Starting /dee2/code/volunteer_pipeline.sh SRR7170820 current disk space = 3088638500864 free memory = 1453936052 SRR7170820 SRAfilesize 4d7a4e85a48b02fca993f7edc481be04 SRR7170820.sra SRR7170820.sra file validated SRR7170820 is paired end SRR7170820 is conventional basespace SRR7170820 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170820_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05025 34.0 33.0 34.0 33.0 34.0 2 33.36925 34.0 33.0 34.0 33.0 34.0 3 33.3355 34.0 33.0 34.0 33.0 34.0 4 33.323 34.0 33.0 34.0 33.0 34.0 5 33.38675 34.0 33.0 34.0 33.0 34.0 6 36.90475 38.0 37.0 38.0 35.0 38.0 7 37.247 38.0 38.0 38.0 36.0 38.0 8 37.39275 38.0 38.0 38.0 37.0 38.0 9 37.45175 38.0 38.0 38.0 37.0 38.0 10-14 37.479400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.438 38.0 38.0 38.0 37.0 38.0 20-24 37.3757 38.0 38.0 38.0 37.0 38.0 25-29 37.353899999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.31320000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.3147 38.0 38.0 38.0 36.8 38.0 40-44 37.1782 38.0 38.0 38.0 36.0 38.0 45-49 37.08115 38.0 38.0 38.0 36.0 38.0 50-54 36.909949999999995 38.0 38.0 38.0 35.4 38.0 55-59 36.8924 38.0 38.0 38.0 35.4 38.0 60-64 36.92555 38.0 38.0 38.0 36.0 38.0 65-69 36.80435 38.0 38.0 38.0 35.2 38.0 70-74 36.73285 38.0 38.0 38.0 35.0 38.0 75-79 36.648450000000004 38.0 38.0 38.0 34.2 38.0 80-84 36.46965 38.0 38.0 38.0 34.0 38.0 85-89 36.341100000000004 38.0 37.6 38.0 34.0 38.0 90-94 36.27595 38.0 37.2 38.0 34.0 38.0 95-99 36.07575 38.0 37.0 38.0 33.2 38.0 100-104 35.9075 38.0 37.0 38.0 32.0 38.0 105-109 35.661 38.0 36.6 38.0 30.6 38.0 110-114 35.412400000000005 38.0 36.0 38.0 29.4 38.0 115-119 35.1185 38.0 35.8 38.0 28.6 38.0 120-124 34.665499999999994 38.0 34.4 38.0 26.4 38.0 125-129 34.32835 38.0 34.0 38.0 25.2 38.0 130-134 33.69295 38.0 33.0 38.0 22.0 38.0 135-139 33.01825 38.0 33.0 38.0 18.4 38.0 140-144 32.1365 37.8 31.8 38.0 13.2 38.0 145-149 31.11295 37.6 30.4 38.0 8.4 38.0 150-151 24.697375 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 2.0 13 0.0 14 0.0 15 2.0 16 3.0 17 2.0 18 1.0 19 6.0 20 5.0 21 7.0 22 7.0 23 13.0 24 18.0 25 24.0 26 17.0 27 26.0 28 37.0 29 46.0 30 56.0 31 81.0 32 115.0 33 130.0 34 260.0 35 426.0 36 962.0 37 1752.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.75662711436506 17.21787427417319 5.099722292350417 53.92577631911134 2 13.65 17.7 54.525 14.124999999999998 3 11.975 23.375 35.475 29.175 4 19.175 30.7 27.200000000000003 22.925 5 20.8 36.025 26.025 17.150000000000002 6 15.299999999999999 35.4 28.749999999999996 20.549999999999997 7 13.975000000000001 22.675 43.925 19.425 8 15.425 22.125 35.525 26.924999999999997 9 15.525 19.575 38.45 26.450000000000003 10-14 19.265 28.415000000000003 28.23 24.09 15-19 18.970000000000002 27.685 29.160000000000004 24.185000000000002 20-24 19.225 28.425 28.854999999999997 23.494999999999997 25-29 19.415 28.315 28.53 23.74 30-34 18.945 28.455000000000002 29.14 23.46 35-39 19.855 28.65 28.205000000000002 23.29 40-44 19.08 28.93 28.470000000000002 23.52 45-49 19.975 28.384999999999998 28.405 23.235 50-54 19.56 28.139999999999997 28.444999999999997 23.855 55-59 19.2 28.64 28.21 23.95 60-64 19.695 