Starting /dee2/code/volunteer_pipeline.sh SRR7170823 current disk space = 3088657637376 free memory = 1455285336 SRR7170823 SRAfilesize 2ec0d8d79673f3e8fc0009852abace1f SRR7170823.sra SRR7170823.sra file validated SRR7170823 is paired end SRR7170823 is conventional basespace SRR7170823 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170823_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1675 34.0 33.0 34.0 33.0 34.0 2 33.29825 34.0 34.0 34.0 33.0 34.0 3 33.3575 34.0 34.0 34.0 33.0 34.0 4 33.53525 34.0 34.0 34.0 33.0 34.0 5 33.512 34.0 34.0 34.0 33.0 34.0 6 37.289 38.0 38.0 38.0 36.0 38.0 7 37.49675 38.0 38.0 38.0 37.0 38.0 8 37.641 38.0 38.0 38.0 38.0 38.0 9 37.657 38.0 38.0 38.0 38.0 38.0 10-14 37.65955 38.0 38.0 38.0 38.0 38.0 15-19 37.62295 38.0 38.0 38.0 38.0 38.0 20-24 37.617399999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.58485 38.0 38.0 38.0 38.0 38.0 30-34 37.576100000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.54175 38.0 38.0 38.0 38.0 38.0 40-44 37.513149999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.4469 38.0 38.0 38.0 37.4 38.0 50-54 37.379 38.0 38.0 38.0 37.0 38.0 55-59 37.2784 38.0 38.0 38.0 37.0 38.0 60-64 37.23755 38.0 38.0 38.0 36.8 38.0 65-69 37.31455000000001 38.0 38.0 38.0 37.0 38.0 70-74 37.264250000000004 38.0 38.0 38.0 36.8 38.0 75-79 37.1122 38.0 38.0 38.0 36.2 38.0 80-84 37.0223 38.0 38.0 38.0 36.0 38.0 85-89 36.8998 38.0 38.0 38.0 35.8 38.0 90-94 36.8187 38.0 38.0 38.0 35.6 38.0 95-99 36.6682 38.0 38.0 38.0 35.0 38.0 100-104 36.6166 38.0 38.0 38.0 34.4 38.0 105-109 36.5817 38.0 38.0 38.0 34.4 38.0 110-114 36.5228 38.0 38.0 38.0 34.2 38.0 115-119 36.239149999999995 38.0 37.6 38.0 33.8 38.0 120-124 36.1208 38.0 37.2 38.0 33.6 38.0 125-129 35.784800000000004 38.0 36.6 38.0 31.8 38.0 130-134 35.44435 38.0 36.0 38.0 31.0 38.0 135-139 35.1754 38.0 36.0 38.0 29.4 38.0 140-144 34.732899999999994 38.0 35.4 38.0 28.2 38.0 145-149 33.98025 38.0 33.0 38.0 24.8 38.0 150-151 29.6175 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 4.0 20 3.0 21 2.0 22 5.0 23 9.0 24 9.0 25 4.0 26 11.0 27 27.0 28 17.0 29 24.0 30 35.0 31 42.0 32 52.0 33 85.0 34 128.0 35 210.0 36 660.0 37 2667.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.411764705882355 15.320261437908497 10.771241830065359 36.49673202614379 2 20.4 20.0 37.1 22.5 3 17.45 26.400000000000002 28.499999999999996 27.650000000000002 4 21.8 33.5 23.724999999999998 20.974999999999998 5 21.025 38.7 23.45 16.825000000000003 6 16.7 36.449999999999996 25.900000000000002 20.95 7 14.000000000000002 22.25 44.9 18.85 8 16.75 23.825 31.874999999999996 27.55 9 17.9 23.95 33.25 24.9 10-14 19.84 29.435 26.650000000000002 24.075 15-19 19.585 28.685 27.79 23.94 20-24 19.814999999999998 28.494999999999997 27.79 23.9 25-29 19.895 28.660000000000004 28.050000000000004 23.395 30-34 20.04 28.799999999999997 27.765 23.395 35-39 19.630981549077454 29.141457072853644 27.591379568978446 23.636181809090452 40-44 19.805 28.694999999999997 28.335 23.165 45-49 20.635 28.9 27.26 23.205000000000002 50-54 19.885 28.53 27.98 23.605 55-59 20.145 28.749999999999996 27.279999999999998 23.825 60-64 19.79 28.435 28.389999999999997 23.385 65-69 20.435 28.95 27.474999999999998 23.14 70-74 19.77 28.785 27.725 23.72 75-79 20.36 28.92 27.465 23.255 80-84 20.044999999999998 28.355000000000004 28.050000000000004 23.549999999999997 85-89 20.325 28.449999999999996 