Starting /dee2/code/volunteer_pipeline.sh SRR7170824 current disk space = 3088621694976 free memory = 1452174944 SRR7170824 SRAfilesize 3d7931b3855245bc454a0207b3c7d3ee SRR7170824.sra SRR7170824.sra file validated SRR7170824 is paired end SRR7170824 is conventional basespace SRR7170824 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170824_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4585 34.0 33.0 34.0 32.0 34.0 2 33.3005 34.0 33.0 34.0 32.0 34.0 3 33.28475 34.0 33.0 34.0 31.0 34.0 4 33.46775 34.0 33.0 34.0 33.0 34.0 5 33.40925 34.0 33.0 34.0 33.0 34.0 6 36.9355 38.0 37.0 38.0 36.0 38.0 7 37.2905 38.0 38.0 38.0 36.0 38.0 8 37.48575 38.0 38.0 38.0 37.0 38.0 9 37.566 38.0 38.0 38.0 38.0 38.0 10-14 37.5589 38.0 38.0 38.0 38.0 38.0 15-19 37.49884999999999 38.0 38.0 38.0 37.6 38.0 20-24 37.493 38.0 38.0 38.0 37.2 38.0 25-29 37.39065 38.0 38.0 38.0 37.0 38.0 30-34 37.3092 38.0 38.0 38.0 37.0 38.0 35-39 37.277750000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.2364 38.0 38.0 38.0 36.6 38.0 45-49 37.126999999999995 38.0 38.0 38.0 36.0 38.0 50-54 37.0427 38.0 38.0 38.0 36.0 38.0 55-59 36.960750000000004 38.0 38.0 38.0 36.0 38.0 60-64 36.875249999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.841899999999995 38.0 38.0 38.0 35.4 38.0 70-74 36.82875 38.0 38.0 38.0 35.2 38.0 75-79 36.705 38.0 38.0 38.0 34.8 38.0 80-84 36.4482 38.0 37.8 38.0 33.8 38.0 85-89 36.43235 38.0 38.0 38.0 33.8 38.0 90-94 36.3065 38.0 37.4 38.0 34.0 38.0 95-99 36.1536 38.0 37.4 38.0 33.0 38.0 100-104 35.9344 38.0 37.0 38.0 32.0 38.0 105-109 35.78869999999999 38.0 37.0 38.0 31.2 38.0 110-114 35.50595 38.0 36.2 38.0 30.2 38.0 115-119 35.2232 38.0 36.0 38.0 29.0 38.0 120-124 34.9248 38.0 35.2 38.0 28.2 38.0 125-129 34.309850000000004 38.0 33.6 38.0 25.2 38.0 130-134 33.925799999999995 38.0 33.0 38.0 22.8 38.0 135-139 33.3291 38.0 33.0 38.0 20.4 38.0 140-144 32.317 37.6 31.8 38.0 14.4 38.0 145-149 30.856650000000002 36.4 29.8 38.0 8.4 38.0 150-151 24.538625 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 2.0 18 7.0 19 7.0 20 7.0 21 2.0 22 3.0 23 10.0 24 9.0 25 21.0 26 24.0 27 26.0 28 29.0 29 55.0 30 52.0 31 68.0 32 93.0 33 130.0 34 236.0 35 432.0 36 1068.0 37 1710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.58595766649458 16.726897263810013 9.189468249870934 28.49767681982447 2 21.275 20.325 34.699999999999996 23.7 3 16.625 29.45 29.375 24.55 4 21.05 33.175 26.174999999999997 19.6 5 20.474999999999998 37.25 23.95 18.325 6 18.0 35.75 26.025 20.225 7 13.200000000000001 22.825 44.474999999999994 19.5 8 18.65 22.725 29.45 29.175 9 18.0 23.7 31.95 26.35 10-14 20.294999999999998 29.275000000000002 26.855 23.575 15-19 20.255000000000003 28.575 27.694999999999997 23.474999999999998 20-24 19.875 28.78 28.185 23.16 25-29 20.04 28.89 27.755000000000003 23.315 30-34 19.88 28.939999999999998 27.735 23.445 35-39 19.919999999999998 29.104999999999997 27.46 23.515 40-44 20.365 28.825 27.744999999999997 23.064999999999998 45-49 20.125 28.494999999999997 27.639999999999997 23.74 50-54 19.925 28.655 28.115000000000002 23.305 55-59 19.88 28.310000000000002 27.825 23.985 60-64 20.44 28.59 28.02 22.95 65-69 20.625 28.499999999999996 28.07 22.805 70-74 20.485 28.58 27.37 23.565 75-79 20.52 28.93 27.54 23.01 80-84 20.39 28.26 27.485 23.865 85-89 20.22 29.03 27.57 23.18 90-94 20.155 28.575 28.055000000000003 23.215 95-99 20.380000000000003 28.93 27.505000000000003 23.185 100-104 19.905 28.544999999999998 28.18 23.369999999999997 105-109 20.715 28.71 27.345000000000002 23.23 110-114 20.4 29.505 27.315 22.78 115-119 20.745 29.075 27.02 23.16 120-124 20.825 28.625 26.905 23.645 