Starting /dee2/code/volunteer_pipeline.sh SRR7170822 current disk space = 3088669204480 free memory = 1567882536 SRR7170822 SRAfilesize d214b2a54ca69a68053a0b9db9db7e7d SRR7170822.sra SRR7170822.sra file validated SRR7170822 is paired end SRR7170822 is conventional basespace SRR7170822 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170822_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.078 34.0 33.0 34.0 32.0 34.0 2 33.24425 34.0 33.0 34.0 32.0 34.0 3 33.303 34.0 34.0 34.0 31.0 34.0 4 33.50675 34.0 34.0 34.0 33.0 34.0 5 33.4965 34.0 34.0 34.0 33.0 34.0 6 37.21025 38.0 37.0 38.0 36.0 38.0 7 37.507 38.0 38.0 38.0 37.0 38.0 8 37.59825 38.0 38.0 38.0 38.0 38.0 9 37.60675 38.0 38.0 38.0 38.0 38.0 10-14 37.643600000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.65305 38.0 38.0 38.0 38.0 38.0 20-24 37.596199999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.59195 38.0 38.0 38.0 38.0 38.0 30-34 37.54995 38.0 38.0 38.0 38.0 38.0 35-39 37.4739 38.0 38.0 38.0 37.8 38.0 40-44 37.411950000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.418600000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.302299999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.22575 38.0 38.0 38.0 36.6 38.0 60-64 37.12695 38.0 38.0 38.0 36.0 38.0 65-69 37.18730000000001 38.0 38.0 38.0 36.4 38.0 70-74 37.13045 38.0 38.0 38.0 36.2 38.0 75-79 37.030300000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.9501 38.0 38.0 38.0 36.0 38.0 85-89 36.769850000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.6351 38.0 38.0 38.0 34.6 38.0 95-99 36.540099999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.41825 38.0 38.0 38.0 34.0 38.0 105-109 36.3293 38.0 37.8 38.0 34.0 38.0 110-114 36.20925 38.0 37.8 38.0 33.8 38.0 115-119 36.0687 38.0 37.2 38.0 33.4 38.0 120-124 35.837900000000005 38.0 37.0 38.0 32.6 38.0 125-129 35.460699999999996 38.0 36.2 38.0 30.6 38.0 130-134 35.1358 38.0 36.0 38.0 28.6 38.0 135-139 34.7102 38.0 35.0 38.0 27.2 38.0 140-144 34.25625 38.0 33.4 38.0 25.2 38.0 145-149 33.580200000000005 38.0 33.0 38.0 23.0 38.0 150-151 29.212 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 0.0 16 2.0 17 3.0 18 3.0 19 6.0 20 3.0 21 6.0 22 3.0 23 4.0 24 5.0 25 11.0 26 10.0 27 15.0 28 17.0 29 22.0 30 34.0 31 56.0 32 70.0 33 99.0 34 155.0 35 277.0 36 709.0 37 2483.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.92872117400419 14.937106918238992 11.268343815513626 31.865828092243188 2 21.25 19.375 35.625 23.75 3 16.400000000000002 26.8 30.75 26.05 4 20.7 32.225 26.700000000000003 20.375 5 21.224999999999998 37.025000000000006 24.05 17.7 6 17.575 37.5 25.074999999999996 19.85 7 14.149999999999999 23.125 44.0 18.725 8 17.625 24.55 30.325000000000003 27.500000000000004 9 17.575 22.650000000000002 33.6 26.174999999999997 10-14 19.435 28.895 27.965 23.705000000000002 15-19 19.585 28.96 28.199999999999996 23.255 20-24 19.79 29.354999999999997 28.035 22.82 25-29 19.56 29.21 28.005000000000003 23.225 30-34 19.495 29.815 27.79 22.900000000000002 35-39 19.741974197419744 29.672967296729674 27.33273327332733 23.25232523252325 40-44 19.715 29.625 27.900000000000002 22.759999999999998 45-49 19.491949194919492 29.022902290229023 27.30773077307731 24.17741774177418 50-54 19.695 29.03 27.800000000000004 23.474999999999998 55-59 19.895 28.68 28.075 23.35 60-64 