Starting /dee2/code/volunteer_pipeline.sh SRR7170821 current disk space = 3088670035968 free memory = 1568396104 SRR7170821 SRAfilesize acf93e9fdcd71442d53e07eabb0de039 SRR7170821.sra SRR7170821.sra file validated SRR7170821 is paired end SRR7170821 is conventional basespace SRR7170821 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170821_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.806 34.0 33.0 34.0 33.0 34.0 2 33.3165 34.0 33.0 34.0 33.0 34.0 3 33.3155 34.0 33.0 34.0 33.0 34.0 4 33.373 34.0 33.0 34.0 33.0 34.0 5 33.28575 34.0 33.0 34.0 33.0 34.0 6 36.87475 38.0 37.0 38.0 35.0 38.0 7 37.2645 38.0 38.0 38.0 36.0 38.0 8 37.459 38.0 38.0 38.0 37.0 38.0 9 37.48875 38.0 38.0 38.0 37.0 38.0 10-14 37.49499999999999 38.0 38.0 38.0 37.6 38.0 15-19 37.4333 38.0 38.0 38.0 37.0 38.0 20-24 37.37995 38.0 38.0 38.0 37.0 38.0 25-29 37.311249999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.313550000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.32745 38.0 38.0 38.0 37.0 38.0 40-44 37.2318 38.0 38.0 38.0 36.6 38.0 45-49 37.1529 38.0 38.0 38.0 36.2 38.0 50-54 37.03675 38.0 38.0 38.0 36.0 38.0 55-59 37.00664999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.93065 38.0 38.0 38.0 35.8 38.0 65-69 36.97845 38.0 38.0 38.0 35.8 38.0 70-74 36.88835 38.0 38.0 38.0 35.4 38.0 75-79 36.57905 38.0 38.0 38.0 34.6 38.0 80-84 36.52645 38.0 38.0 38.0 34.6 38.0 85-89 36.4875 38.0 38.0 38.0 34.2 38.0 90-94 36.4494 38.0 38.0 38.0 34.0 38.0 95-99 36.37005 38.0 38.0 38.0 34.0 38.0 100-104 36.10505 38.0 37.2 38.0 33.6 38.0 105-109 35.8928 38.0 37.0 38.0 32.6 38.0 110-114 35.73245 38.0 37.0 38.0 32.2 38.0 115-119 35.55425000000001 38.0 36.4 38.0 31.0 38.0 120-124 35.20875 38.0 36.0 38.0 28.8 38.0 125-129 35.14125 38.0 35.8 38.0 29.2 38.0 130-134 34.51195 38.0 34.8 38.0 25.8 38.0 135-139 34.377300000000005 38.0 34.0 38.0 25.8 38.0 140-144 33.79064999999999 38.0 33.2 38.0 23.0 38.0 145-149 33.04995000000001 38.0 33.0 38.0 19.4 38.0 150-151 28.261375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 2.0 16 2.0 17 2.0 18 1.0 19 15.0 20 4.0 21 1.0 22 12.0 23 3.0 24 9.0 25 22.0 26 15.0 27 22.0 28 41.0 29 41.0 30 43.0 31 56.0 32 76.0 33 119.0 34 186.0 35 291.0 36 754.0 37 2277.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.61436576668365 14.00916963830871 8.6856851757514 38.69077941925624 2 21.925 15.775 36.75 25.55 3 17.974999999999998 22.675 28.15 31.2 4 22.925 30.9 22.475 23.7 5 22.900000000000002 35.4 23.799999999999997 17.9 6 19.650000000000002 34.525 24.4 21.425 7 15.4 23.9 40.975 19.725 8 18.375 22.975 29.975 28.675 9 18.45 22.425 32.45 26.674999999999997 10-14 20.395 28.544999999999998 26.41 24.65 15-19 20.775 27.54 27.029999999999998 24.654999999999998 20-24 20.405 28.060000000000002 26.87 24.665 25-29 20.68 28.025 26.810000000000002 24.485 30-34 20.830000000000002 27.97 27.33 23.87 35-39 20.715 28.04 26.525 24.72 40-44 21.095 27.82 26.905 24.18 45-49 20.605 27.779999999999998 26.534999999999997 25.080000000000002 50-54 20.915 27.68 26.919999999999998 24.485 55-59 20.9 27.965 27.075 24.060000000000002 60-64 20.685000000000002 