Starting /dee2/code/volunteer_pipeline.sh SRR7170825 current disk space = 3088705679360 free memory = 1450165784 SRR7170825 SRAfilesize 3aa5925e7828fdc255fff973723de8b4 SRR7170825.sra SRR7170825.sra file validated SRR7170825 is paired end SRR7170825 is conventional basespace SRR7170825 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.601 34.0 33.0 34.0 32.0 34.0 2 33.0395 34.0 33.0 34.0 32.0 34.0 3 33.116 34.0 33.0 34.0 32.0 34.0 4 33.1395 34.0 33.0 34.0 32.0 34.0 5 33.1335 34.0 33.0 34.0 32.0 34.0 6 36.44925 38.0 37.0 38.0 34.0 38.0 7 36.89575 38.0 38.0 38.0 35.0 38.0 8 37.09575 38.0 38.0 38.0 36.0 38.0 9 37.153 38.0 38.0 38.0 36.0 38.0 10-14 37.1142 38.0 38.0 38.0 36.0 38.0 15-19 37.03189999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.98965 38.0 38.0 38.0 35.6 38.0 25-29 36.952149999999996 38.0 38.0 38.0 35.6 38.0 30-34 36.8776 38.0 38.0 38.0 35.2 38.0 35-39 36.76519999999999 38.0 38.0 38.0 35.0 38.0 40-44 36.628550000000004 38.0 38.0 38.0 34.0 38.0 45-49 36.59195 38.0 38.0 38.0 34.0 38.0 50-54 36.393899999999995 38.0 37.4 38.0 33.6 38.0 55-59 36.242399999999996 38.0 37.0 38.0 33.4 38.0 60-64 36.244 38.0 37.0 38.0 33.2 38.0 65-69 36.11880000000001 38.0 37.0 38.0 33.0 38.0 70-74 35.967 38.0 37.0 38.0 31.8 38.0 75-79 35.7971 38.0 37.0 38.0 31.0 38.0 80-84 35.50515 38.0 36.4 38.0 29.4 38.0 85-89 35.52040000000001 38.0 36.0 38.0 29.4 38.0 90-94 35.339549999999996 38.0 36.0 38.0 29.0 38.0 95-99 35.060500000000005 38.0 35.8 38.0 28.4 38.0 100-104 34.814350000000005 38.0 35.0 38.0 26.8 38.0 105-109 34.4567 38.0 34.6 38.0 25.0 38.0 110-114 34.19885 38.0 34.0 38.0 23.4 38.0 115-119 33.80685 38.0 33.4 38.0 22.4 38.0 120-124 33.12925 37.8 32.4 38.0 17.4 38.0 125-129 32.43845 37.0 31.2 38.0 14.8 38.0 130-134 31.624599999999997 36.4 30.4 38.0 14.2 38.0 135-139 30.62715 36.0 28.6 38.0 12.8 38.0 140-144 29.4885 35.2 26.6 38.0 7.8 38.0 145-149 27.324149999999996 33.0 18.4 38.0 2.0 38.0 150-151 21.0295 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 4.0 10 1.0 11 2.0 12 0.0 13 2.0 14 1.0 15 0.0 16 3.0 17 3.0 18 8.0 19 7.0 20 7.0 21 8.0 22 21.0 23 26.0 24 23.0 25 42.0 26 44.0 27 53.0 28 69.0 29 74.0 30 100.0 31 129.0 32 185.0 33 231.0 34 383.0 35 586.0 36 1120.0 37 867.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.604373251970507 15.687770150012714 16.399694889397406 36.30816170861937 2 22.575 20.275000000000002 36.199999999999996 20.95 3 18.05 28.175 29.375 24.4 4 20.925 34.949999999999996 23.775 20.349999999999998 5 20.549999999999997 37.075 24.175 18.2 6 17.75 36.425000000000004 26.025 19.8 7 13.200000000000001 21.325 45.95 19.525000000000002 8 18.224999999999998 24.425 28.625 28.725 9 16.975 24.25 32.324999999999996 26.450000000000003 10-14 19.42 28.64 27.529999999999998 24.41 15-19 19.375 28.575 28.395 23.655 20-24 19.53 29.060000000000002 27.825 23.585 25-29 19.285 29.13 27.99 23.595 30-34 19.13 28.785 28.325 23.76 35-39 19.46 29.115000000000002 28.015 23.41 40-44 19.895 28.99 27.725 23.39 45-49 19.575 29.299999999999997 27.38 23.745 50-54 19.945 28.67 28.04 23.345 55-59 