 4.325 0.0 0.0 0.0 0.0 114-115 4.7125 0.0 0.0 0.0 0.0 116-117 5.4 0.0 0.0 0.0 0.0 118-119 5.9125 0.0 0.0 0.0 0.0 120-121 6.3 0.0 0.0 0.0 0.0 122-123 6.65 0.0 0.0 0.0 0.0 124-125 7.25 0.0 0.0 0.0 0.0 126-127 7.9 0.0 0.0 0.0 0.0 128-129 8.375 0.0 0.0 0.0 0.0 130-131 8.9875 0.0 0.0 0.0 0.0 132-133 9.775 0.0 0.0 0.0 0.0 134-135 10.45 0.0 0.0 0.0 0.0 136-137 11.1625 0.0 0.0 0.0 0.0 138-139 11.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATACCT 10 0.006830828 145.0 5 >>END_MODULE SRR7170819 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170819_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7745 33.0 33.0 34.0 32.0 34.0 2 32.9125 33.0 33.0 34.0 32.0 34.0 3 32.91425 34.0 33.0 34.0 32.0 34.0 4 32.86775 34.0 33.0 34.0 32.0 34.0 5 32.953 34.0 33.0 34.0 32.0 34.0 6 37.12225 38.0 38.0 38.0 37.0 38.0 7 37.1265 38.0 38.0 38.0 37.0 38.0 8 37.1125 38.0 38.0 38.0 36.0 38.0 9 37.17575 38.0 38.0 38.0 37.0 38.0 10-14 37.049549999999996 38.0 38.0 38.0 36.6 38.0 15-19 37.0484 38.0 38.0 38.0 36.8 38.0 20-24 36.957100000000004 38.0 38.0 38.0 36.2 38.0 25-29 36.931749999999994 38.0 38.0 38.0 36.0 38.0 30-34 36.91545 38.0 38.0 38.0 36.0 38.0 35-39 36.8158 38.0 38.0 38.0 36.0 38.0 40-44 36.896249999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.862399999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.772149999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.732350000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.650400000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.6139 38.0 38.0 38.0 35.0 38.0 70-74 36.58175 38.0 38.0 38.0 35.0 38.0 75-79 36.37995 38.0 38.0 38.0 34.0 38.0 80-84 36.1939 38.0 38.0 38.0 33.8 38.0 85-89 36.05875 38.0 38.0 38.0 33.6 38.0 90-94 35.79785 38.0 37.4 38.0 32.6 38.0 95-99 35.83265 38.0 37.6 38.0 33.0 38.0 100-104 35.639050000000005 38.0 37.0 38.0 31.4 38.0 105-109 35.5864 38.0 37.0 38.0 31.2 38.0 110-114 35.30525 38.0 37.0 38.0 29.8 38.0 115-119 35.049400000000006 38.0 36.4 38.0 28.4 38.0 120-124 34.7992 38.0 36.0 38.0 27.6 38.0 125-129 34.35475 38.0 35.2 38.0 24.0 38.0 130-134 33.80425 38.0 33.6 38.0 22.6 38.0 135-139 33.0658 38.0 33.0 38.0 16.8 38.0 140-144 32.21175 38.0 33.0 38.0 13.0 38.0 145-149 31.227449999999997 38.0 32.2 38.0 5.8 38.0 150-151 25.917125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 6.0 4 4.0 5 1.0 6 0.0 7 5.0 8 2.0 9 4.0 10 4.0 11 2.0 12 1.0 13 1.0 14 3.0 15 7.0 16 1.0 17 3.0 18 4.0 19 9.0 20 26.0 21 9.0 22 10.0 23 19.0 24 19.0 25 17.0 26 18.0 27 41.0 28 45.0 29 43.0 30 62.0 31 61.0 32 91.0 33 111.0 34 201.0 35 268.0 36 716.0 37 2182.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.975 20.25 11.799999999999999 21.975 2 26.91345672836418 23.78689344672336 31.96598299149575 17.333666833416707 3 21.03551775887944 25.48774387193597 34.592296148074034 18.884442221110557 4 24.60615153788447 34.583645911477866 22.980745186296573 17.829457364341085 5 24.48112028007002 38.20955238809702 20.43010752688172 16.879219804951237 6 20.530132533133283 37.08427106776694 23.63090772693173 18.754688672168044 7 20.130032508127034 19.754938734683673 39.83495873968492 20.280070017504375 8 20.830207551887973 24.131032758189548 28.35708927231808 26.6816704176044 9 21.13028257064266 25.131282820705174 29.207301825456366 24.5311327831958 10-14 23.20080020005001 28.882220555138783 26.386596649162293 21.530382595648913 15-19 23.008052818486473 28.01980693242635 28.074826189166206 20.897314059920973 20-24 22.686343171585793 28.324162081040523 27.913956978489246 21.07553776888444 25-29 22.500750525367756 