27.875 23.35 90-94 20.48 28.215 27.875 23.43 95-99 20.395 28.7 27.534999999999997 23.369999999999997 100-104 20.19 28.555000000000003 27.794999999999998 23.46 105-109 20.549999999999997 28.565 27.11 23.775 110-114 21.085 28.405 26.895000000000003 23.615 115-119 20.919999999999998 28.025 27.51 23.544999999999998 120-124 21.01 28.505000000000003 26.61 23.875 125-129 21.044999999999998 28.325 26.775 23.855 130-134 21.025 29.2 26.540000000000003 23.235 135-139 21.46 28.67 25.974999999999998 23.895 140-144 21.5 27.689999999999998 26.75 24.060000000000002 145-149 21.57 28.57 25.495 24.365000000000002 150-151 21.3125 27.8625 26.075 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.5 23 2.5 24 3.5 25 5.0 26 8.5 27 11.5 28 17.5 29 20.0 30 22.5 31 41.0 32 51.5 33 52.0 34 60.5 35 84.5 36 111.5 37 129.0 38 137.5 39 157.0 40 192.5 41 216.0 42 232.5 43 244.0 44 243.0 45 246.0 46 242.5 47 230.0 48 226.5 49 200.5 50 169.0 51 141.5 52 106.5 53 88.0 54 74.5 55 56.0 56 47.5 57 38.0 58 28.5 59 21.0 60 13.0 61 9.5 62 4.5 63 2.5 64 2.0 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3436001009846 98.375 2 0.5301691492047462 1.05 3 0.025246149962130777 0.075 4 0.050492299924261554 0.2 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.025246149962130777 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGCGATAGATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 1 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.5875 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.4375 0.0 0.0 0.0 0.0 96-97 1.8375 0.0 0.0 0.0 0.0 98-99 2.275 0.0 0.0 0.0 0.0 100-101 2.6125 0.0 0.0 0.0 0.0 102-103 3.075 0.0 0.0 0.0 0.0 104-105 3.4625 0.0 0.0 0.0 0.0 106-107 3.85 0.0 0.0 0.0 0.0 108-109 4.375 0.0 0.0 0.0 0.0 110-111 4.7 0.0 0.0 0.0 0.0 112-113 4.9875 0.0 0.0 0.0 0.0 114-115 5.4625 0.0 0.0 0.0 0.0 116-117 6.0625 0.0 0.0 0.0 0.0 118-119 6.725 0.0 0.0 0.0 0.0 120-121 7.387499999999999 0.0 0.0 0.0 0.0 122-123 7.9625 0.0 0.0 0.0 0.0 124-125 8.75 0.0 0.0 0.0 0.0 126-127 9.625 0.0 0.0 0.0 0.0 128-129 10.075 0.0 0.0 0.0 0.0 130-131 10.8375 0.0 0.0 0.0 0.0 132-133 11.7375 0.0 0.0 0.0 0.0 134-135 12.3 0.0 0.0 0.0 0.0 136-137 12.95 0.0 0.0 0.0 0.0 138-139 13.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 185 1.6347292E-5 9.404594 65-69 >>END_MODULE SRR7170823 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170823_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08375 33.0 33.0 34.0 33.0 34.0 2 33.23275 34.0 33.0 34.0 33.0 34.0 3 33.2405 34.0 33.0 34.0 33.0 34.0 4 33.235 34.0 33.0 34.0 33.0 34.0 5 33.249 34.0 33.0 34.0 33.0 34.0 6 37.461 38.0 38.0 38.0 38.0 38.0 7 37.49325 38.0 38.0 38.0 38.0 38.0 8 37.48975 38.0 38.0 38.0 38.0 38.0 9 37.4565 38.0 38.0 38.0 38.0 38.0 10-14 37.457 38.0 38.0 38.0 38.0 38.0 15-19 37.47695 38.0 38.0 38.0 38.0 38.0 20-24 37.4206 38.0 38.0 38.0 38.0 38.0 25-29 37.428549999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.417350000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.362700000000004 38.0 38.0 38.0 37.6 38.0 40-44 37.326 38.0 38.0 38.0 37.6 38.0 45-49 37.33125 38.0 38.0 38.0 37.4 38.0 50-54 37.331649999999996 38.0 38.0 38.0 37.6 38.0 55-59 37.3272 38.0 38.0 38.0 37.2 38.0 60-64 37.271550000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.22585 38.0 38.0 38.0 37.0 38.0 70-74 37.17755 38.0 38.0 38.0 37.0 38.0 75-79 37.169000000000004 38.0 38.0 38.0 37.0 38.0 80-84 37.014 38.0 38.0 