28.000000000000004 28.999999999999996 23.305 65-69 20.215 28.63 27.96 23.195 70-74 20.369999999999997 28.77 27.875 22.985 75-79 20.145 28.775000000000002 28.34 22.74 80-84 20.125 28.515 27.98 23.380000000000003 85-89 19.97 28.994999999999997 28.055000000000003 22.98 90-94 20.435 29.09 27.889999999999997 22.585 95-99 20.465 28.875 27.925 22.735 100-104 20.225 29.349999999999998 27.85 22.575 105-109 20.595 28.705000000000002 27.375 23.325000000000003 110-114 20.169999999999998 29.005 28.134999999999998 22.689999999999998 115-119 20.919999999999998 28.560000000000002 27.36 23.16 120-124 20.605 28.705000000000002 26.96 23.73 125-129 20.865000000000002 28.88 27.76 22.495 130-134 20.896044802240112 29.24146207310366 27.076353817690883 22.786139306965346 135-139 21.060000000000002 28.999999999999996 27.145000000000003 22.795 140-144 21.246062303115156 28.8114405720286 26.73133656682834 23.211160558027903 145-149 20.585 29.73 26.765 22.919999999999998 150-151 21.7 29.7125 25.924999999999997 22.662499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 1.5 22 2.5 23 3.5 24 7.5 25 9.0 26 9.5 27 12.0 28 15.0 29 19.5 30 23.5 31 35.5 32 47.0 33 56.0 34 72.5 35 91.5 36 108.5 37 125.0 38 153.0 39 184.0 40 210.0 41 232.5 42 259.5 43 255.0 44 242.0 45 262.0 46 256.5 47 235.0 48 223.0 49 196.5 50 156.0 51 110.5 52 85.5 53 81.0 54 60.0 55 44.0 56 37.0 57 25.0 58 15.5 59 10.5 60 8.0 61 4.0 62 1.5 63 2.0 64 1.0 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31869795609387 98.4 2 0.58036840777189 1.15 3 0.0 0.0 4 0.05046681806712087 0.2 5 0.05046681806712087 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.0625 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.825 0.0 0.0 0.0 0.0 96-97 2.1375 0.0 0.0 0.0 0.0 98-99 2.35 0.0 0.0 0.0 0.0 100-101 2.6625 0.0 0.0 0.0 0.0 102-103 2.925 0.0 0.0 0.0 0.0 104-105 3.4124999999999996 0.0 0.0 0.0 0.0 106-107 3.875 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 4.45 0.0 0.0 0.0 0.0 112-113 4.775 0.0 0.0 0.0 0.0 114-115 5.275 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.3125 0.0 0.0 0.0 0.0 120-121 6.75 0.0 0.0 0.0 0.0 122-123 7.3125 0.0 0.0 0.0 0.0 124-125 7.949999999999999 0.0 0.0 0.0 0.0 126-127 8.7375 0.0 0.0 0.0 0.0 128-129 9.4125 0.0 0.0 0.0 0.0 130-131 10.087499999999999 0.0 0.0 0.0 0.0 132-133 10.675 0.0 0.0 0.0 0.0 134-135 11.5 0.0 0.0 0.0 0.0 136-137 12.25 0.0 0.0 0.0 0.0 138-139 12.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTCAG 10 0.006830828 145.0 5 AAAAAAA 40 0.0076550315 18.125 20-24 >>END_MODULE SRR7170820 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170820_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93525 33.0 33.0 34.0 32.0 34.0 2 33.0865 34.0 33.0 34.0 32.0 34.0 3 33.15 34.0 33.0 34.0 33.0 34.0 4 33.18225 34.0 33.0 34.0 33.0 34.0 5 33.2395 34.0 33.0 34.0 33.0 34.0 6 37.414 38.0 38.0 38.0 38.0 38.0 7 37.47625 38.0 38.0 38.0 38.0 38.0 8 37.468 38.0 38.0 38.0 37.0 38.0 9 37.41925 38.0 38.0 38.0 38.0 38.0 10-14 37.4305 38.0 38.0 38.0 37.2 38.0 15-19 37.43615 38.0 38.0 38.0 37.4 38.0 20-24 37.372949999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.336 38.0 38.0 38.0 37.0 38.0 30-34 37.2427 38.0 38.0 38.0 37.0 38.0 35-39 