27.725 27.089999999999996 24.5 65-69 21.335 27.48 26.83 24.355 70-74 20.925 27.794999999999998 26.685 24.595 75-79 20.895 28.01 27.11 23.985 80-84 20.915 27.650000000000002 26.83 24.605 85-89 21.14 27.83 26.834999999999997 24.195 90-94 21.23 27.589999999999996 26.645000000000003 24.535 95-99 21.295 27.334999999999997 27.0 24.37 100-104 21.58 28.17 26.465 23.785 105-109 21.785 28.415000000000003 26.21 23.59 110-114 21.759999999999998 27.965 26.605 23.669999999999998 115-119 21.82 27.950000000000003 26.075 24.154999999999998 120-124 21.945 27.195000000000004 26.51 24.349999999999998 125-129 21.57 27.215 26.355 24.86 130-134 21.67 27.47 26.169999999999998 24.69 135-139 22.465 27.66 25.765 24.11 140-144 22.2 27.205000000000002 25.825 24.77 145-149 22.185 28.075 25.64 24.099999999999998 150-151 21.45 28.249999999999996 25.5375 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 3.0 24 3.0 25 1.5 26 4.5 27 6.5 28 7.0 29 13.0 30 19.0 31 22.0 32 31.5 33 38.5 34 43.0 35 57.5 36 79.5 37 101.0 38 110.0 39 130.0 40 165.0 41 187.5 42 208.0 43 213.5 44 220.5 45 244.5 46 247.5 47 222.0 48 202.0 49 198.5 50 193.0 51 178.5 52 145.5 53 115.5 54 104.0 55 103.0 56 89.5 57 65.5 58 57.0 59 50.5 60 34.0 61 24.0 62 19.5 63 13.0 64 7.5 65 4.0 66 3.5 67 2.5 68 2.0 69 1.5 70 1.0 71 1.5 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.2051282051282 95.75 2 1.4102564102564104 2.75 3 0.2564102564102564 0.75 4 0.07692307692307693 0.3 5 0.02564102564102564 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02564102564102564 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 13 0.325 TruSeq Adapter, Index 6 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.0 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.7125 0.0 0.0 0.0 0.0 112-113 3.0 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.2125 0.0 0.0 0.0 0.0 120-121 4.7 0.0 0.0 0.0 0.0 122-123 5.175 0.0 0.0 0.0 0.0 124-125 5.675 0.0 0.0 0.0 0.0 126-127 6.1125 0.0 0.0 0.0 0.0 128-129 6.625 0.0 0.0 0.0 0.0 130-131 7.0125 0.0 0.0 0.0 0.0 132-133 7.6 0.0 0.0 0.0 0.0 134-135 8.325 0.0 0.0 0.0 0.0 136-137 8.925 0.0 0.0 0.0 0.0 138-139 9.649999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170821 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170821_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.962 33.0 33.0 34.0 32.0 34.0 2 33.07525 34.0 33.0 34.0 32.0 34.0 3 33.137 34.0 33.0 34.0 33.0 34.0 4 33.0065 34.0 33.0 34.0 32.0 34.0 5 33.03725 34.0 33.0 34.0 32.0 34.0 6 37.09225 38.0 38.0 38.0 37.0 38.0 7 37.19575 38.0 38.0 38.0 37.0 38.0 8 37.206 38.0 38.0 38.0 37.0 38.0 9 37.1955 38.0 38.0 38.0 37.0 38.0 10-14 37.1485 38.0 38.0 38.0 37.0 38.0 15-19 37.1303 38.0 38.0 38.0 37.0 38.0 20-24 37.10915 38.0 38.0 38.0 36.8 38.0 25-29 37.0327 38.0 38.0 38.0 36.4 38.0 30-34 37.06269999999999 38.0 38.0 38.0 36.6 38.0 35-39 37.02505 38.0 38.0 38.0 36.4 38.0 40-44 37.0587 38.0 38.0 38.0 36.6 38.0 45-49 37.08225 38.0 38.0 38.0 36.6 38.0 50-54 37.0381 38.0 38.0 38.0 36.4 38.0 55-59 37.013349999999996 38.0 38.0 38.0 36.2 38.0 60-64 36.8994 38.0 38.0 38.0 36.0 38.0 65-69 36.87625 38.0 