38.0 36.8 38.0 85-89 36.9406 38.0 38.0 38.0 36.2 38.0 90-94 36.888549999999995 38.0 38.0 38.0 36.0 38.0 95-99 36.79705 38.0 38.0 38.0 36.0 38.0 100-104 36.734300000000005 38.0 38.0 38.0 35.8 38.0 105-109 36.61415 38.0 38.0 38.0 35.0 38.0 110-114 36.50849999999999 38.0 38.0 38.0 34.8 38.0 115-119 36.29045 38.0 38.0 38.0 34.2 38.0 120-124 36.08774999999999 38.0 38.0 38.0 34.0 38.0 125-129 35.7595 38.0 37.4 38.0 32.6 38.0 130-134 35.438700000000004 38.0 36.6 38.0 30.6 38.0 135-139 34.880199999999995 38.0 36.0 38.0 29.2 38.0 140-144 34.4392 38.0 35.6 38.0 27.4 38.0 145-149 33.6132 38.0 33.2 38.0 22.0 38.0 150-151 28.587875000000004 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 0.0 17 6.0 18 5.0 19 9.0 20 14.0 21 3.0 22 5.0 23 10.0 24 10.0 25 15.0 26 12.0 27 15.0 28 22.0 29 31.0 30 23.0 31 33.0 32 47.0 33 64.0 34 100.0 35 177.0 36 520.0 37 2864.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.725 18.4 12.075 26.8 2 26.700000000000003 24.349999999999998 32.95 16.0 3 21.975 26.275 32.85 18.9 4 24.3 34.35 22.15 19.2 5 23.5 37.45 22.0 17.05 6 18.7 39.050000000000004 25.3 16.950000000000003 7 18.925 18.75 41.199999999999996 21.125 8 19.725 23.65 29.099999999999998 27.525 9 21.7 23.674999999999997 30.349999999999998 24.275 10-14 23.115 28.53 26.810000000000002 21.545 15-19 22.84 27.950000000000003 28.494999999999997 20.715 20-24 23.05 27.98 28.265 20.705000000000002 25-29 22.919999999999998 27.834999999999997 28.235 21.01 30-34 22.189999999999998 28.525 28.785 20.5 35-39 22.85 27.650000000000002 28.749999999999996 20.75 40-44 23.285 28.095 28.37 20.25 45-49 22.98 28.155 27.905 20.96 50-54 22.335 28.185 28.425 21.055 55-59 22.755 27.965 28.175 21.105 60-64 23.035 28.144999999999996 27.925 20.895 65-69 23.695 27.084999999999997 28.060000000000002 21.16 70-74 23.16 27.99 27.700000000000003 21.15 75-79 22.86 27.815 28.389999999999997 20.935000000000002 80-84 23.425 27.555000000000003 28.155 20.865000000000002 85-89 23.580000000000002 28.08 27.605 20.735 90-94 23.785 27.515 27.474999999999998 21.224999999999998 95-99 23.715 28.42 27.555000000000003 20.31 100-104 23.59 28.249999999999996 27.615000000000002 20.544999999999998 105-109 23.990000000000002 28.025 27.67 20.315 110-114 24.265 28.384999999999998 27.200000000000003 20.150000000000002 115-119 24.54 28.46 27.465 19.535 120-124 24.610000000000003 28.794999999999998 27.18 19.415 125-129 24.63 28.38 27.325 19.665 130-134 25.619999999999997 28.01 27.089999999999996 19.28 135-139 26.25 27.279999999999998 27.284999999999997 19.185 140-144 26.290000000000003 28.299999999999997 27.075 18.335 145-149 26.755000000000003 28.375 26.51 18.360000000000003 150-151 26.4625 28.449999999999996 26.3625 18.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.5 21 1.5 22 1.5 23 2.0 24 3.0 25 3.0 26 5.0 27 8.5 28 8.5 29 9.5 30 19.0 31 21.0 32 29.0 33 43.0 34 50.0 35 62.0 36 89.0 37 131.0 38 155.5 39 172.5 40 188.0 41 212.0 42 235.0 43 243.5 44 274.5 45 270.5 46 247.5 47 249.5 48 226.0 49 200.0 50 175.0 51 143.0 52 117.0 53 87.0 54 69.0 55 63.5 56 49.0 57 33.0 58 24.5 59 19.5 60 16.0 61 13.0 62 9.5 63 5.5 64 3.0 65 2.