125-129 21.375 28.005000000000003 27.02 23.599999999999998 130-134 21.525 28.405 26.284999999999997 23.785 135-139 21.315 27.950000000000003 26.875 23.86 140-144 21.01 28.610000000000003 26.235000000000003 24.145 145-149 21.495 28.615000000000002 26.245 23.645 150-151 21.6875 28.4375 26.5 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.5 19 1.0 20 1.0 21 1.0 22 0.5 23 2.5 24 4.0 25 4.0 26 5.0 27 11.5 28 15.5 29 11.0 30 19.0 31 34.5 32 43.5 33 53.0 34 60.5 35 74.5 36 95.0 37 106.5 38 134.0 39 174.5 40 200.0 41 224.5 42 241.5 43 255.5 44 274.0 45 261.0 46 251.5 47 252.0 48 219.0 49 188.5 50 173.5 51 139.5 52 106.5 53 89.5 54 70.5 55 58.5 56 43.5 57 30.0 58 20.5 59 10.5 60 9.0 61 6.5 62 3.5 63 4.0 64 3.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54728370221329 98.95 2 0.4024144869215292 0.8 3 0.0 0.0 4 0.0 0.0 5 0.05030181086519115 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.037500000000000006 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.6000000000000001 0.0 0.0 0.0 0.0 90-91 0.8125 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.2 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.475 0.0 0.0 0.0 0.0 112-113 3.95 0.0 0.0 0.0 0.0 114-115 4.425000000000001 0.0 0.0 0.0 0.0 116-117 4.8875 0.0 0.0 0.0 0.0 118-119 5.550000000000001 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.800000000000001 0.0 0.0 0.0 0.0 124-125 7.4375 0.0 0.0 0.0 0.0 126-127 8.0375 0.0 0.0 0.0 0.0 128-129 8.662500000000001 0.0 0.0 0.0 0.0 130-131 9.4625 0.0 0.0 0.0 0.0 132-133 10.0625 0.0 0.0 0.0 0.0 134-135 10.675 0.0 0.0 0.0 0.0 136-137 11.4625 0.0 0.0 0.0 0.0 138-139 12.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATAC 10 0.006836113 144.9625 7 CAACATA 10 0.006836113 144.9625 4 AGATGGA 10 0.006836113 144.9625 4 >>END_MODULE SRR7170824 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170824_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98275 33.0 33.0 34.0 32.0 34.0 2 33.106 34.0 33.0 34.0 32.0 34.0 3 33.1495 34.0 33.0 34.0 33.0 34.0 4 33.07775 34.0 33.0 34.0 33.0 34.0 5 33.108 34.0 33.0 34.0 33.0 34.0 6 37.32225 38.0 38.0 38.0 38.0 38.0 7 37.3795 38.0 38.0 38.0 38.0 38.0 8 37.331 38.0 38.0 38.0 38.0 38.0 9 37.364 38.0 38.0 38.0 38.0 38.0 10-14 37.31770000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.31479999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.24225 38.0 38.0 38.0 37.0 38.0 25-29 37.18125 38.0 38.0 38.0 37.0 38.0 30-34 37.206500000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.165949999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.15125 38.0 38.0 38.0 37.0 38.0 45-49 37.16915 38.0 38.0 38.0 37.0 38.0 50-54 37.0749 38.0 38.0 38.0 37.0 38.0 55-59 37.08695 38.0 38.0 38.0 37.0 38.0 60-64 37.00945 38.0 38.0 38.0 36.6 38.0 65-69 36.9885 38.0 38.0 38.0 36.0 38.0 70-74 36.9654 38.0 38.0 38.0 36.0 38.0 75-79 36.803 38.0 38.0 38.0 36.0 38.0 80-84 36.7333 38.0 38.0 38.0 35.8 38.0 85-89 36.674499999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.48115 38.0 38.0 38.0 34.6 38.0 95-99 36.44775 38.0 38.0 38.0 34.6 38.0 100-104 36.285999999999994 38.0 38.0 38.0 34.2 38.0 105-109 36.056400000000004 38.0 38.0 38.0 33.4 38.0 110-114 35.9996 38.0 38.0 38.0 33.6 38.0 115-119 35.772149999999996 38.0 37.0 38.0 32.2 38.0 120-124 35.61865 38.0 37.0 38.0 31.4 38.0 125-129 35.216300000000004 38.0 36.2 38.0 30.4 38.0 130-134 34.57735 38.0 35.2 38.0 26.6 38.0 135-139 34.04355 38.0 34.0 38.0 23.8 38.0 140-144 33.3799 38.0 33.0 38.0 20.0 38.0 145-149 32.3389 38.0 33.0 38.0 11.6 38.0 150-151 27.072625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 3.