Starting /dee2/code/volunteer_pipeline.sh SRR7170826 current disk space = 3088646635520 free memory = 1404866904 SRR7170826 SRAfilesize 0bb4064bd1fc7108b11110686635265e SRR7170826.sra SRR7170826.sra file validated SRR7170826 is paired end SRR7170826 is conventional basespace SRR7170826 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.007 34.0 33.0 34.0 33.0 34.0 2 33.28825 34.0 33.0 34.0 33.0 34.0 3 33.27275 34.0 33.0 34.0 33.0 34.0 4 33.20575 34.0 33.0 34.0 33.0 34.0 5 33.29325 34.0 33.0 34.0 33.0 34.0 6 36.798 38.0 37.0 38.0 35.0 38.0 7 37.149 38.0 38.0 38.0 36.0 38.0 8 37.3155 38.0 38.0 38.0 37.0 38.0 9 37.30975 38.0 38.0 38.0 37.0 38.0 10-14 37.37820000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.3472 38.0 38.0 38.0 37.0 38.0 20-24 37.275800000000004 38.0 38.0 38.0 36.6 38.0 25-29 37.294799999999995 38.0 38.0 38.0 36.6 38.0 30-34 37.2236 38.0 38.0 38.0 36.6 38.0 35-39 37.15895 38.0 38.0 38.0 36.0 38.0 40-44 37.0538 38.0 38.0 38.0 35.8 38.0 45-49 36.9336 38.0 38.0 38.0 35.8 38.0 50-54 36.80114999999999 38.0 38.0 38.0 35.0 38.0 55-59 36.71405 38.0 38.0 38.0 34.8 38.0 60-64 36.726749999999996 38.0 38.0 38.0 34.6 38.0 65-69 36.626 38.0 38.0 38.0 34.2 38.0 70-74 36.5685 38.0 38.0 38.0 34.0 38.0 75-79 36.29595 38.0 38.0 38.0 34.0 38.0 80-84 36.061699999999995 38.0 37.4 38.0 33.0 38.0 85-89 35.9773 38.0 37.2 38.0 32.8 38.0 90-94 35.87505 38.0 37.0 38.0 33.0 38.0 95-99 35.6877 38.0 37.0 38.0 31.4 38.0 100-104 35.61445 38.0 36.8 38.0 30.6 38.0 105-109 35.29934999999999 38.0 36.2 38.0 29.4 38.0 110-114 35.0238 38.0 36.0 38.0 28.2 38.0 115-119 34.64455 38.0 35.0 38.0 26.0 38.0 120-124 34.28105000000001 38.0 34.2 38.0 24.8 38.0 125-129 34.031499999999994 38.0 33.6 38.0 24.0 38.0 130-134 33.3564 38.0 33.0 38.0 20.8 38.0 135-139 32.661 38.0 32.8 38.0 14.8 38.0 140-144 31.802549999999997 37.8 31.0 38.0 13.2 38.0 145-149 30.810399999999998 37.2 30.2 38.0 7.8 38.0 150-151 24.45275 31.0 14.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 2.0 15 6.0 16 2.0 17 5.0 18 9.0 19 21.0 20 9.0 21 6.0 22 9.0 23 15.0 24 16.0 25 28.0 26 23.0 27 21.0 28 50.0 29 45.0 30 65.0 31 79.0 32 119.0 33 151.0 34 223.0 35 425.0 36 1014.0 37 1652.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.31447335185653 16.36776963879768 10.431927254357161 27.885829754988634 2 20.775 19.875 34.449999999999996 24.9 3 18.125 27.200000000000003 30.125 24.55 4 20.775 32.75 25.825 20.65 5 19.975 36.05 25.25 18.725 6 17.95 36.725 25.3 20.025000000000002 7 13.15 24.349999999999998 43.1 19.400000000000002 8 17.299999999999997 24.875 30.625000000000004 27.200000000000003 9 18.325 24.125 31.225 26.325 10-14 20.355 29.815 26.295 23.535 15-19 19.985 29.104999999999997 27.655 23.255 20-24 19.5 28.965000000000003 28.01 23.525 25-29 19.325 29.515 27.66 23.5 30-34 19.34 28.810000000000002 28.18 23.669999999999998 35-39 19.735 29.005 27.36 23.9 40-44 20.17600880044002 29.51147557377869 27.646382319115958 22.666133306665333 45-49 20.375 29.104999999999997 27.35 23.169999999999998 50-54 20.105 28.449999999999996 27.939999999999998 23.505000000000003 55-59 19.59 28.78 27.765 23.865 60-64 19.98 28.410000000000004 28.37 23.24 65-69 19.77 30.2 26.31 23.72 70-74 20.125 29.975 26.685 23.215 75-79 19.985 29.575000000000003 27.495000000000005 22.945 80-84 