38.0 38.0 36.0 38.0 70-74 36.8383 38.0 38.0 38.0 36.0 38.0 75-79 36.67655 38.0 38.0 38.0 35.0 38.0 80-84 36.43515 38.0 38.0 38.0 34.4 38.0 85-89 36.375099999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.3197 38.0 38.0 38.0 34.0 38.0 95-99 36.2402 38.0 38.0 38.0 33.8 38.0 100-104 36.09475 38.0 38.0 38.0 33.6 38.0 105-109 35.951800000000006 38.0 38.0 38.0 33.0 38.0 110-114 35.53675 38.0 37.0 38.0 31.2 38.0 115-119 35.32795 38.0 36.8 38.0 30.6 38.0 120-124 34.9729 38.0 36.2 38.0 28.6 38.0 125-129 34.57635 38.0 35.6 38.0 25.8 38.0 130-134 34.4297 38.0 35.2 38.0 26.0 38.0 135-139 33.601600000000005 38.0 34.0 38.0 21.4 38.0 140-144 33.22895 38.0 33.0 38.0 17.6 38.0 145-149 32.12905000000001 38.0 32.8 38.0 8.6 38.0 150-151 26.89275 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 2.0 6 4.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 3.0 13 1.0 14 0.0 15 5.0 16 6.0 17 5.0 18 6.0 19 8.0 20 19.0 21 13.0 22 10.0 23 18.0 24 14.0 25 18.0 26 31.0 27 22.0 28 35.0 29 36.0 30 48.0 31 51.0 32 86.0 33 101.0 34 151.0 35 269.0 36 634.0 37 2397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.975 20.974999999999998 11.55 26.5 2 27.3 24.05 32.550000000000004 16.1 3 21.45 27.200000000000003 31.0 20.349999999999998 4 23.5 34.075 23.45 18.975 5 26.075 35.9 20.599999999999998 17.424999999999997 6 21.9 37.875 21.75 18.475 7 19.925 19.35 39.525 21.2 8 22.375 23.974999999999998 27.275 26.375 9 22.2 24.15 29.4 24.25 10-14 23.576178808940448 27.771388569428474 26.02630131506575 22.626131306565327 15-19 23.43617180859043 27.04135206760338 27.51137556877844 22.011100555027753 20-24 23.609721944388877 27.485497099419888 27.290458091618326 21.614322864572916 25-29 23.50587646911728 27.446861715428856 27.431857964491122 21.615403850962743 30-34 23.435858964741186 27.231807951987996 27.851962990747687 21.48037009252313 35-39 24.2110527631908 27.646911727931982 26.916729182295573 21.225306326581645 40-44 23.365841460365093 26.756689172293076 28.43710927731933 21.440360090022505 45-49 23.400850212553138 27.781945486371594 27.426856714178545 21.390347586896723 50-54 24.121030257564392 26.521630407601897 27.451862965741437 21.905476369092273 55-59 23.68592148037009 26.716679169792446 27.596899224806204 22.00050012503126 60-64 23.850962740685173 25.911477869467365 28.02700675168792 22.210552638159538 65-69 23.620905226306576 26.80170042510628 27.47686921730433 22.10052513128282 70-74 23.373180613214625 26.814385034762168 27.354574100935324 22.45786025108788 75-79 23.53588397099275 27.846961740435113 26.74668667166792 21.870467616904225 80-84 23.71592898224556 27.141785446361588 26.65166291572893 22.490622655663916 85-89 23.61090272568142 27.376844211052763 26.756689172293076 22.255563890972745 90-94 23.950987746936732 26.916729182295573 27.666916729182294 21.465366341585394 95-99 23.709483793517407 27.721088435374146 26.680672268907564 21.88875550220088 100-104 24.454781912765107 27.2108843537415 27.180872348939577 21.15346138455382 105-109 24.93871629396168 27.264995747661214 27.400070038521186 20.39621791985592 110-114 24.308369603281804 