19.939999999999998 28.84 27.860000000000003 23.36 65-69 20.05 29.075 27.88 22.994999999999997 70-74 20.435 28.535 28.035 22.994999999999997 75-79 19.805 29.665000000000003 27.99 22.54 80-84 19.325 28.99 27.955000000000002 23.73 85-89 20.415 29.189999999999998 27.515 22.88 90-94 20.03 28.665000000000003 27.794999999999998 23.51 95-99 20.285 28.970000000000002 27.800000000000004 22.945 100-104 20.055 29.9 27.27 22.775000000000002 105-109 19.945 29.020000000000003 27.73 23.305 110-114 20.405 28.98 27.495000000000005 23.119999999999997 115-119 20.365 29.165000000000003 27.05 23.419999999999998 120-124 20.560000000000002 29.07 27.125 23.244999999999997 125-129 20.575 29.01 26.93 23.485 130-134 21.015 29.09 26.884999999999998 23.01 135-139 20.45 29.01 27.18 23.36 140-144 20.65 28.65 27.055 23.645 145-149 20.815 29.315 26.57 23.3 150-151 20.7125 28.499999999999996 26.625 24.1625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.0 20 0.5 21 2.0 22 2.5 23 2.5 24 3.5 25 4.0 26 9.0 27 16.5 28 17.5 29 20.5 30 29.0 31 38.5 32 54.0 33 64.5 34 79.5 35 94.0 36 111.0 37 132.5 38 152.5 39 175.0 40 196.5 41 216.0 42 239.5 43 253.5 44 252.0 45 243.5 46 226.5 47 214.5 48 216.5 49 202.0 50 163.0 51 131.0 52 99.0 53 67.5 54 59.0 55 56.0 56 42.5 57 29.5 58 19.5 59 15.5 60 10.0 61 7.5 62 7.5 63 4.5 64 2.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.35167043456417985 0.7000000000000001 3 0.025119316754584273 0.075 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5125000000000002 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 2.05 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.6625 0.0 0.0 0.0 0.0 110-111 3.1 0.0 0.0 0.0 0.0 112-113 3.35 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.1375 0.0 0.0 0.0 0.0 118-119 4.5375 0.0 0.0 0.0 0.0 120-121 4.887499999999999 0.0 0.0 0.0 0.0 122-123 5.487500000000001 0.0 0.0 0.0 0.0 124-125 6.0375 0.0 0.0 0.0 0.0 126-127 6.525 0.0 0.0 0.0 0.0 128-129 7.15 0.0 0.0 0.0 0.0 130-131 7.625 0.0 0.0 0.0 0.0 132-133 8.3125 0.0 0.0 0.0 0.0 134-135 8.9375 0.0 0.0 0.0 0.0 136-137 9.6375 0.0 0.0 0.0 0.0 138-139 10.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGCATT 10 0.0068396386 144.9375 2 CTGAACT 35 0.0033180849 62.116074 145 >>END_MODULE SRR7170822 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170822_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0995 33.0 33.0 34.0 33.0 34.0 2 33.201 34.0 33.0 34.0 33.0 34.0 3 33.22125 34.0 33.0 34.0 33.0 34.0 4 33.22325 34.0 33.0 34.0 33.0 34.0 5 33.21825 34.0 33.0 34.0 33.0 34.0 6 37.41125 38.0 38.0 38.0 38.0 38.0 7 37.43675 38.0 38.0 38.0 38.0 38.0 8 37.41075 38.0 38.0 38.0 38.0 38.0 9 37.4305 38.0 38.0 38.0 38.0 38.0 10-14 37.41665 38.0 38.0 38.0 38.0 38.0 15-19 37.43655 38.0 38.0 38.0 38.0 38.0 20-24 37.34905 38.0 38.0 38.0 37.6 38.0 25-29 37.34235 38.0 38.0 38.0 37.6 38.0 30-34 37.33505 38.0 38.0 38.0 37.6 38.0 35-39 37.2898 38.0 38.0 38.0 37.0 38.0 40-44 37.2596 38.0 38.0 38.0 37.0 38.0 45-49 37.30375 38.0 38.0 38.0 37.2 38.0 50-54 37.28125000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.27885 38.0 38.0 38.0 37.0 38.0 60-64 37.2098 38.0 38.0 38.0 37.0 38.0 65-69 37.17215 38.0 38.0 38.0 37.0 38.0 70-74 37.15405 38.0 38.0 38.0 36.8 38.0 75-79 37.100049999999996 38.0 38.0 38.0 36.8 38.0 80-84 36.944849999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.91005 38.0 