20.1 28.884999999999998 27.800000000000004 23.215 85-89 20.445 28.9 27.095000000000002 23.56 90-94 20.125 28.560000000000002 27.48 23.835 95-99 20.04 29.15 27.439999999999998 23.369999999999997 100-104 20.435 28.465 27.115000000000002 23.985 105-109 20.285 28.415000000000003 26.97 24.33 110-114 20.62 29.03 26.669999999999998 23.68 115-119 20.669999999999998 29.385 26.290000000000003 23.655 120-124 20.945 29.104999999999997 26.295 23.655 125-129 20.65809871480722 28.604290643596542 26.073911086663 24.663699554933242 130-134 21.132113211321133 28.717871787178716 26.302630263026305 23.84738473847385 135-139 20.685171292823206 28.457114278569644 26.241560390097522 24.616154038509627 140-144 21.09210921092109 28.862886288628864 25.597559755975595 24.44744474447445 145-149 21.04605230261513 28.266413320666032 25.801290064503224 24.88624431221561 150-151 20.577572196524567 28.041005125640705 26.328291036379547 25.053131641455185 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 1.5 23 2.5 24 3.5 25 5.5 26 11.5 27 11.0 28 16.5 29 20.0 30 23.0 31 35.0 32 50.0 33 68.5 34 78.0 35 87.0 36 104.0 37 126.5 38 145.5 39 166.5 40 184.0 41 202.0 42 235.0 43 239.5 44 245.0 45 260.0 46 241.5 47 219.5 48 212.0 49 188.5 50 161.5 51 140.0 52 117.5 53 97.0 54 70.5 55 52.5 56 45.5 57 41.0 58 25.5 59 16.5 60 13.0 61 8.5 62 7.0 63 4.0 64 2.0 65 1.0 66 0.5 67 1.5 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.015 130-134 0.01 135-139 0.025 140-144 0.01 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.87611749680715 96.775 2 0.8684546615581098 1.7000000000000002 3 0.15325670498084293 0.44999999999999996 4 0.02554278416347382 0.1 5 0.0 0.0 6 0.05108556832694764 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02554278416347382 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 27 0.675 TruSeq Adapter, Index 6 (97% over 36bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 6 0.15 No Hit ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTATG 6 0.15 TruSeq Adapter, Index 6 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.65 0.0 0.0 0.0 0.0 86-87 0.7875000000000001 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.375 0.0 0.0 0.0 0.0 96-97 1.7625000000000002 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.2 0.0 0.0 0.0 0.0 102-103 2.625 0.0 0.0 0.0 0.0 104-105 2.95 0.0 0.0 0.0 0.0 106-107 3.4125 0.0 0.0 0.0 0.0 108-109 3.9625 0.0 0.0 0.0 0.0 110-111 4.425000000000001 0.0 0.0 0.0 0.0 112-113 4.9 0.0 0.0 0.0 0.0 114-115 5.3875 0.0 0.0 0.0 0.0 116-117 5.975 0.0 0.0 0.0 0.0 118-119 6.6875 0.0 0.0 0.0 0.0 120-121 7.5625 0.0 0.0 0.0 0.0 122-123 8.1875 0.0 0.0 0.0 0.0 124-125 8.8375 0.0 0.0 0.0 0.0 126-127 9.35 0.0 0.0 0.0 0.0 128-129 10.037500000000001 0.0 0.0 0.0 0.0 130-131 10.575 0.0 0.0 0.0 0.0 132-133 11.25 0.0 0.0 0.0 0.0 134-135 11.975 0.0 0.0 0.0 0.0 136-137 12.675 0.0 0.0 0.0 0.0 138-139 13.