27.00485266896793 27.3250287658212 21.36174896192906 115-119 24.95871903927946 27.225419064298222 27.020265198899175 20.79559669752314 120-124 25.343939166541595 27.164940717394565 26.87478112962129 20.616338986442543 125-129 25.24145523695141 27.293199219336433 26.02211880098083 21.443226742731323 130-134 25.34273991794256 27.389172420694486 26.34844391073752 20.91964375062544 135-139 26.220976781425144 27.071657325860688 26.371096877502005 20.336269015212167 140-144 25.961682757240755 27.367315291881344 26.266820069031066 20.40418188184683 145-149 26.699684826654664 28.060433238281057 25.574065736154882 19.6658161989094 150-151 27.107830873154864 27.820865649236925 26.21966474856142 18.851638729046787 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 0.0 23 1.0 24 3.5 25 4.5 26 3.0 27 3.5 28 5.0 29 9.5 30 14.0 31 18.0 32 26.5 33 34.5 34 39.0 35 51.5 36 69.5 37 90.0 38 116.5 39 151.0 40 171.0 41 175.5 42 210.0 43 227.0 44 241.5 45 246.5 46 236.0 47 244.5 48 230.5 49 219.0 50 187.5 51 131.5 52 117.0 53 125.0 54 119.5 55 98.5 56 76.0 57 68.0 58 50.5 59 41.5 60 38.5 61 24.5 62 23.5 63 21.5 64 9.5 65 4.0 66 3.5 67 1.5 68 2.0 69 1.5 70 0.5 71 2.0 72 1.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.02 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.034999999999999996 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.04 100-104 0.04 105-109 0.055 110-114 0.055 115-119 0.075 120-124 0.055 125-129 0.08499999999999999 130-134 0.06999999999999999 135-139 0.08 140-144 0.045 145-149 0.055 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.675 #Duplication Level Percentage of deduplicated Percentage of total 1 97.98293250581847 94.72500000000001 2 1.5774502198086373 3.05 3 0.2068787173519524 0.6 4 0.02585983966899405 0.1 5 0.07757951900698215 0.375 6 0.02585983966899405 0.15 7 0.0517196793379881 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0517196793379881 0.65 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 14 0.35000000000000003 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 12 0.3 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit CTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGGAA 6 0.15 No Hit GGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAG 5 0.125 No Hit GTAAGCTCCCAAGCAGTGGGAGGAGCCCGGGGCTCTGACCGCGTGCCTGT 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.825 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.775 0.0 0.0 0.0 0.0 112-113 3.075 0.0 0.0 0.0 0.0 114-115 3.275 0.0 0.0 0.0 0.0 116-117 3.8375000000000004 0.0 0.0 0.0 0.0 118-119 4.3125 0.0 0.0 0.0 0.0 120-121 4.7875 0.0 0.0 0.0 0.0 122-123 5.25 0.0 0.0 0.0 0.0 124-125 5.7125 0.0 0.0 0.0 0.0 126-127 6.1375 0.0 0.0 0.0 0.0 128-129 6.6625 0.0 0.0 0.0 0.0 130-131 7.0625 0.0 0.0 0.0 0.0 132-133 7.675 0.0 0.0 0.0 0.0 134-135 8.375 0.0 0.0 0.0 0.0 136-137 9.0 0.0 0.0 0.0 0.0 138-139 9.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGGG 10 0.006830828 145.0 4 GGGAGGA 10 0.006830828 145.0 1 >>END_MODULE Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684581 spots for SRR7170821.sra Written 684581 spots for SRR7170821.sra Read 684585 spots for SRR7170821.sra Written 684585 spots for SRR7170821.sra SRR ids: ['SRR7170821.