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 1.0 12 0.0 13 1.0 14 3.0 15 4.0 16 3.0 17 4.0 18 7.0 19 5.0 20 8.0 21 10.0 22 2.0 23 16.0 24 9.0 25 8.0 26 13.0 27 22.0 28 30.0 29 43.0 30 33.0 31 48.0 32 60.0 33 86.0 34 158.0 35 267.0 36 645.0 37 2492.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.625 19.75 10.825 22.8 2 26.25125125125125 24.8998998998999 30.48048048048048 18.36836836836837 3 20.02002002002002 28.07807807807808 32.13213213213213 19.76976976976977 4 23.967975981986488 35.80185138854141 22.016512384288216 18.21366024518389 5 22.2972972972973 39.13913913913914 21.77177177177177 16.79179179179179 6 20.05 38.025 23.0 18.925 7 18.925 18.8 40.025 22.25 8 21.55 24.075 27.950000000000003 26.424999999999997 9 21.475 24.425 29.299999999999997 24.8 10-14 23.12615630781539 28.401420071003553 26.786339316965847 21.68608430421521 15-19 22.90729072907291 27.787778777877786 28.76787678767877 20.537053705370536 20-24 22.795257866039716 28.327747486368864 28.267720474213398 20.60927417337802 25-29 23.09193734047345 28.31189630148641 28.131725138881936 20.4644412191582 30-34 22.21443938560064 27.983189072897385 28.778706159003352 21.023665382498624 35-39 22.685208343754688 27.837526887099195 28.677905057275776 20.79935971187034 40-44 22.503002401921538 28.1775420336269 28.447758206565254 20.87169735788631 45-49 22.889878420973634 27.773052484114675 28.333416720868566 21.003652374043128 50-54 22.61243684026214 27.375056280954524 28.650757916854268 21.36174896192906 55-59 23.153103586255188 28.189866453258638 28.309908467963783 20.347121492522383 60-64 22.99189756927078 27.348204461338398 28.39351805541662 21.26637991397419 65-69 22.640188084638087 27.862538142163974 28.56285328397779 20.934420489220148 70-74 22.8202691211045 27.807513381021458 27.84753138912511 21.524686108748938 75-79 23.268143850347624 28.229880458160356 27.90976841894663 20.59220727254539 80-84 22.55127563781891 28.369184592296147 28.049024512256125 21.030515257628814 85-89 23.024604920984196 27.885577115423082 28.220644128825768 20.869173834766954 90-94 23.311993598079425 27.96338901670501 28.123437031109333 20.601180354106233 95-99 22.81114055702785 27.77638881944097 28.366418320916047 21.04605230261513 100-104 23.27698309492848 28.363509052715813 27.853356006802038 20.506151845553667 105-109 23.704481792717086 27.37595038015206 28.26130452180872 20.658263305322127 110-114 23.36967393478696 27.450490098019603 27.955591118223644 21.224244848969796 115-119 24.429771908763506 27.836134453781515 27.686074429771907 20.048019207683073 120-124 24.398539488821086 28.2098734557095 27.699694893212623 19.691892162256792 125-129 24.939975990396157 27.696078431372552 27.220888355342137 20.143057222889155 130-134 24.65993198639728 27.110422084416886 28.210642128425683 20.019003800760153 135-139 25.140056022408963 27.43097238895558 27.651060424169664 19.777911164465785 140-144 24.571142785696424 27.24181045261315 28.092023005751436 20.095023755938985 145-149 25.01500600240096 27.721088435374146 27.230892356942775 20.033013205282113 150-151 26.078259782472806 26.115764470558823 27.51593949243655 20.290036254531817 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 3.5 26 2.5 27 5.5 28 12.5 29 18.5 30 22.5 31 26.5 32 37.0 33 46.0 34 57.5 35 75.5 36 78.0 37 100.0 38 137.0 39 161.0 40 197.0 41 229.0 42 261.0 43 274.0 44 263.0 45 260.0 46 261.5 47 242.0 48 213.5 49 201.5 50 175.0 51 133.0 52 106.5 53 96.5 54 83.5 55 61.5 56 43.5 57 29.0 58 18.0 59 18.0 60 14.5 61 7.5 62 5.0 63 3.0 64 1.5 65 1.