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTATT 10 0.006832588 144.9875 8 >>END_MODULE SRR7170826 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78325 33.0 33.0 34.0 32.0 34.0 2 32.859 33.0 33.0 34.0 32.0 34.0 3 32.8475 34.0 33.0 34.0 32.0 34.0 4 32.81575 34.0 33.0 34.0 32.0 34.0 5 32.8475 34.0 33.0 34.0 32.0 34.0 6 37.01675 38.0 38.0 38.0 37.0 38.0 7 37.026 38.0 38.0 38.0 37.0 38.0 8 37.03925 38.0 38.0 38.0 37.0 38.0 9 36.934 38.0 38.0 38.0 37.0 38.0 10-14 36.962450000000004 38.0 38.0 38.0 37.0 38.0 15-19 36.880849999999995 38.0 38.0 38.0 36.6 38.0 20-24 36.89325 38.0 38.0 38.0 36.4 38.0 25-29 36.84905 38.0 38.0 38.0 36.2 38.0 30-34 36.78404999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.7155 38.0 38.0 38.0 35.8 38.0 40-44 36.7382 38.0 38.0 38.0 36.0 38.0 45-49 36.691199999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.650600000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.54455 38.0 38.0 38.0 35.6 38.0 60-64 36.50735000000001 38.0 38.0 38.0 35.0 38.0 65-69 36.49745 38.0 38.0 38.0 35.0 38.0 70-74 36.463550000000005 38.0 38.0 38.0 34.8 38.0 75-79 36.3318 38.0 38.0 38.0 34.0 38.0 80-84 35.99675 38.0 38.0 38.0 34.0 38.0 85-89 35.89005 38.0 38.0 38.0 33.2 38.0 90-94 35.61555 38.0 38.0 38.0 31.8 38.0 95-99 35.560249999999996 38.0 37.4 38.0 31.4 38.0 100-104 35.391650000000006 38.0 37.0 38.0 31.0 38.0 105-109 35.3525 38.0 37.0 38.0 30.6 38.0 110-114 35.13674999999999 38.0 37.0 38.0 29.2 38.0 115-119 34.78 38.0 36.0 38.0 27.6 38.0 120-124 34.58525 38.0 35.8 38.0 25.8 38.0 125-129 34.21335 38.0 35.4 38.0 23.4 38.0 130-134 33.751349999999995 38.0 33.8 38.0 20.6 38.0 135-139 33.1958 38.0 33.0 38.0 18.0 38.0 140-144 32.323449999999994 38.0 33.0 38.0 13.0 38.0 145-149 31.37945 38.0 32.6 38.0 6.0 38.0 150-151 25.74675 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 9.0 4 1.0 5 4.0 6 1.0 7 2.0 8 2.0 9 4.0 10 2.0 11 4.0 12 5.0 13 5.0 14 5.0 15 1.0 16 4.0 17 6.0 18 8.0 19 14.0 20 29.0 21 10.0 22 19.0 23 15.0 24 21.0 25 16.0 26 20.0 27 27.0 28 28.0 29 24.0 30 52.0 31 78.0 32 68.0 33 110.0 34 182.0 35 277.0 36 691.0 37 2239.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.85 22.45 12.325 19.375 2 28.071053289967473 22.71703777833375 30.873154866149612 18.33875406554916 3 21.04078058543908 26.444833625218916 33.149862396797594 19.36452339254441 4 23.667750813109834 34.450838128596445 23.01726294721041 18.864148111083313 5 24.568426319739807 35.92694520890668 21.841381035776834 17.663247435576682 6 20.41531148361271 38.1285964473355 23.667750813109834 17.788341255941955 7 19.139354515886914 19.41456092069052 40.15511633725294 21.290968226169625 8 20.26519889917438 25.519139354515886 27.1703777833375 27.045283962972228 9 21.51613710282712 25.369026770077557 29.522141606204656 23.592694520890667 10-14 23.70778083562672 28.491368526394794 26.32974731048286 21.471103327495623 15-19 23.062296722541905 27.88091068301226 27.815861896422316 21.240930698023515 20-24 23.122341756317237 28.32124093069802 28.116087065298974 20.440330247685765 25-29 23.284792073262274 27.823650102587198 28.39413501476255 20.49742280938798 30-34 23.02727045283963 27.575681761320993 28.631473605203904 20.765574180635475 35-39 22.776192621514742 28.12734644841568 28.68799118986835 20.408469740201234 40-44 22.798938885830122 27.879273236898744 28.13454126833175 21.187246608939386 45-49 22.636504679445473 27.71633051398829 28.86241929833342 20.78474550823282 50-54 22.98183274110405 27.471097542665536 28.897452579950954 20.649617136279467 55-59 23.087705246295553 27.678213856627952 28.308970764917902 20.92511013215859 60-64 23.121965867574197 27.115759971973375 28.57214353635954 21.190130624092888 65-69 22.793933630311827 