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08583037074658 97.55 2 0.6602336211274759 1.3 3 0.10157440325038089 0.3 4 0.07618080243778569 0.3 5 0.0 0.0 6 0.0 0.0 7 0.050787201625190445 0.35000000000000003 8 0.025393600812595223 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7250000000000001 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.35 0.0 0.0 0.0 0.0 100-101 2.7375 0.0 0.0 0.0 0.0 102-103 3.2 0.0 0.0 0.0 0.0 104-105 3.6125 0.0 0.0 0.0 0.0 106-107 4.0125 0.0 0.0 0.0 0.0 108-109 4.55 0.0 0.0 0.0 0.0 110-111 4.887499999999999 0.0 0.0 0.0 0.0 112-113 5.2 0.0 0.0 0.0 0.0 114-115 5.6875 0.0 0.0 0.0 0.0 116-117 6.2875 0.0 0.0 0.0 0.0 118-119 6.9375 0.0 0.0 0.0 0.0 120-121 7.575 0.0 0.0 0.0 0.0 122-123 8.1875 0.0 0.0 0.0 0.0 124-125 8.9875 0.0 0.0 0.0 0.0 126-127 9.875 0.0 0.0 0.0 0.0 128-129 10.3 0.0 0.0 0.0 0.0 130-131 11.0625 0.0 0.0 0.0 0.0 132-133 11.9625 0.0 0.0 0.0 0.0 134-135 12.5125 0.0 0.0 0.0 0.0 136-137 13.2125 0.0 0.0 0.0 0.0 138-139 14.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 170 2.5538611E-9 12.794117 70-74 >>END_MODULE Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703689 spots for SRR7170823.sra Written 703689 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra Read 703686 spots for SRR7170823.sra Written 703686 spots for SRR7170823.sra SRR ids: ['SRR7170823.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_swsm6mvx SRR7170823.sra spots: 14073723 blocks: [[1, 703686], [703687, 1407372], [1407373, 2111058], [2111059, 2814744], [2814745, 3518430], [3518431, 4222116], [4222117, 4925802], [4925803, 5629488], [5629489, 6333174], [6333175, 7036860], [7036861, 7740546], [7740547, 8444232], [8444233, 9147918], [9147919, 9851604], [9851605, 10555290], [10555291, 11258976], [11258977, 11962662], [11962663, 12666348], [12666349, 13370034], [13370035, 14073723]] SRR7170823 file size 4747422 SRR7170823 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170823 SRR7170823_1.fastq SRR7170823_2.fastq Input file: SRR7170823_1.fastq Paired file: SRR7170823_2.fastq trimmed: SRR7170823-trimmed-pair1.fastq, SRR7170823-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:37:35 2025 >> started Thu Feb 13 17:37:50 2025 >> done (15.209s) 14073723 read pairs processed; of these: 9892 ( 0.07%) short read pairs filtered out after trimming by size control 31516 ( 0.22%) empty read pairs filtered out after trimming by size control 14032315 (99.71%) read pairs available; of these: 8712511 (62.09%) trimmed read pairs available after processing 5319804 (37.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 19 0.00% 20 16 0.00% 21 17 0.00% 22 16 0.00% 23 11 0.00% 24 20 0.00% 25 13 0.00% 26 30 0.00% 27 34 0.00% 28 28 0.00% 29 23 0.00% 30 33 0.00% 31 41 0.00% 32 34 0.00% 33 34 0.00% 34 50 0.00% 35 45 0.00% 36 46 0.00% 37 57 0.00% 38 73 0.00% 39 101 0.00% 40 124 0.00% 41 110 0.00% 42 126 0.00% 43 125 0.00% 44 134 0.00% 45 183 0.00% 46 183 0.00% 47 218 0.00% 48 258 0.00% 49 337 0.00% 50 390 0.00% 51 403 0.00% 52 488 0.00% 53 495 0.00% 54 518 0.00% 55 606 0.00% 56 595 0.00% 57 727 0.01% 58 859 0.01% 59 984 0.01% 60 1143 0.01% 61 1338 0.01% 62 1392 0.01% 63 1646 0.01% 64 1699 0.01% 65 1852 0.01% 66 1980 0.01% 67 2189 0.02% 68 2403 0.02% 69 2816 0.02% 70 3160 0.02% 71 3720 0.03% 72 4177 0.03% 73 4732 0.03% 74 5229 0.04% 75 5779 0.04% 76 7603 0.05% 77 7881 0.06% 78 7158 0.05% 79 7655 0.05% 80 8523 0.06% 81 9651 0.07% 82 10759 0.08% 83 11929 0.09% 84 13125 0.09% 85 14164 0.10% 86 14600 0.10% 87 15737 0.11% 88 16695 0.12% 89 17416 0.12% 90 18457 0.13% 91 19760 0.14% 92 21720 0.15% 93 23577 0.17% 94 24643 0.18% 95 25904 0.18% 96 26639 0.19% 97 27366 0.20% 98 28172 0.20% 