37.225899999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.256750000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.185199999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.17524999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.164550000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.08014999999999 38.0 38.0 38.0 36.2 38.0 65-69 37.079100000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.005500000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.8656 38.0 38.0 38.0 35.6 38.0 80-84 36.75465 38.0 38.0 38.0 35.4 38.0 85-89 36.664750000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.408249999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.425850000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.19605 38.0 37.8 38.0 33.6 38.0 105-109 36.094 38.0 38.0 38.0 33.6 38.0 110-114 35.8373 38.0 37.2 38.0 32.6 38.0 115-119 35.6605 38.0 37.0 38.0 31.8 38.0 120-124 35.45485000000001 38.0 36.6 38.0 30.6 38.0 125-129 35.037549999999996 38.0 36.0 38.0 29.0 38.0 130-134 34.63375 38.0 35.4 38.0 26.8 38.0 135-139 33.941500000000005 38.0 33.2 38.0 23.6 38.0 140-144 33.212900000000005 38.0 33.0 38.0 20.0 38.0 145-149 32.369299999999996 38.0 33.0 38.0 11.0 38.0 150-151 27.26925 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 3.0 14 0.0 15 1.0 16 0.0 17 6.0 18 8.0 19 4.0 20 8.0 21 5.0 22 11.0 23 11.0 24 7.0 25 22.0 26 17.0 27 35.0 28 25.0 29 32.0 30 42.0 31 50.0 32 79.0 33 115.0 34 157.0 35 269.0 36 709.0 37 2375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.575 20.25 7.324999999999999 44.85 2 19.198998748435546 24.28035043804756 44.25531914893617 12.265331664580724 3 12.966207759699625 26.883604505632043 36.57071339173967 23.57947434292866 4 19.64956195244055 35.36921151439299 25.256570713391742 19.72465581977472 5 22.828535669586984 39.04881101376721 22.60325406758448 15.519399249061328 6 16.90422605651413 39.85996499124781 24.781195298824706 18.454613653413354 7 17.179294823705927 18.704676169042262 42.685671417854465 21.43035758939735 8 16.062046534901175 22.992244183137352 33.500125093820365 27.445584188141105 9 19.05476369092273 22.655663915978995 34.18354588647162 24.10602650662666 10-14 21.903141885131078 28.512107264358615 27.656593956373825 21.92815689413648 15-19 22.19886903868288 27.90371816043637 29.019666716709203 20.877746084171545 20-24 21.121401752190238 28.715894868585735 29.241551939924904 20.921151439299123 25-29 21.633123059977972 28.602182837688993 28.55712426154 21.20756984079303 30-34 22.147684605757195 28.075093867334168 28.79599499374218 20.98122653316646 35-39 21.86279419128693 28.327491236855284 28.277416124186278 21.532298447671508 40-44 22.05587822952133 28.049268976567195 29.15581814540357 20.73903464850791 45-49 22.018027040560842 28.002003004506758 28.472709063595392 21.507260891337005 50-54 22.05978070395033 28.258148500475645 28.73879737645822 20.94327341911581 55-59 21.802704056084128 28.69804707060591 28.718077115673513 20.781171757636454 60-64 22.410253842687627 27.66735092374706 28.753817653832677 21.168577579732638 65-69 22.20720044063893 27.289569876320662 28.861849682038958 21.641380001001455 70-74 22.397476340694006 28.461268839817738 