19.68 29.2 27.435 23.685000000000002 60-64 20.095 28.37 27.975 23.56 65-69 20.085 28.265 27.74 23.91 70-74 19.72 29.385 27.425 23.47 75-79 19.400000000000002 28.865000000000002 28.01 23.724999999999998 80-84 19.77 28.610000000000003 27.875 23.745 85-89 19.55 28.7 27.825 23.925 90-94 19.725 28.299999999999997 28.244999999999997 23.73 95-99 19.15 28.435 28.49 23.925 100-104 20.385 27.97 28.244999999999997 23.400000000000002 105-109 20.064999999999998 28.42 28.205000000000002 23.31 110-114 19.615 28.555000000000003 28.46 23.369999999999997 115-119 20.255000000000003 28.945 27.51 23.29 120-124 19.435 28.99 28.395 23.18 125-129 19.439999999999998 28.525 28.57 23.465 130-134 20.61 28.215 27.72 23.455000000000002 135-139 20.18 28.134999999999998 28.02 23.665 140-144 20.19 28.315 28.155 23.34 145-149 20.13 28.660000000000004 27.689999999999998 23.52 150-151 19.5875 28.3375 28.4375 23.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.0 17 1.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.5 23 3.5 24 5.0 25 3.5 26 3.5 27 7.0 28 13.5 29 19.0 30 22.0 31 32.0 32 36.5 33 51.5 34 77.5 35 87.5 36 103.5 37 119.5 38 141.0 39 165.0 40 197.0 41 233.0 42 250.5 43 278.0 44 275.5 45 255.5 46 250.0 47 235.5 48 225.0 49 200.0 50 161.5 51 135.5 52 108.5 53 84.5 54 67.0 55 43.0 56 26.0 57 20.5 58 17.0 59 12.0 60 6.5 61 6.5 62 4.5 63 1.0 64 0.5 65 2.0 66 2.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.7 0.0 0.0 0.0 0.0 128-129 0.75 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.85 0.0 0.0 0.0 0.0 136-137 0.9 0.0 0.0 0.0 0.0 138-139 0.9874999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACAGC 10 0.0068343505 144.975 2 >>END_MODULE SRR7170825 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3785 33.0 33.0 34.0 31.0 34.0 2 32.53025 33.0 33.0 34.0 31.0 34.0 3 32.5515 33.0 33.0 34.0 31.0 34.0 4 32.487 33.0 33.0 34.0 31.0 34.0 5 32.5625 33.0 33.0 34.0 31.0 34.0 6 36.596 38.0 38.0 38.0 34.0 38.0 7 36.719 38.0 38.0 38.0 35.0 38.0 8 36.588 38.0 38.0 38.0 35.0 38.0 9 36.509 38.0 38.0 38.0 34.0 38.0 10-14 36.6449 38.0 38.0 38.0 34.6 38.0 15-19 36.6625 38.0 38.0 38.0 34.8 38.0 20-24 36.545550000000006 38.0 38.0 38.0 34.2 38.0 25-29 36.437799999999996 38.0 38.0 38.0 34.0 38.0 30-34 36.3705 38.0 38.0 38.0 34.0 38.0 35-39 36.293299999999995 38.0 38.0 38.0 33.8 38.0 40-44 36.330600000000004 38.0 38.0 38.0 33.8 38.0 45-49 36.3386 38.0 38.0 38.0 33.8 38.0 50-54 36.25125 38.0 38.0 38.0 33.6 38.0 55-59 36.18345 38.0 38.0 38.0 33.4 38.0 60-64 36.1914 38.0 38.0 38.0 33.4 38.0 65-69 35.97165 38.0 37.0 38.0 32.6 38.0 70-74 35.9508 38.0 37.0 38.0 32.2 38.0 75-79 35.8508 38.0 37.0 38.0 31.4 38.0 80-84 35.73405 38.0 37.0 38.0 31.0 38.0 85-89 35.56675 38.0 37.0 38.0 30.2 38.0 90-94 35.3639 38.0 36.4 38.0 29.0 38.0 95-99 35.187200000000004 38.0 36.0 38.0 28.6 38.0 100-104 34.815400000000004 38.0 36.0 38.0 26.8 38.0 105-109 34.60105 38.0 35.4 38.0 26.6 38.0 110-114 34.32515 38.0 35.4 38.0 24.6 38.0 115-119 33.93320000000001 38.0 34.6 38.0 21.4 38.0 120-124 33.55825 38.0 34.0 38.0 17.8 38.0 125-129 33.000299999999996 