38.0 38.0 36.0 38.0 90-94 36.8474 38.0 38.0 38.0 36.0 38.0 95-99 36.7162 38.0 38.0 38.0 35.6 38.0 100-104 36.6329 38.0 38.0 38.0 35.0 38.0 105-109 36.52865 38.0 38.0 38.0 34.6 38.0 110-114 36.3945 38.0 38.0 38.0 34.4 38.0 115-119 36.2511 38.0 38.0 38.0 34.0 38.0 120-124 36.02375 38.0 38.0 38.0 33.6 38.0 125-129 35.6566 38.0 37.4 38.0 32.0 38.0 130-134 35.28855 38.0 36.0 38.0 30.4 38.0 135-139 34.72580000000001 38.0 35.8 38.0 28.0 38.0 140-144 34.3216 38.0 34.6 38.0 26.8 38.0 145-149 33.5542 38.0 33.4 38.0 21.4 38.0 150-151 28.623125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 3.0 15 5.0 16 2.0 17 3.0 18 6.0 19 3.0 20 9.0 21 10.0 22 3.0 23 8.0 24 12.0 25 9.0 26 16.0 27 15.0 28 22.0 29 32.0 30 28.0 31 40.0 32 50.0 33 78.0 34 99.0 35 232.0 36 521.0 37 2782.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.15 20.3 13.900000000000002 22.650000000000002 2 27.175 24.275 32.025 16.525000000000002 3 22.05 26.325 33.4 18.224999999999998 4 24.0 34.575 23.175 18.25 5 24.05 36.725 22.425 16.8 6 20.875 39.025 22.225 17.875 7 19.425 18.425 41.699999999999996 20.45 8 21.025 23.599999999999998 27.500000000000004 27.875 9 21.925 24.9 30.099999999999998 23.075000000000003 10-14 23.135 28.625 27.0 21.240000000000002 15-19 23.0 28.1 28.165000000000003 20.735 20-24 23.445 28.225 27.810000000000002 20.52 25-29 23.189999999999998 28.294999999999998 27.925 20.59 30-34 22.105 28.52 28.615000000000002 20.76 35-39 22.38 28.305000000000003 28.835 20.48 40-44 22.955000000000002 28.749999999999996 27.96 20.335 45-49 22.384999999999998 28.360000000000003 28.544999999999998 20.71 50-54 23.09 28.005000000000003 28.299999999999997 20.605 55-59 22.875 28.294999999999998 28.325 20.505000000000003 60-64 22.935 27.715 28.765 20.585 65-69 23.25 27.529999999999998 28.235 20.985 70-74 23.11 28.315 27.91 20.665 75-79 23.22 27.810000000000002 28.08 20.89 80-84 22.95 28.375 28.189999999999998 20.485 85-89 23.225 28.055000000000003 28.050000000000004 20.669999999999998 90-94 23.474999999999998 28.144999999999996 28.12 20.26 95-99 23.31 27.855 28.12 20.715 100-104 23.669999999999998 27.750000000000004 28.01 20.57 105-109 23.18 27.794999999999998 29.025000000000002 20.0 110-114 23.48 28.544999999999998 27.955000000000002 20.02 115-119 24.145 28.294999999999998 27.38 20.18 120-124 24.04 28.660000000000004 27.825 19.475 125-129 24.39 27.975 27.235 20.4 130-134 24.884999999999998 28.15 27.62 19.345000000000002 135-139 24.98 28.13 27.33 19.56 140-144 25.285000000000004 27.755000000000003 28.07 18.89 145-149 25.590000000000003 27.82 26.87 19.72 150-151 25.55 28.299999999999997 27.3 18.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 1.5 23 2.0 24 3.5 25 7.0 26 7.5 27 6.5 28 9.0 29 16.0 30 21.5 31 25.5 32 34.5 33 47.0 34 58.5 35 76.0 36 94.5 37 110.5 38 135.5 39 170.5 40 203.5 41 232.0 42 263.0 43 267.0 44 254.0 45 258.0 46 262.0 47 230.5 48 202.5 49 187.5 50 164.5 51 142.5 52 113.0 53 97.5 54 79.5 55 54.5 56 41.5 57 27.5 58 21.0 59 22.5 60 17.0 61 9.5 62 6.0 63 4.5 64 2.