28.536377747734214 20.604877071754043 75-79 22.60164229921891 28.48988584017625 27.994191868616063 20.914279991988785 80-84 22.544307599879843 28.416942024632018 28.341844397717033 20.696905977771102 85-89 23.00375469336671 29.051314142678347 27.41927409261577 20.52565707133917 90-94 22.992189064690567 28.124374123773283 28.454836771480075 20.42860004005608 95-99 23.43515272909364 28.147220831246873 27.811717576364547 20.605908863294943 100-104 23.263732411997395 28.66656652145611 27.700165239597418 20.369535826949075 105-109 23.04842020930349 28.936958589955434 27.670121676430824 20.34449952431025 110-114 23.747996794871796 28.260216346153843 28.190104166666668 19.801682692307693 115-119 23.994792449051126 28.496319663512093 27.334635221070553 20.17425266636623 120-124 23.44516775162744 28.652979469203803 27.681522283425135 20.220330495743617 125-129 24.541812719078617 28.948422633950926 26.91537305958938 19.59439158738107 130-134 25.356767312603274 28.4662761003455 26.678684091933302 19.49827249511792 135-139 25.1514696309649 28.095738821290873 27.880426618596964 18.872364929147263 140-144 25.522006910019527 27.584998247458813 27.19943918682089 19.693555655700766 145-149 25.884944675311672 28.253141741350824 26.861262704651278 19.000650878686226 150-151 25.481852315394242 27.80976220275344 28.397997496871092 18.310387984981226 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 1.0 5 1.0 6 1.0 7 0.5 8 0.5 9 1.0 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 2.0 23 4.5 24 4.5 25 4.0 26 3.5 27 6.5 28 11.0 29 16.0 30 26.5 31 33.0 32 35.5 33 46.0 34 66.5 35 84.5 36 102.5 37 122.0 38 150.0 39 173.5 40 211.5 41 255.0 42 292.5 43 290.5 44 272.5 45 280.0 46 253.5 47 220.5 48 199.0 49 178.5 50 154.0 51 122.0 52 92.0 53 71.5 54 58.0 55 44.0 56 26.5 57 18.5 58 14.5 59 11.0 60 9.0 61 7.0 62 6.0 63 3.5 64 1.0 65 0.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.125 5 0.125 6 0.025 7 0.025 8 0.075 9 0.025 10-14 0.06 15-19 0.08499999999999999 20-24 0.125 25-29 0.13 30-34 0.125 35-39 0.15 40-44 0.13999999999999999 45-49 0.15 50-54 0.135 55-59 0.15 60-64 0.135 65-69 0.145 70-74 0.145 75-79 0.13999999999999999 80-84 0.13 85-89 0.125 90-94 0.13999999999999999 95-99 0.15 100-104 0.145 105-109 0.145 110-114 0.16 115-119 0.145 120-124 0.15 125-129 0.15 130-134 0.145 135-139 0.145 140-144 0.145 145-149 0.135 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13836796756209 97.8 2 0.6335529650278764 1.25 3 0.10136847440446022 0.3 4 0.05068423720223011 0.2 5 0.025342118601115054 0.125 6 0.025342118601115054 0.15 7 0.025342118601115054 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.0625 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.5249999999999999 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.05 0.0 0.0 0.0 0.0 90-91 1.275 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.0875 0.0 0.0 0.0 0.0 98-99 2.3 0.0 0.0 0.0 0.0 100-101 2.6125 0.0 0.0 0.0 0.0 102-103 2.875 0.0 0.0 0.0 0.0 104-105 3.3875 0.0 0.0 0.0 0.0 106-107 3.875 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 4.475 0.0 0.0 0.0 0.0 112-113 4.800000000000001 0.0 0.0 0.0 0.0 114-115 5.3 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.35 0.0 0.0 0.0 0.0 120-121 6.800000000000001 0.0 0.0 0.0 0.0 122-123 7.3625 0.0 0.0 0.0 0.0 124-125 8.0 0.0 0.0 0.0 0.0 126-127 8.825 0.0 0.0 0.0 0.0 128-129 9.4875 0.0 0.0 0.0 0.0 130-131 10.15 0.0 0.0 0.0 0.0 132-133 10.725000000000001 0.0 0.0 0.0 0.0 134-135 11.5125 0.0 0.0 0.0 0.0 136-137 12.3 0.0 0.0 0.0 0.0 138-139 13.