38.0 33.8 38.0 15.0 38.0 130-134 32.33775 38.0 32.0 38.0 15.0 38.0 135-139 31.9957 37.8 31.2 38.0 13.4 38.0 140-144 30.718799999999998 36.4 29.4 38.0 10.2 38.0 145-149 29.062599999999996 36.0 26.4 38.0 2.0 38.0 150-151 23.230125 30.5 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 3.0 5 1.0 6 1.0 7 1.0 8 0.0 9 3.0 10 1.0 11 2.0 12 4.0 13 6.0 14 6.0 15 4.0 16 13.0 17 12.0 18 7.0 19 21.0 20 11.0 21 29.0 22 19.0 23 15.0 24 34.0 25 36.0 26 40.0 27 49.0 28 50.0 29 68.0 30 78.0 31 91.0 32 135.0 33 168.0 34 244.0 35 421.0 36 883.0 37 1535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.575 19.35 19.55 26.525 2 27.975 24.2 31.825 16.0 3 21.349999999999998 28.325 31.0 19.325 4 22.925 35.449999999999996 22.1 19.525000000000002 5 22.6 37.75 21.7 17.95 6 20.125 36.875 23.75 19.25 7 17.95 19.25 41.8 21.0 8 22.7 23.375 27.075 26.85 9 21.625 25.900000000000002 29.25 23.225 10-14 22.515 28.83 26.619999999999997 22.035 15-19 22.384999999999998 28.575 28.125 20.915 20-24 22.095000000000002 28.435 29.015 20.455000000000002 25-29 22.39 28.325 28.794999999999998 20.49 30-34 22.0 28.075 29.035 20.89 35-39 22.485 28.845 28.439999999999998 20.23 40-44 22.41 28.285 28.32 20.985 45-49 22.41 28.835 27.975 20.78 50-54 23.22 27.6 28.34 20.84 55-59 22.470000000000002 27.35 28.744999999999997 21.435000000000002 60-64 22.53 27.060000000000002 29.315 21.095 65-69 23.035 27.839999999999996 27.985 21.14 70-74 23.055 28.025 28.065 20.855 75-79 22.305 27.794999999999998 28.310000000000002 21.59 80-84 22.615 27.87 27.805000000000003 21.709999999999997 85-89 23.265 27.325 28.199999999999996 21.21 90-94 22.595000000000002 27.91 28.110000000000003 21.385 95-99 23.26 27.905 27.85 20.985 100-104 23.21 27.82 27.950000000000003 21.02 105-109 23.445 27.750000000000004 28.165000000000003 20.64 110-114 22.735 28.235 28.134999999999998 20.895 115-119 23.41 27.779999999999998 28.03 20.78 120-124 23.13 28.225 27.825 20.82 125-129 23.415 27.615000000000002 28.355000000000004 20.615 130-134 23.07 28.1 28.07 20.76 135-139 23.14 28.365000000000002 27.810000000000002 20.685000000000002 140-144 23.215 28.32 28.27 20.195 145-149 23.419999999999998 28.4 27.785 20.395 150-151 23.5 28.65 27.8625 19.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 1.0 18 0.5 19 1.0 20 1.5 21 2.0 22 2.0 23 2.5 24 3.5 25 4.0 26 6.5 27 8.5 28 10.5 29 15.0 30 22.0 31 28.0 32 27.5 33 39.0 34 60.5 35 75.0 36 92.5 37 109.0 38 137.0 39 184.5 40 217.5 41 224.5 42 245.0 43 256.5 44 261.5 45 272.0 46 251.5 47 228.0 48 215.0 49 208.0 50 176.5 51 137.0 52 106.5 53 86.5 54 76.0 55 53.5 56 39.0 57 36.5 58 25.0 59 13.0 60 9.5 61 8.5 62 7.0 63 3.0 64 2.0 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36980085707083 98.55000000000001 2 0.5041593143433325 1.0 3 0.07562389715149988 0.22499999999999998 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4625 0.0 0.0 0.0 0.0 120-121 0.5375000000000001 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.65 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.8125 0.0 0.0 0.0 0.0 132-133 0.8374999999999999 0.0 0.0 0.0 0.0 134-135 0.85 0.0 0.0 0.0 0.0 136-137 0.9125 0.0 0.0 0.0 0.0 138-139 1.