99 29192 0.21% 100 30298 0.22% 101 31530 0.22% 102 33891 0.24% 103 35503 0.25% 104 36624 0.26% 105 37819 0.27% 106 38226 0.27% 107 39123 0.28% 108 39479 0.28% 109 40342 0.29% 110 40829 0.29% 111 42862 0.31% 112 43876 0.31% 113 45178 0.32% 114 47054 0.34% 115 49022 0.35% 116 49807 0.35% 117 50294 0.36% 118 51076 0.36% 119 51882 0.37% 120 52984 0.38% 121 53894 0.38% 122 55420 0.39% 123 57789 0.41% 124 59471 0.42% 125 61234 0.44% 126 63449 0.45% 127 64255 0.46% 128 65291 0.47% 129 66948 0.48% 130 68084 0.49% 131 69546 0.50% 132 71582 0.51% 133 75266 0.54% 134 78892 0.56% 135 82760 0.59% 136 86534 0.62% 137 90041 0.64% 138 94261 0.67% 139 99370 0.71% 140 104897 0.75% 141 112922 0.80% 142 122984 0.88% 143 137568 0.98% 144 156941 1.12% 145 183355 1.31% 146 224797 1.60% 147 294949 2.10% 148 439357 3.13% 149 850305 6.06% 150 3370449 24.02% 151 5319804 37.91% 14032315 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=21 prefix-density=0.41 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=34.77 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=8.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=23 prefix-density=0.53 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=33.75 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.5 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7170823 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:38:33 Started mapping on | Feb 13 17:38:34 Finished on | Feb 13 17:39:59 Mapping speed, Million of reads per hour | 594.31 Number of input reads | 14032315 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 13340446 Uniquely mapped reads % | 95.07% Average mapped length | 286.05 Number of splices: Total | 12553039 Number of splices: Annotated (sjdb) | 12247004 Number of splices: GT/AG | 12310673 Number of splices: GC/AG | 189981 Number of splices: AT/AC | 7696 Number of splices: Non-canonical | 44689 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363009 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 25862 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 338801 338801 338801 N_multimapping 363009 363009 363009 N_noFeature 575378 13005175 771066 N_ambiguous 229421 1436 88807 UnstrandedReadsAssigned:12535647 PositiveStrandReadsAssigned:333835 NegativeStrandReadsAssigned:12480573 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR7170823 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170823-trimmed-pair1.fastq SRR7170823-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,032,315 reads, 12,436,646 reads pseudoaligned [quant] estimated average fragment length: 218.905 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7170823.ke.tsv 34699 SRR7170823.se.tsv 87100 total ==> SRR7170823.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1800.09 531 21.6691 Potri.005G024800.1.v4.1 1035 817.095 134 12.0469 Potri.004G059700.1.v4.1 961 743.149 14 1.38387 Potri.007G009000.2.v4.1 1416 1198.09 0 0 Potri.003G141000.2.v4.1 2943 2725.09 765.453 20.6338 Potri.016G087400.1.v4.1 270 97.9333 771 578.317 Potri.015G069301.1.v4.1 564 351.928 0 0 Potri.010G195200.1.v4.1 1773 1555.09 145 6.84941 Potri.012G127500.1.v4.1 977 759.125 56 5.41897 ==> SRR7170823.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 560 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 313 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7170823 completed mapping pipeline successfully