27.418789729215675 28.569998498423345 21.21727814204915 70-74 23.297132275661877 28.011611030478957 27.70632100495471 20.98493568890446 75-79 22.88674240528502 28.542115009258794 27.68129723237075 20.88984535308543 80-84 23.424911174498323 28.44918180453385 27.64850122604214 20.477405794925687 85-89 23.517638228671505 27.905929447085313 28.20115086314736 20.37528146109582 90-94 23.682234569755217 28.00220253291285 28.092306152074887 20.223256745257046 95-99 23.304469693177836 28.29971470043546 27.884278492417035 20.51153711396967 100-104 24.08269509936427 27.611753516544024 27.77694348500776 20.528607899083948 105-109 24.454454454454456 27.56756756756757 27.66266266266266 20.315315315315317 110-114 24.197666850247835 28.493466179342114 27.28683723026085 20.022029740149204 115-119 24.718426190118635 28.42268608900235 27.206287230314864 19.652600490564147 120-124 24.794753704445334 28.659391269523425 26.812174609531436 19.733680416499798 125-129 24.99624530663329 28.846057571964955 26.888610763454317 19.269086357947433 130-134 25.311577156013815 27.654036738575506 27.54392111717303 19.490464988237648 135-139 25.74589507408891 27.503003604325187 27.11754104925911 19.633560272326793 140-144 26.073681049154068 28.211032135348884 27.079787766543195 18.63549904895385 145-149 25.699414443721537 28.166758420499477 26.76542715579801 19.368399979980982 150-151 27.583187390542907 26.21966474856142 26.8951713785339 19.30197648236177 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.0 19 0.0 20 1.5 21 2.0 22 1.5 23 2.0 24 1.5 25 2.0 26 4.0 27 6.5 28 10.0 29 12.5 30 17.5 31 27.0 32 37.0 33 42.5 34 51.0 35 66.0 36 81.0 37 111.5 38 136.0 39 163.5 40 210.5 41 233.0 42 235.5 43 248.0 44 262.0 45 268.5 46 263.0 47 244.0 48 217.0 49 186.0 50 166.5 51 142.5 52 119.5 53 104.5 54 88.0 55 69.5 56 48.0 57 30.5 58 22.5 59 20.5 60 13.5 61 8.5 62 5.5 63 3.0 64 3.0 65 2.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.075 20-24 0.075 25-29 0.08499999999999999 30-34 0.075 35-39 0.11499999999999999 40-44 0.105 45-49 0.095 50-54 0.095 55-59 0.12 60-64 0.095 65-69 0.105 70-74 0.095 75-79 0.095 80-84 0.08499999999999999 85-89 0.075 90-94 0.11499999999999999 95-99 0.105 100-104 0.11499999999999999 105-109 0.1 110-114 0.135 115-119 0.11499999999999999 120-124 0.12 125-129 0.125 130-134 0.105 135-139 0.12 140-144 0.11 145-149 0.095 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.79641485275287 96.45 2 0.8962868117797695 1.7500000000000002 3 0.1792573623559539 0.525 4 0.05121638924455826 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.05121638924455826 0.4 9 0.0 0.0 >10 0.02560819462227913 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 27 0.675 Illumina Single End PCR Primer 1 (96% over 32bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.85 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.15 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 1.975 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.7 0.0 0.0 0.0 0.0 104-105 3.0250000000000004 0.0 0.0 0.0 0.0 106-107 3.5125 0.0 0.0 0.0 0.0 108-109 4.0 0.0 0.0 0.0 0.0 110-111 4.4625 0.0 0.0 0.0 0.0 112-113 4.925 0.0 0.0 0.0 0.0 114-115 5.4 0.0 0.0 0.0 0.0 116-117 5.9125 0.0 0.0 0.0 0.0 118-119 6.6375 0.0 0.0 0.0 0.0 120-121 7.5375 0.0 0.0 0.0 0.0 122-123 8.1375 0.0 0.0 0.0 0.0 124-125 8.7875 0.0 0.0 0.0 0.0 126-127 9.3875 0.0 0.0 0.0 0.0 128-129 10.1375 0.0 0.0 0.0 0.0 130-131 10.6875 0.0 0.0 0.0 0.0 132-133 11.3625 0.0 0.0 0.0 0.0 134-135 12.1125 0.0 0.0 0.0 0.0 136-137 12.775 0.0 0.0 0.0 0.0 138-139 13.