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATGTA 10 0.006830828 145.0 4 >>END_MODULE Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629519 spots for SRR7170825.sra Written 629519 spots for SRR7170825.sra Read 629520 spots for SRR7170825.sra Written 629520 spots for SRR7170825.sra SRR ids: ['SRR7170825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kuvttyyl SRR7170825.sra spots: 12590381 blocks: [[1, 629519], [629520, 1259038], [1259039, 1888557], [1888558, 2518076], [2518077, 3147595], [3147596, 3777114], [3777115, 4406633], [4406634, 5036152], [5036153, 5665671], [5665672, 6295190], [6295191, 6924709], [6924710, 7554228], [7554229, 8183747], [8183748, 8813266], [8813267, 9442785], [9442786, 10072304], [10072305, 10701823], [10701824, 11331342], [11331343, 11960861], [11960862, 12590381]] SRR7170825 file size 4244766 SRR7170825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170825 SRR7170825_1.fastq SRR7170825_2.fastq Input file: SRR7170825_1.fastq Paired file: SRR7170825_2.fastq trimmed: SRR7170825-trimmed-pair1.fastq, SRR7170825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:30:02 2025 >> started Thu Feb 13 17:30:23 2025 >> done (20.548s) 12590381 read pairs processed; of these: 20698 ( 0.16%) short read pairs filtered out after trimming by size control 20126 ( 0.16%) empty read pairs filtered out after trimming by size control 12549557 (99.68%) read pairs available; of these: 8971547 (71.49%) trimmed read pairs available after processing 3578010 (28.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 4 0.00% 21 4 0.00% 22 13 0.00% 23 10 0.00% 24 8 0.00% 25 12 0.00% 26 12 0.00% 27 16 0.00% 28 8 0.00% 29 14 0.00% 30 16 0.00% 31 18 0.00% 32 21 0.00% 33 19 0.00% 34 19 0.00% 35 17 0.00% 36 22 0.00% 37 23 0.00% 38 24 0.00% 39 28 0.00% 40 23 0.00% 41 43 0.00% 42 26 0.00% 43 34 0.00% 44 28 0.00% 45 41 0.00% 46 43 0.00% 47 40 0.00% 48 51 0.00% 49 54 0.00% 50 68 0.00% 51 74 0.00% 52 61 0.00% 53 100 0.00% 54 118 0.00% 55 94 0.00% 56 126 0.00% 57 123 0.00% 58 137 0.00% 59 167 0.00% 60 177 0.00% 61 195 0.00% 62 235 0.00% 63 274 0.00% 64 265 0.00% 65 295 0.00% 66 314 0.00% 67 361 0.00% 68 410 0.00% 69 476 0.00% 70 562 0.00% 71 638 0.01% 72 727 0.01% 73 802 0.01% 74 927 0.01% 75 1017 0.01% 76 1607 0.01% 77 1501 0.01% 78 1279 0.01% 79 1367 0.01% 80 1469 0.01% 81 1672 0.01% 82 1865 0.01% 83 2169 0.02% 84 2925 0.02% 85 2864 0.02% 86 3006 0.02% 87 3386 0.03% 88 3387 0.03% 89 3514 0.03% 90 3733 0.03% 91 3956 0.03% 92 4159 0.03% 93 4170 0.03% 94 4664 0.04% 95 4872 0.04% 96 4917 0.04% 97 5293 0.04% 98 5406 0.04% 99 5867 0.05% 100 6054 0.05% 101 6536 0.05% 102 7054 0.06% 103 7760 0.06% 104 8035 0.06% 105 8633 0.07% 106 9021 0.07% 107 9609 0.08% 108 10111 0.08% 109 10900 0.09% 110 11710 0.09% 111 12730 0.10% 112 13234 0.11% 113 14269 0.11% 114 15329 0.12% 115 16589 0.13% 116 17595 0.14% 117 18775 0.15% 118 20307 0.16% 119 21767 0.17% 120 22787 0.18% 121 25180 0.20% 122 27049 0.22% 123 29192 0.23% 