28.55999199439608 28.23976783748624 20.699489642749924 30-34 22.469605243408218 27.803071996797918 28.57357282233452 21.15374993745935 35-39 23.35101591432289 27.825042538284457 27.679911920728657 21.144029626664 40-44 23.025723150835752 28.140326293664298 28.115303773396054 20.718646782103896 45-49 22.77321857485989 28.032425940752603 27.742193755004003 21.452161729383505 50-54 22.934494320172146 27.633488465195416 28.439173297302705 20.992843917329733 55-59 23.52735098343426 27.185826535208445 28.25183924728492 21.034983234072367 60-64 23.23474953710654 27.198118400640542 28.284041435219937 21.283090627032976 65-69 22.624230596006605 27.463343842265925 28.52424560876745 21.388179952960016 70-74 23.074613421408195 28.32407546414452 27.928739428514238 20.672571685933043 75-79 22.929490066556575 27.793624580893763 27.86868838512736 21.408196967422306 80-84 23.61270953214911 28.43632724543407 27.565674255691768 20.385288966725042 85-89 23.767825869402053 27.93094821115837 27.21040780585439 21.09081811358519 90-94 23.110799719747774 28.050245220698628 28.04023621259133 20.798718846962267 95-99 23.341006906215593 27.980182163947553 27.8300470423381 20.84876388749875 100-104 23.596236612951657 27.689920928835953 27.409668701831645 21.30417375638074 105-109 24.335685332532652 27.558424660961816 27.803633088124908 20.302256918380625 110-114 23.843843843843842 28.033033033033032 27.037037037037038 21.086086086086087 115-119 23.792602972824184 28.216805965667387 27.601221160102096 20.389369901406337 120-124 24.447002302071866 27.724952457211486 27.519767791011912 20.308277449704732 125-129 25.075075075075077 28.35835835835836 26.87187187187187 19.694694694694697 130-134 24.842358122310078 28.39555600040036 27.23451105995396 19.5275748173356 135-139 25.13261935742168 27.759983985587027 26.58392553297968 20.52347112401161 140-144 24.987488739865878 28.4205785206686 26.55389850865779 20.038034230807728 145-149 25.711855076815294 27.498373617574938 26.847820647550417 19.94195065805935 150-151 25.40655491618714 27.395546659994995 26.970227670753065 20.2276707530648 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 2.5 22 3.0 23 5.0 24 6.5 25 4.0 26 4.5 27 8.5 28 8.5 29 7.0 30 13.0 31 18.5 32 24.5 33 35.5 34 45.5 35 60.5 36 79.5 37 101.0 38 135.5 39 160.5 40 190.0 41 237.0 42 275.5 43 277.5 44 263.0 45 257.0 46 251.5 47 254.0 48 231.0 49 197.5 50 177.0 51 144.5 52 113.0 53 87.0 54 76.0 55 64.0 56 43.0 57 39.5 58 28.5 59 17.5 60 15.5 61 10.5 62 7.0 63 5.5 64 4.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.05 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.034999999999999996 20-24 0.05 25-29 0.06999999999999999 30-34 0.065 35-39 0.09 40-44 0.09 45-49 0.08 50-54 0.08499999999999999 55-59 0.095 60-64 0.08499999999999999 65-69 0.08499999999999999 70-74 0.08499999999999999 75-79 0.08499999999999999 80-84 0.075 85-89 0.075 90-94 0.09 95-99 0.09 100-104 0.09 105-109 0.08499999999999999 110-114 0.1 115-119 0.095 120-124 0.09 125-129 0.1 130-134 0.09 135-139 0.09 140-144 0.09 145-149 0.08499999999999999 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26545086119553 97.975 2 0.5319148936170213 1.05 3 0.10131712259371835 0.3 4 0.07598784194528875 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025329280648429587 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 15 0.375 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.037500000000000006 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.0875 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.16249999999999998 