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36995967741935 98.575 2 0.5292338709677419 1.05 3 0.05040322580645161 0.15 4 0.025201612903225805 0.1 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0875 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.3250000000000002 0.0 0.0 0.0 0.0 100-101 1.5125000000000002 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.3 0.0 0.0 0.0 0.0 114-115 3.725 0.0 0.0 0.0 0.0 116-117 4.1375 0.0 0.0 0.0 0.0 118-119 4.512499999999999 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.4 0.0 0.0 0.0 0.0 124-125 5.925 0.0 0.0 0.0 0.0 126-127 6.425 0.0 0.0 0.0 0.0 128-129 7.025 0.0 0.0 0.0 0.0 130-131 7.4625 0.0 0.0 0.0 0.0 132-133 8.0625 0.0 0.0 0.0 0.0 134-135 8.7 0.0 0.0 0.0 0.0 136-137 9.3875 0.0 0.0 0.0 0.0 138-139 9.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATTAC 10 0.006830828 145.0 4 TAGGGAA 30 0.0017973486 72.5 145 >>END_MODULE Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663777 spots for SRR7170822.sra Written 663777 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra Read 663758 spots for SRR7170822.sra Written 663758 spots for SRR7170822.sra SRR ids: ['SRR7170822.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1shcaddy SRR7170822.sra spots: 13275179 blocks: [[1, 663758], [663759, 1327516], [1327517, 1991274], [1991275, 2655032], [2655033, 3318790], [3318791, 3982548], [3982549, 4646306], [4646307, 5310064], [5310065, 5973822], [5973823, 6637580], [6637581, 7301338], [7301339, 7965096], [7965097, 8628854], [8628855, 9292612], [9292613, 9956370], [9956371, 10620128], [10620129, 11283886], [11283887, 11947644], [11947645, 12611402], [12611403, 13275179]] SRR7170822 file size 4476822 SRR7170822 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170822 SRR7170822_1.fastq SRR7170822_2.fastq Input file: SRR7170822_1.fastq Paired file: SRR7170822_2.fastq trimmed: SRR7170822-trimmed-pair1.fastq, SRR7170822-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:22:10 2025 >> started Thu Feb 13 17:22:24 2025 >> done (14.063s) 13275179 read pairs processed; of these: 11382 ( 0.09%) short read pairs filtered out after trimming by size control 34544 ( 0.26%) empty read pairs filtered out after trimming by size control 13229253 (99.65%) read pairs available; of these: 8065006 (60.96%) trimmed read pairs available after processing 5164247 (39.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 16 0.00% 20 17 0.00% 21 13 0.00% 22 18 0.00% 23 24 0.00% 24 20 0.00% 25 23 0.00% 26 32 0.00% 27 29 0.00% 28 19 0.00% 29 28 0.00% 30 25 0.00% 31 29 0.00% 32 20 0.00% 33 33 0.00% 34 29 0.00% 35 25 0.00% 36 22 0.00% 37 32 0.00% 38 34 0.00% 39 38 0.00% 40 40 0.00% 41 49 0.00% 42 52 0.00% 43 65 0.00% 44 65 0.00% 45 56 0.00% 46 76 0.00% 47 70 0.00% 48 105 0.00% 49 123 0.00% 50 120 0.00% 51 149 0.00% 52 177 0.00% 53 175 0.00% 54 201 0.00% 55 215 0.00% 56 247 0.00% 57 293 0.00% 58 329 0.00% 59 378 0.00% 60 462 0.00% 61 498 0.00% 62 599 0.00% 63 606 0.00% 64 688 0.01% 65 764 0.01% 66 843 0.01% 67 916 0.01% 68 1040 0.01% 69 1205 0.01% 70 1297 0.01% 71 1647 0.01% 72 1895 0.01% 73 2172 0.02% 74 2305 0.02% 75 2789 0.02% 76 3700 0.03% 77 4134 0.03% 78 3491 0.03% 79 3801 0.03% 80 4229 0.03% 81 4790 0.04% 82 5323 0.04% 83 6024 0.05% 84 6970 0.05% 85 7799 0.06% 86 8345 0.06% 87 9210 0.07% 88 9461 0.07% 89 10394 0.08% 90 11091 0.08% 91 11971 0.09% 92 12944 0.10% 93 14187 0.11% 94 14872 0.11% 95 15907 0.12% 96 16533 0.12% 97 17158 0.13% 98 17400 0.13% 99 18448 0.14% 100 19401 0.15% 101 20112 0.15% 102 21437 0.16% 103 22826 0.17% 104 23729 0.18% 105 24934 0.19% 106 25782 0.19% 107 26463 0.20% 108 27607 0.21% 109 28026 0.21% 110 28399 0.21% 111 29869 