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6v3ka0ix SRR7170821.sra spots: 13691624 blocks: [[1, 684581], [684582, 1369162], [1369163, 2053743], [2053744, 2738324], [2738325, 3422905], [3422906, 4107486], [4107487, 4792067], [4792068, 5476648], [5476649, 6161229], [6161230, 6845810], [6845811, 7530391], [7530392, 8214972], [8214973, 8899553], [8899554, 9584134], [9584135, 10268715], [10268716, 10953296], [10953297, 11637877], [11637878, 12322458], [12322459, 13007039], [13007040, 13691624]] SRR7170821 file size 4617941 SRR7170821 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170821 SRR7170821_1.fastq SRR7170821_2.fastq Input file: SRR7170821_1.fastq Paired file: SRR7170821_2.fastq trimmed: SRR7170821-trimmed-pair1.fastq, SRR7170821-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:21:23 2025 >> started Thu Feb 13 17:21:38 2025 >> done (15.074s) 13691624 read pairs processed; of these: 13918 ( 0.10%) short read pairs filtered out after trimming by size control 52489 ( 0.38%) empty read pairs filtered out after trimming by size control 13625217 (99.51%) read pairs available; of these: 8649459 (63.48%) trimmed read pairs available after processing 4975758 (36.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 15 0.00% 20 14 0.00% 21 20 0.00% 22 11 0.00% 23 7 0.00% 24 14 0.00% 25 15 0.00% 26 30 0.00% 27 19 0.00% 28 17 0.00% 29 28 0.00% 30 27 0.00% 31 26 0.00% 32 21 0.00% 33 20 0.00% 34 19 0.00% 35 24 0.00% 36 23 0.00% 37 20 0.00% 38 40 0.00% 39 24 0.00% 40 46 0.00% 41 46 0.00% 42 40 0.00% 43 51 0.00% 44 43 0.00% 45 43 0.00% 46 67 0.00% 47 73 0.00% 48 69 0.00% 49 110 0.00% 50 98 0.00% 51 133 0.00% 52 150 0.00% 53 148 0.00% 54 155 0.00% 55 199 0.00% 56 199 0.00% 57 222 0.00% 58 247 0.00% 59 271 0.00% 60 332 0.00% 61 451 0.00% 62 455 0.00% 63 555 0.00% 64 594 0.00% 65 594 0.00% 66 689 0.01% 67 758 0.01% 68 837 0.01% 69 987 0.01% 70 1150 0.01% 71 1299 0.01% 72 1576 0.01% 73 1824 0.01% 74 1977 0.01% 75 2336 0.02% 76 3457 0.03% 77 3484 0.03% 78 2915 0.02% 79 3163 0.02% 80 3568 0.03% 81 4133 0.03% 82 4732 0.03% 83 5587 0.04% 84 6760 0.05% 85 7272 0.05% 86 7247 0.05% 87 7416 0.05% 88 8153 0.06% 89 8677 0.06% 90 9169 0.07% 91 10092 0.07% 92 11078 0.08% 93 12163 0.09% 94 12903 0.09% 95 14251 0.10% 96 14994 0.11% 97 15588 0.11% 98 16513 0.12% 99 17073 0.13% 100 18372 0.13% 101 19404 0.14% 102 20772 0.15% 103 22338 0.16% 104 23306 0.17% 105 24393 0.18% 106 25811 0.19% 107 26749 0.20% 108 27660 0.20% 109 28459 0.21% 110 30147 0.22% 111 31845 0.23% 112 33268 0.24% 113 34335 0.25% 114 36041 0.26% 115 37465 0.27% 116 39323 0.29% 117 40504 0.30% 118 42097 0.31% 119 42452 0.31% 120 44733 0.33% 121 46138 0.34% 122 47561 0.35% 123 49766 0.37% 124 51639 0.38% 125 54012 0.40% 126 56649 0.42% 127 57817 0.42% 128 61266 0.45% 129 62235 0.46% 130 64641 0.47% 131 66164 0.49% 132 69725 0.51% 133 73263 0.54% 134 76882 0.56% 135 82521 0.61% 136 86365 0.63% 137 91137 0.67% 138 96403 0.71% 139 105240 0.77% 140 111927 0.82% 141 