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.7375 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.75 0.0 0.0 0.0 0.0 100-101 2.0 0.0 0.0 0.0 0.0 102-103 2.3499999999999996 0.0 0.0 0.0 0.0 104-105 2.8125 0.0 0.0 0.0 0.0 106-107 3.1125 0.0 0.0 0.0 0.0 108-109 3.4625000000000004 0.0 0.0 0.0 0.0 110-111 3.8125 0.0 0.0 0.0 0.0 112-113 4.35 0.0 0.0 0.0 0.0 114-115 4.800000000000001 0.0 0.0 0.0 0.0 116-117 5.550000000000001 0.0 0.0 0.0 0.0 118-119 6.0625 0.0 0.0 0.0 0.0 120-121 6.425 0.0 0.0 0.0 0.0 122-123 6.775 0.0 0.0 0.0 0.0 124-125 7.35 0.0 0.0 0.0 0.0 126-127 7.9625 0.0 0.0 0.0 0.0 128-129 8.412500000000001 0.0 0.0 0.0 0.0 130-131 8.9875 0.0 0.0 0.0 0.0 132-133 9.75 0.0 0.0 0.0 0.0 134-135 10.375 0.0 0.0 0.0 0.0 136-137 11.1375 0.0 0.0 0.0 0.0 138-139 11.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGCAAT 10 0.006830828 145.0 9 CCAAGTA 10 0.006830828 145.0 7 AAAAAAA 40 0.0076550315 18.125 70-74 >>END_MODULE Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786642 spots for SRR7170819.sra Written 786642 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra Read 786628 spots for SRR7170819.sra Written 786628 spots for SRR7170819.sra SRR ids: ['SRR7170819.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_884f_jvn SRR7170819.sra spots: 15732574 blocks: [[1, 786628], [786629, 1573256], [1573257, 2359884], [2359885, 3146512], [3146513, 3933140], [3933141, 4719768], [4719769, 5506396], [5506397, 6293024], [6293025, 7079652], [7079653, 7866280], [7866281, 8652908], [8652909, 9439536], [9439537, 10226164], [10226165, 11012792], [11012793, 11799420], [11799421, 12586048], [12586049, 13372676], [13372677, 14159304], [14159305, 14945932], [14945933, 15732574]] SRR7170819 file size 5309552 SRR7170819 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170819 SRR7170819_1.fastq SRR7170819_2.fastq Input file: SRR7170819_1.fastq Paired file: SRR7170819_2.fastq trimmed: SRR7170819-trimmed-pair1.fastq, SRR7170819-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:05:45 2025 >> started Thu Feb 13 18:06:08 2025 >> done (23.120s) 15732574 read pairs processed; of these: 24449 ( 0.16%) short read pairs filtered out after trimming by size control 58750 ( 0.37%) empty read pairs filtered out after trimming by size control 15649375 (99.47%) read pairs available; of these: 11035208 (70.52%) trimmed read pairs available after processing 4614167 (29.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 18 0.00% 20 23 0.00% 21 18 0.00% 22 24 0.00% 23 22 0.00% 24 25 0.00% 25 19 0.00% 26 25 0.00% 27 35 0.00% 28 26 0.00% 29 35 0.00% 30 37 0.00% 31 39 0.00% 32 30 0.00% 33 35 0.00% 34 43 0.00% 35 50 0.00% 36 68 0.00% 37 60 0.00% 38 59 0.00% 39 95 0.00% 40 99 0.00% 41 92 0.00% 42 117 0.00% 43 143 0.00% 44 125 0.00% 45 160 0.00% 46 161 0.00% 47 240 0.00% 48 268 0.00% 49 287 0.00% 50 324 0.00% 51 414 0.00% 52 395 0.00% 53 423 0.00% 54 494 0.00% 55 493 0.00% 56 558 0.00% 57 666 0.00% 58 729 0.00% 59 772 0.00% 60 1015 0.01% 61 1115 0.01% 62 1250 0.01% 63 1312 0.01% 64 1409 0.01% 65 1540 0.01% 66 1694 0.01% 67 1862 0.01% 68 2101 0.01% 69 2358 0.02% 70 2642 0.02% 71 3054 0.02% 72 3811 0.02% 73 4101 0.03% 74 4536 0.03% 75 5161 0.03% 76 7393 0.05% 77 7289 0.05% 78 6168 0.04% 79 6584 0.04% 80 7126 0.05% 81 8326 0.05% 82 9389 0.06% 83 10693 0.07% 84 12925 0.08% 85 12622 0.08% 86 13273 0.08% 87 13966 0.09% 88 14604 0.09% 89 15433 0.10% 90 16270 0.10% 91 17678 0.11% 92 18982 0.12% 93 20552 0.13% 94 21994 0.14% 95 22872 0.15% 96 23518 0.15% 