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGAAAT 10 0.006830828 145.0 1 GGGGGGG 40 0.0076550315 18.125 130-134 >>END_MODULE Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746780 spots for SRR7170826.sra Written 746780 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra Read 746776 spots for SRR7170826.sra Written 746776 spots for SRR7170826.sra SRR ids: ['SRR7170826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ry_l079x SRR7170826.sra spots: 14935524 blocks: [[1, 746776], [746777, 1493552], [1493553, 2240328], [2240329, 2987104], [2987105, 3733880], [3733881, 4480656], [4480657, 5227432], [5227433, 5974208], [5974209, 6720984], [6720985, 7467760], [7467761, 8214536], [8214537, 8961312], [8961313, 9708088], [9708089, 10454864], [10454865, 11201640], [11201641, 11948416], [11948417, 12695192], [12695193, 13441968], [13441969, 14188744], [14188745, 14935524]] SRR7170826 file size 5039458 SRR7170826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170826 SRR7170826_1.fastq SRR7170826_2.fastq Input file: SRR7170826_1.fastq Paired file: SRR7170826_2.fastq trimmed: SRR7170826-trimmed-pair1.fastq, SRR7170826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:28:36 2025 >> started Thu Feb 13 17:28:58 2025 >> done (21.812s) 14935524 read pairs processed; of these: 33072 ( 0.22%) short read pairs filtered out after trimming by size control 102294 ( 0.68%) empty read pairs filtered out after trimming by size control 14800158 (99.09%) read pairs available; of these: 10689578 (72.23%) trimmed read pairs available after processing 4110580 (27.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 15 0.00% 20 24 0.00% 21 10 0.00% 22 25 0.00% 23 34 0.00% 24 35 0.00% 25 38 0.00% 26 32 0.00% 27 37 0.00% 28 42 0.00% 29 29 0.00% 30 24 0.00% 31 48 0.00% 32 40 0.00% 33 33 0.00% 34 30 0.00% 35 40 0.00% 36 43 0.00% 37 48 0.00% 38 66 0.00% 39 74 0.00% 40 70 0.00% 41 76 0.00% 42 93 0.00% 43 96 0.00% 44 93 0.00% 45 116 0.00% 46 133 0.00% 47 173 0.00% 48 191 0.00% 49 227 0.00% 50 258 0.00% 51 306 0.00% 52 342 0.00% 53 323 0.00% 54 374 0.00% 55 438 0.00% 56 470 0.00% 57 560 0.00% 58 624 0.00% 59 725 0.00% 60 839 0.01% 61 967 0.01% 62 1108 0.01% 63 1099 0.01% 64 1318 0.01% 65 1463 0.01% 66 1571 0.01% 67 1718 0.01% 68 1854 0.01% 69 2142 0.01% 70 2526 0.02% 71 3022 0.02% 72 3717 0.03% 73 4191 0.03% 74 4523 0.03% 75 5634 0.04% 76 9801 0.07% 77 10602 0.07% 78 7269 0.05% 79 7073 0.05% 80 7622 0.05% 81 8767 0.06% 82 9908 0.07% 83 11523 0.08% 84 13961 0.09% 85 14078 0.10% 86 14985 0.10% 87 15749 0.11% 88 16478 0.11% 89 17095 0.12% 90 18315 0.12% 91 19590 0.13% 92 21437 0.14% 93 23464 0.16% 94 25099 0.17% 95 26300 0.18% 96 26986 0.18% 97 27061 0.18% 98 27653 0.19% 99 28870 0.20% 100 30160 0.20% 101 32112 0.22% 102 34949 0.24% 103 37217 0.25% 104 39157 0.26% 105 41028 0.28% 106 41993 0.28% 107 42239 0.29% 108 42014 0.28% 109 43319 0.29% 110 44078 0.30% 111 46337 0.31% 112 48976 0.33% 113 52010 0.35% 114 54644 0.37% 115 57143 0.39% 116 58304 0.39% 117 58981 