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.075 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.045 25-29 0.095 30-34 0.065 35-39 0.045 40-44 0.08 45-49 0.065 50-54 0.055 55-59 0.034999999999999996 60-64 0.03 65-69 0.045 70-74 0.045 75-79 0.034999999999999996 80-84 0.05 85-89 0.02 90-94 0.03 95-99 0.005 100-104 0.03 105-109 0.04 110-114 0.02 115-119 0.04 120-124 0.034999999999999996 125-129 0.04 130-134 0.02 135-139 0.04 140-144 0.025 145-149 0.04 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.4284274193548387 0.8500000000000001 3 0.07560483870967742 0.22499999999999998 4 0.07560483870967742 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8875 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.7125 0.0 0.0 0.0 0.0 114-115 4.1625 0.0 0.0 0.0 0.0 116-117 4.625 0.0 0.0 0.0 0.0 118-119 5.275 0.0 0.0 0.0 0.0 120-121 5.9375 0.0 0.0 0.0 0.0 122-123 6.5625 0.0 0.0 0.0 0.0 124-125 7.1875 0.0 0.0 0.0 0.0 126-127 7.7125 0.0 0.0 0.0 0.0 128-129 8.3375 0.0 0.0 0.0 0.0 130-131 9.1125 0.0 0.0 0.0 0.0 132-133 9.725000000000001 0.0 0.0 0.0 0.0 134-135 10.3875 0.0 0.0 0.0 0.0 136-137 11.175 0.0 0.0 0.0 0.0 138-139 11.899999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGGGA 10 0.006830828 145.0 4 TATAAAA 10 0.006830828 145.0 7 CCTTGAT 10 0.006830828 145.0 1 AGTTAAG 10 0.006830828 145.0 5 >>END_MODULE Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671465 spots for SRR7170824.sra Written 671465 spots for SRR7170824.sra Read 671471 spots for SRR7170824.sra Written 671471 spots for SRR7170824.sra SRR ids: ['SRR7170824.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j_zw80z8 SRR7170824.sra spots: 13429306 blocks: [[1, 671465], [671466, 1342930], [1342931, 2014395], [2014396, 2685860], [2685861, 3357325], [3357326, 4028790], [4028791, 4700255], [4700256, 5371720], [5371721, 6043185], [6043186, 6714650], [6714651, 7386115], [7386116, 8057580], [8057581, 8729045], [8729046, 9400510], [9400511, 10071975], [10071976, 10743440], [10743441, 11414905], [11414906, 12086370], [12086371, 12757835], [12757836, 13429306]] SRR7170824 file size 4529050 SRR7170824 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170824 SRR7170824_1.fastq SRR7170824_2.fastq Input file: SRR7170824_1.fastq Paired file: SRR7170824_2.fastq trimmed: SRR7170824-trimmed-pair1.fastq, SRR7170824-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:45:21 2025 >> started Thu Feb 13 17:45:37 2025 >> done (15.993s) 13429306 read pairs processed; of these: 24537 ( 0.18%) short read pairs filtered out after trimming by size control 29775 ( 0.22%) empty read pairs filtered out after trimming by size control 13374994 (99.60%) read pairs available; of these: 9255623 (69.20%) trimmed read pairs available after processing 4119371 (30.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 10 0.00% 20 12 0.00% 21 16 0.00% 22 19 0.00% 23 16 0.00% 24 13 0.00% 25 14 0.00% 26 30 0.00% 27 23 0.00% 28 18 0.00% 29 21 0.00% 30 18 0.00% 31 18 0.00% 32 28 0.00% 33 18 0.00% 34 27 0.00% 35 20 0.00% 36 16 0.00% 37 24 0.00% 38 49 0.00% 39 37 0.00% 40 57 0.00% 41 49 0.00% 42 78 0.00% 43 55 0.00% 44 70 0.00% 45 60 0.00% 46 72 0.00% 47 73 0.00% 48 98 0.00% 49 136 0.00% 50 155 0.00% 51 166 0.00% 52 195 0.00% 53 211 0.00% 54 238 0.00% 55 290 0.00% 56 278 0.00% 57 322 0.00% 58 354 0.00% 59 457 0.00% 60 513 0.00% 61 610 0.00% 62 664 0.00% 63 732 0.01% 64 806 0.01% 65 903 0.01% 66 997 0.01% 67 1133 0.01% 68 1195 0.01% 69 1376 0.01% 70 1689 0.01% 71 1898 0.01% 72 2121 0.02% 73 2606 0.02% 74 2882 0.02% 75 3127 0.02% 76 4190 0.03% 77 4406 0.03% 78 3877 0.03% 79 4302 0.03% 80 4846 0.04% 81 5506 0.04% 82 6234 0.05% 83 7768 0.06% 84 9374 0.07% 85 9018 0.07% 86 9155 0.07% 87 9447 0.07% 88 10023 0.07% 89 10867 0.08% 90 11633 0.09% 91 12936 0.10% 92 13874 0.10% 