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGATT 10 0.006830828 145.0 2 CGCCGTA 10 0.006830828 145.0 145 >>END_MODULE Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 789996 spots for SRR7170820.sra Written 789996 spots for SRR7170820.sra Read 790015 spots for SRR7170820.sra Written 790015 spots for SRR7170820.sra SRR ids: ['SRR7170820.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x8nwxdwb SRR7170820.sra spots: 15799939 blocks: [[1, 789996], [789997, 1579992], [1579993, 2369988], [2369989, 3159984], [3159985, 3949980], [3949981, 4739976], [4739977, 5529972], [5529973, 6319968], [6319969, 7109964], [7109965, 7899960], [7899961, 8689956], [8689957, 9479952], [9479953, 10269948], [10269949, 11059944], [11059945, 11849940], [11849941, 12639936], [12639937, 13429932], [13429933, 14219928], [14219929, 15009924], [15009925, 15799939]] SRR7170820 file size 5332380 SRR7170820 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170820 SRR7170820_1.fastq SRR7170820_2.fastq Input file: SRR7170820_1.fastq Paired file: SRR7170820_2.fastq trimmed: SRR7170820-trimmed-pair1.fastq, SRR7170820-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:29:03 2025 >> started Thu Feb 13 17:29:19 2025 >> done (16.626s) 15799939 read pairs processed; of these: 12221 ( 0.08%) short read pairs filtered out after trimming by size control 44182 ( 0.28%) empty read pairs filtered out after trimming by size control 15743536 (99.64%) read pairs available; of these: 11090676 (70.45%) trimmed read pairs available after processing 4652860 (29.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 40 0.00% 19 41 0.00% 20 52 0.00% 21 54 0.00% 22 64 0.00% 23 52 0.00% 24 49 0.00% 25 61 0.00% 26 69 0.00% 27 57 0.00% 28 59 0.00% 29 75 0.00% 30 68 0.00% 31 83 0.00% 32 84 0.00% 33 68 0.00% 34 80 0.00% 35 72 0.00% 36 101 0.00% 37 97 0.00% 38 104 0.00% 39 128 0.00% 40 135 0.00% 41 151 0.00% 42 159 0.00% 43 178 0.00% 44 171 0.00% 45 203 0.00% 46 192 0.00% 47 261 0.00% 48 330 0.00% 49 313 0.00% 50 386 0.00% 51 450 0.00% 52 496 0.00% 53 510 0.00% 54 553 0.00% 55 543 0.00% 56 678 0.00% 57 777 0.00% 58 842 0.01% 59 1034 0.01% 60 1081 0.01% 61 1249 0.01% 62 1480 0.01% 63 1513 0.01% 64 1749 0.01% 65 1835 0.01% 66 1899 0.01% 67 2254 0.01% 68 2522 0.02% 69 2705 0.02% 70 3037 0.02% 71 3520 0.02% 72 4104 0.03% 73 4512 0.03% 74 4952 0.03% 75 5380 0.03% 76 6457 0.04% 77 6920 0.04% 78 6806 0.04% 79 7464 0.05% 80 8232 0.05% 81 9143 0.06% 82 10541 0.07% 83 11805 0.07% 84 14123 0.09% 85 13846 0.09% 86 14470 0.09% 87 15262 0.10% 88 16280 0.10% 89 16716 0.11% 90 18263 0.12% 91 19525 0.12% 92 21206 0.13% 93 23237 0.15% 94 23836 0.15% 95 25579 0.16% 96 26696 0.17% 97 27426 0.17% 98 28630 0.18% 99 29237 0.19% 100 31301 0.20% 101 32214 0.20% 102 34554 0.22% 103 35979 0.23% 104 37620 0.24% 105 39531 0.25% 106 40287 0.26% 107 