124 31995 0.25% 125 34482 0.27% 126 37072 0.30% 127 39821 0.32% 128 43608 0.35% 129 47161 0.38% 130 51611 0.41% 131 56108 0.45% 132 61201 0.49% 133 67828 0.54% 134 74756 0.60% 135 82477 0.66% 136 92018 0.73% 137 101926 0.81% 138 115205 0.92% 139 127128 1.01% 140 143300 1.14% 141 163174 1.30% 142 187131 1.49% 143 218273 1.74% 144 257037 2.05% 145 311457 2.48% 146 397350 3.17% 147 525711 4.19% 148 756536 6.03% 149 1251676 9.97% 150 3256773 25.95% 151 3578010 28.51% 12549557 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.70 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=23 fanout-score=41.61 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTCTGCAAATGCATCAGGATCATCAGCGAGGCCAAGTGGGTCAAA criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=21 prefix-density=0.93 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=18.83 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=5.2 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7170825 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:31:08 Started mapping on | Feb 13 17:31:09 Finished on | Feb 13 17:32:32 Mapping speed, Million of reads per hour | 544.32 Number of input reads | 12549557 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11820756 Uniquely mapped reads % | 94.19% Average mapped length | 291.94 Number of splices: Total | 11532923 Number of splices: Annotated (sjdb) | 11259445 Number of splices: GT/AG | 11317436 Number of splices: GC/AG | 177263 Number of splices: AT/AC | 6254 Number of splices: Non-canonical | 31970 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300772 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 20654 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 447945 447945 447945 N_multimapping 300772 300772 300772 N_noFeature 466299 11635351 525218 N_ambiguous 220028 778 93136 UnstrandedReadsAssigned:11134429 PositiveStrandReadsAssigned:184627 NegativeStrandReadsAssigned:11202402 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR7170825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170825-trimmed-pair1.fastq SRR7170825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,549,557 reads, 11,157,838 reads pseudoaligned [quant] estimated average fragment length: 327.11 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,115 rounds 52401 SRR7170825.ke.tsv 34699 SRR7170825.se.tsv 87100 total ==> SRR7170825.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1691.89 503 24.1497 Potri.005G024800.1.v4.1 1035 708.89 126 14.438 Potri.004G059700.1.v4.1 961 635.061 12 1.53491 Potri.007G009000.2.v4.1 1416 1089.89 0 0 Potri.003G141000.2.v4.1 2943 2616.89 405.333 12.5818 Potri.016G087400.1.v4.1 270 58.1265 612 855.25 Potri.015G069301.1.v4.1 564 254.246 0 0 Potri.010G195200.1.v4.1 1773 1446.89 15 0.842115 Potri.012G127500.1.v4.1 977 650.973 66 8.23562 ==> SRR7170825.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 524 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 245 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7170825 completed mapping pipeline successfully