124311 0.91% 142 136878 1.00% 143 155237 1.14% 144 178122 1.31% 145 214415 1.57% 146 267272 1.96% 147 357261 2.62% 148 527044 3.87% 149 970525 7.12% 150 3427911 25.16% 151 4975758 36.52% 13625217 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=19 prefix-density=0.68 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=162.15 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.95 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=28 prefix-density=0.95 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=46.60 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.7 sequence=AGGAAAGGCTTACGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGTAAGCGACGAAATGCTTCGGGGAGTTGAAAATAAGCGTAGATCCGGAGATTCCCGAATAGGTTAACCTTTCAAACTGCTGCCGAATCCATGGGCAGGCAAGAGACAACCTGGCGAACTGAAACATCTTAGTAACCAGAGGAAAAGAA SRR7170821 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:22:19 Started mapping on | Feb 13 17:22:19 Finished on | Feb 13 17:23:42 Mapping speed, Million of reads per hour | 590.97 Number of input reads | 13625217 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12321617 Uniquely mapped reads % | 90.43% Average mapped length | 289.43 Number of splices: Total | 10884924 Number of splices: Annotated (sjdb) | 10666286 Number of splices: GT/AG | 10666883 Number of splices: GC/AG | 181235 Number of splices: AT/AC | 6436 Number of splices: Non-canonical | 30370 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.03% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 488066 % of reads mapped to multiple loci | 3.58% Number of reads mapped to too many loci | 590141 % of reads mapped to too many loci | 4.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.89% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 825233 825233 825233 N_multimapping 488066 488066 488066 N_noFeature 822640 12014966 938428 N_ambiguous 264608 2020 72140 UnstrandedReadsAssigned:11234369 PositiveStrandReadsAssigned:304631 NegativeStrandReadsAssigned:11311049 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170821 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170821-trimmed-pair1.fastq SRR7170821-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,625,217 reads, 11,607,928 reads pseudoaligned [quant] estimated average fragment length: 230.271 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 997 rounds 52401 SRR7170821.ke.tsv 34699 SRR7170821.se.tsv 87100 total ==> SRR7170821.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1788.73 292 10.4994 Potri.005G024800.1.v4.1 1035 805.729 75 5.98687 Potri.004G059700.1.v4.1 961 731.76 2 0.175788 Potri.007G009000.2.v4.1 1416 1186.73 0 0 Potri.003G141000.2.v4.1 2943 2713.73 779.896 18.4841 Potri.016G087400.1.v4.1 270 91.0896 719 507.678 Potri.015G069301.1.v4.1 564 340.623 0 0 Potri.010G195200.1.v4.1 1773 1543.73 9 0.374972 Potri.012G127500.1.v4.1 977 747.735 254 21.8481 ==> SRR7170821.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 272 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 278 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170821 completed mapping pipeline successfully