93 15749 0.12% 94 16666 0.12% 95 17504 0.13% 96 17932 0.13% 97 18594 0.14% 98 18691 0.14% 99 19814 0.15% 100 21157 0.16% 101 22630 0.17% 102 24556 0.18% 103 26431 0.20% 104 27773 0.21% 105 29251 0.22% 106 29723 0.22% 107 29997 0.22% 108 30688 0.23% 109 31135 0.23% 110 32400 0.24% 111 34582 0.26% 112 36876 0.28% 113 38651 0.29% 114 40940 0.31% 115 42286 0.32% 116 43738 0.33% 117 43918 0.33% 118 44653 0.33% 119 44981 0.34% 120 46379 0.35% 121 48466 0.36% 122 50873 0.38% 123 54481 0.41% 124 57294 0.43% 125 59723 0.45% 126 62112 0.46% 127 63483 0.47% 128 64627 0.48% 129 66725 0.50% 130 69311 0.52% 131 71737 0.54% 132 76125 0.57% 133 81068 0.61% 134 86444 0.65% 135 92751 0.69% 136 98890 0.74% 137 105081 0.79% 138 111528 0.83% 139 118815 0.89% 140 127240 0.95% 141 139794 1.05% 142 156982 1.17% 143 178733 1.34% 144 206785 1.55% 145 245291 1.83% 146 305414 2.28% 147 401721 3.00% 148 594298 4.44% 149 1087434 8.13% 150 3360119 25.12% 151 4119371 30.80% 13374994 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=14 prefix-density=0.44 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=11.58 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.9 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=22 prefix-density=0.61 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=23 fanout-score=17.57 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=8.1 sequence=CAGCAATGGCAGC SRR7170824 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:46:22 Started mapping on | Feb 13 17:46:23 Finished on | Feb 13 17:48:06 Mapping speed, Million of reads per hour | 467.48 Number of input reads | 13374994 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 12524004 Uniquely mapped reads % | 93.64% Average mapped length | 287.29 Number of splices: Total | 11839145 Number of splices: Annotated (sjdb) | 11527380 Number of splices: GT/AG | 11601622 Number of splices: GC/AG | 183933 Number of splices: AT/AC | 6702 Number of splices: Non-canonical | 46888 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416016 % of reads mapped to multiple loci | 3.11% Number of reads mapped to too many loci | 59331 % of reads mapped to too many loci | 0.44% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 452487 452487 452487 N_multimapping 416016 416016 416016 N_noFeature 519582 12293620 639758 N_ambiguous 212570 1018 101740 UnstrandedReadsAssigned:11791852 PositiveStrandReadsAssigned:229366 NegativeStrandReadsAssigned:11782506 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170824 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170824-trimmed-pair1.fastq SRR7170824-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,374,994 reads, 11,829,291 reads pseudoaligned [quant] estimated average fragment length: 224.662 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,085 rounds 52401 SRR7170824.ke.tsv 34699 SRR7170824.se.tsv 87100 total ==> SRR7170824.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.34 982 45.2338 Potri.005G024800.1.v4.1 1035 811.338 176 17.9295 Potri.004G059700.1.v4.1 961 737.4 2 0.224173 Potri.007G009000.2.v4.1 1416 1192.34 0 0 Potri.003G141000.2.v4.1 2943 2719.34 689.878 20.9684 Potri.016G087400.1.v4.1 270 92.339 880 787.687 Potri.015G069301.1.v4.1 564 346.557 0 0 Potri.010G195200.1.v4.1 1773 1549.34 209.789 11.1916 Potri.012G127500.1.v4.1 977 753.366 123 13.4945 ==> SRR7170824.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 567 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 215 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 255 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7170824 completed mapping pipeline successfully