0.40% 118 59453 0.40% 119 59793 0.40% 120 61690 0.42% 121 64600 0.44% 122 66777 0.45% 123 70216 0.47% 124 74319 0.50% 125 77746 0.53% 126 79918 0.54% 127 81319 0.55% 128 83546 0.56% 129 85514 0.58% 130 88055 0.59% 131 91160 0.62% 132 96488 0.65% 133 102441 0.69% 134 108314 0.73% 135 115977 0.78% 136 121728 0.82% 137 129657 0.88% 138 137313 0.93% 139 145952 0.99% 140 153822 1.04% 141 167786 1.13% 142 184836 1.25% 143 208102 1.41% 144 239938 1.62% 145 279628 1.89% 146 345069 2.33% 147 449334 3.04% 148 657166 4.44% 149 1178070 7.96% 150 3565341 24.09% 151 4110580 27.77% 14800158 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=26 prefix-density=0.55 prefix-fanout=2.1 sequence=TACGCTTGTAAGGATT criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=30.96 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=10.8 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=8.08 fanout-score-rank=12 prefix-density=0.49 prefix-fanout=5.5 sequence=AGAAGCAAGCAAAGTTGAGTACTGCTTAAAAGTATGGAGAGCTATACTACTATCTTTATCAATATGTAAAATGATCAGAACTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=61.17 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170826 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:29:41 Started mapping on | Feb 13 17:29:41 Finished on | Feb 13 17:31:52 Mapping speed, Million of reads per hour | 406.72 Number of input reads | 14800158 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 13753917 Uniquely mapped reads % | 92.93% Average mapped length | 284.67 Number of splices: Total | 12756323 Number of splices: Annotated (sjdb) | 12443108 Number of splices: GT/AG | 12517913 Number of splices: GC/AG | 177394 Number of splices: AT/AC | 9576 Number of splices: Non-canonical | 51440 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409755 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 16616 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.15% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 666633 666633 666633 N_multimapping 409755 409755 409755 N_noFeature 460084 13440104 585774 N_ambiguous 296705 1080 107953 UnstrandedReadsAssigned:12997128 PositiveStrandReadsAssigned:312733 NegativeStrandReadsAssigned:13060190 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170826-trimmed-pair1.fastq SRR7170826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,800,158 reads, 13,033,513 reads pseudoaligned [quant] estimated average fragment length: 216.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7170826.ke.tsv 34699 SRR7170826.se.tsv 87100 total ==> SRR7170826.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1802.61 922 29.8731 Potri.005G024800.1.v4.1 1035 819.606 497 35.4161 Potri.004G059700.1.v4.1 961 745.629 7 0.548309 Potri.007G009000.2.v4.1 1416 1200.61 0 0 Potri.003G141000.2.v4.1 2943 2727.61 595 12.7405 Potri.016G087400.1.v4.1 270 97.2125 1870 1123.49 Potri.015G069301.1.v4.1 564 353.448 0 0 Potri.010G195200.1.v4.1 1773 1557.61 437 16.386 Potri.012G127500.1.v4.1 977 761.62 164 12.5764 ==> SRR7170826.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 382 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 17 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 54 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR7170826 completed mapping pipeline successfully