0.23% 112 31050 0.23% 113 32660 0.25% 114 34263 0.26% 115 35562 0.27% 116 36704 0.28% 117 37396 0.28% 118 38326 0.29% 119 39622 0.30% 120 40576 0.31% 121 41819 0.32% 122 43307 0.33% 123 44821 0.34% 124 46770 0.35% 125 48776 0.37% 126 50537 0.38% 127 52072 0.39% 128 53506 0.40% 129 55205 0.42% 130 57088 0.43% 131 59449 0.45% 132 61864 0.47% 133 64987 0.49% 134 68708 0.52% 135 73081 0.55% 136 76146 0.58% 137 81208 0.61% 138 86554 0.65% 139 92448 0.70% 140 99103 0.75% 141 107421 0.81% 142 118543 0.90% 143 134616 1.02% 144 156344 1.18% 145 183991 1.39% 146 229517 1.73% 147 304683 2.30% 148 456956 3.45% 149 880154 6.65% 150 3349148 25.32% 151 5164247 39.04% 13229253 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=23 prefix-density=0.39 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=43.83 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=13.2 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=11 prefix-density=0.63 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=17.87 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.2 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170822 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:23:22 Started mapping on | Feb 13 17:23:23 Finished on | Feb 13 17:24:44 Mapping speed, Million of reads per hour | 587.97 Number of input reads | 13229253 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 12552860 Uniquely mapped reads % | 94.89% Average mapped length | 289.27 Number of splices: Total | 11444860 Number of splices: Annotated (sjdb) | 11141385 Number of splices: GT/AG | 11218850 Number of splices: GC/AG | 176296 Number of splices: AT/AC | 8022 Number of splices: Non-canonical | 41692 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.03% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363831 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 35504 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.02% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 327418 327418 327418 N_multimapping 363831 363831 363831 N_noFeature 593891 12279924 733668 N_ambiguous 237253 1364 103162 UnstrandedReadsAssigned:11721716 PositiveStrandReadsAssigned:271572 NegativeStrandReadsAssigned:11716030 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170822 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170822-trimmed-pair1.fastq SRR7170822-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,229,253 reads, 11,671,103 reads pseudoaligned [quant] estimated average fragment length: 236.347 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,313 rounds 52401 SRR7170822.ke.tsv 34699 SRR7170822.se.tsv 87100 total ==> SRR7170822.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.65 575 26.4752 Potri.005G024800.1.v4.1 1035 799.653 176 18.0655 Potri.004G059700.1.v4.1 961 725.716 21 2.37515 Potri.007G009000.2.v4.1 1416 1180.65 0 0 Potri.003G141000.2.v4.1 2943 2707.65 510.246 15.4677 Potri.016G087400.1.v4.1 270 90.8441 615 555.67 Potri.015G069301.1.v4.1 564 336.216 0 0 Potri.010G195200.1.v4.1 1773 1537.65 65 3.46971 Potri.012G127500.1.v4.1 977 741.699 305 33.7529 ==> SRR7170822.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1094 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 268 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 17 SRR7170822 completed mapping pipeline successfully