41607 0.26% 108 42757 0.27% 109 43137 0.27% 110 44707 0.28% 111 47158 0.30% 112 48820 0.31% 113 51068 0.32% 114 52483 0.33% 115 54976 0.35% 116 56222 0.36% 117 56924 0.36% 118 59069 0.38% 119 59315 0.38% 120 61558 0.39% 121 63147 0.40% 122 64992 0.41% 123 68378 0.43% 124 71018 0.45% 125 73838 0.47% 126 76405 0.49% 127 78677 0.50% 128 81200 0.52% 129 83414 0.53% 130 87674 0.56% 131 90816 0.58% 132 96140 0.61% 133 101410 0.64% 134 108581 0.69% 135 114088 0.72% 136 120373 0.76% 137 127509 0.81% 138 136783 0.87% 139 146060 0.93% 140 155662 0.99% 141 170315 1.08% 142 189052 1.20% 143 210244 1.34% 144 243245 1.55% 145 283886 1.80% 146 350100 2.22% 147 456876 2.90% 148 672676 4.27% 149 1222082 7.76% 150 3919336 24.89% 151 4652860 29.55% 15743536 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=35.79 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.2 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=64.61 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=14.1 sequence=CTCTCTCTTTCAAACCCTA SRR7170820 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:30:19 Started mapping on | Feb 13 17:30:19 Finished on | Feb 13 17:31:43 Mapping speed, Million of reads per hour | 674.72 Number of input reads | 15743536 Average input read length | 277 UNIQUE READS: Uniquely mapped reads number | 13003606 Uniquely mapped reads % | 82.60% Average mapped length | 279.73 Number of splices: Total | 12532492 Number of splices: Annotated (sjdb) | 12190823 Number of splices: GT/AG | 12297620 Number of splices: GC/AG | 175126 Number of splices: AT/AC | 7932 Number of splices: Non-canonical | 51814 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424995 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 33396 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.44% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2332576 2332576 2332576 N_multimapping 424995 424995 424995 N_noFeature 608696 12746089 737353 N_ambiguous 348468 4319 215964 UnstrandedReadsAssigned:12046442 PositiveStrandReadsAssigned:253198 NegativeStrandReadsAssigned:12050289 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7170820 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170820-trimmed-pair1.fastq SRR7170820-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,743,536 reads, 13,892,468 reads pseudoaligned [quant] estimated average fragment length: 219.459 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52401 SRR7170820.ke.tsv 34699 SRR7170820.se.tsv 87100 total ==> SRR7170820.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.54 1366 53.2377 Potri.005G024800.1.v4.1 1035 816.541 273 23.4485 Potri.004G059700.1.v4.1 961 742.59 8 0.755564 Potri.007G009000.2.v4.1 1416 1197.54 0 0 Potri.003G141000.2.v4.1 2943 2724.54 882 22.7042 Potri.016G087400.1.v4.1 270 100.548 1396 973.74 Potri.015G069301.1.v4.1 564 352.601 0 0 Potri.010G195200.1.v4.1 1773 1554.54 508 22.9188 Potri.012G127500.1.v4.1 977 758.571 66 6.10209 ==> SRR7170820.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 473 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 93 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7170820 completed mapping pipeline successfully