97 24397 0.16% 98 24737 0.16% 99 26191 0.17% 100 27175 0.17% 101 28650 0.18% 102 30700 0.20% 103 32873 0.21% 104 34435 0.22% 105 35842 0.23% 106 36689 0.23% 107 37429 0.24% 108 38297 0.24% 109 39143 0.25% 110 40252 0.26% 111 42530 0.27% 112 44413 0.28% 113 46408 0.30% 114 48665 0.31% 115 50400 0.32% 116 52175 0.33% 117 53048 0.34% 118 54190 0.35% 119 55452 0.35% 120 56953 0.36% 121 59240 0.38% 122 61789 0.39% 123 64696 0.41% 124 67831 0.43% 125 70529 0.45% 126 73457 0.47% 127 75861 0.48% 128 78792 0.50% 129 81740 0.52% 130 84295 0.54% 131 87694 0.56% 132 93324 0.60% 133 99388 0.64% 134 105404 0.67% 135 112945 0.72% 136 119084 0.76% 137 127681 0.82% 138 135452 0.87% 139 146219 0.93% 140 155964 1.00% 141 171446 1.10% 142 190830 1.22% 143 215722 1.38% 144 249115 1.59% 145 294305 1.88% 146 361976 2.31% 147 477906 3.05% 148 703915 4.50% 149 1271785 8.13% 150 3901402 24.93% 151 4614167 29.48% 15649375 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=20 prefix-density=0.51 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=31.36 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.82 fanout-score-rank=24 prefix-density=0.92 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=51.17 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.1 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGATTGCAAAAGCGTGAAGTGAAGAATCGAAGCAGATTATGAAGTATGATAATAAGCTAGTGCTAGAATAAAAGGGGTGCTCGAGCATGTTTGAGCTAGTT SRR7170819 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:06:58 Started mapping on | Feb 13 18:07:00 Finished on | Feb 13 18:08:33 Mapping speed, Million of reads per hour | 605.78 Number of input reads | 15649375 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 14744410 Uniquely mapped reads % | 94.22% Average mapped length | 286.31 Number of splices: Total | 13275006 Number of splices: Annotated (sjdb) | 12957349 Number of splices: GT/AG | 13021587 Number of splices: GC/AG | 200147 Number of splices: AT/AC | 9579 Number of splices: Non-canonical | 43693 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 440774 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 37348 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 487213 487213 487213 N_multimapping 440774 440774 440774 N_noFeature 537281 14485970 668912 N_ambiguous 239572 1347 111855 UnstrandedReadsAssigned:13967557 PositiveStrandReadsAssigned:257093 NegativeStrandReadsAssigned:13963643 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7170819 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170819-trimmed-pair1.fastq SRR7170819-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,649,375 reads, 14,014,373 reads pseudoaligned [quant] estimated average fragment length: 230.826 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7170819.ke.tsv 34699 SRR7170819.se.tsv 87100 total ==> SRR7170819.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.17 727 28.7731 Potri.005G024800.1.v4.1 1035 805.174 253 22.2379 Potri.004G059700.1.v4.1 961 731.232 4 0.387139 Potri.007G009000.2.v4.1 1416 1186.17 0 0 Potri.003G141000.2.v4.1 2943 2713.17 533.681 13.9209 Potri.016G087400.1.v4.1 270 94.0997 751 564.825 Potri.015G069301.1.v4.1 564 341.158 0 0 Potri.010G195200.1.v4.1 1773 1543.17 115.948 5.31753 Potri.012G127500.1.v4.1 977 747.206 364 34.4765 ==> SRR7170819.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 330 Potri.001G212900.v4.1 121 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 38 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR7170819 completed mapping pipeline successfully