Starting /dee2/code/volunteer_pipeline.sh SRR7170827 current disk space = 3088664043520 free memory = 1496447596 SRR7170827 SRAfilesize 852e643d9c9a166ef575d97b423aad29 SRR7170827.sra SRR7170827.sra file validated SRR7170827 is paired end SRR7170827 is conventional basespace SRR7170827 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2955 34.0 33.0 34.0 32.0 34.0 2 33.2685 34.0 33.0 34.0 32.0 34.0 3 33.28 34.0 34.0 34.0 31.0 34.0 4 33.425 34.0 34.0 34.0 33.0 34.0 5 33.44225 34.0 33.0 34.0 33.0 34.0 6 37.09525 38.0 37.0 38.0 36.0 38.0 7 37.378 38.0 38.0 38.0 37.0 38.0 8 37.48375 38.0 38.0 38.0 37.0 38.0 9 37.52475 38.0 38.0 38.0 38.0 38.0 10-14 37.52805 38.0 38.0 38.0 38.0 38.0 15-19 37.504 38.0 38.0 38.0 38.0 38.0 20-24 37.47025 38.0 38.0 38.0 37.6 38.0 25-29 37.42614999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.38905 38.0 38.0 38.0 37.0 38.0 35-39 37.346700000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.267 38.0 38.0 38.0 37.0 38.0 45-49 37.25885 38.0 38.0 38.0 37.0 38.0 50-54 37.1708 38.0 38.0 38.0 36.6 38.0 55-59 37.1143 38.0 38.0 38.0 36.0 38.0 60-64 37.0071 38.0 38.0 38.0 36.0 38.0 65-69 37.053399999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.92625 38.0 38.0 38.0 35.6 38.0 75-79 36.6221 38.0 38.0 38.0 35.0 38.0 80-84 36.49495 38.0 38.0 38.0 34.8 38.0 85-89 36.292649999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.1192 38.0 38.0 38.0 33.8 38.0 95-99 35.99435 38.0 38.0 38.0 33.0 38.0 100-104 35.9239 38.0 37.0 38.0 33.4 38.0 105-109 35.878 38.0 37.2 38.0 32.8 38.0 110-114 35.75065 38.0 37.0 38.0 32.2 38.0 115-119 35.41575 38.0 36.6 38.0 31.0 38.0 120-124 35.2358 38.0 36.2 38.0 28.8 38.0 125-129 34.95065 38.0 36.0 38.0 28.0 38.0 130-134 34.554700000000004 38.0 35.0 38.0 26.8 38.0 135-139 34.07155 38.0 34.6 38.0 23.0 38.0 140-144 33.6235 38.0 33.0 38.0 22.6 38.0 145-149 32.835699999999996 38.0 33.0 38.0 16.6 38.0 150-151 28.221625000000003 34.5 17.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 3.0 12 2.0 13 2.0 14 2.0 15 2.0 16 5.0 17 5.0 18 7.0 19 23.0 20 7.0 21 6.0 22 7.0 23 4.0 24 11.0 25 11.0 26 14.0 27 28.0 28 30.0 29 42.0 30 44.0 31 49.0 32 64.0 33 105.0 34 153.0 35 300.0 36 738.0 37 2334.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.11284046692607 15.90142671854734 10.972762645914397 30.012970168612192 2 20.45 19.825 35.5 24.224999999999998 3 17.4 28.599999999999998 29.4 24.6 4 22.275 33.725 22.825 21.175 5 21.2 37.05 23.849999999999998 17.9 6 17.424999999999997 35.875 25.525 21.175 7 13.900000000000002 24.45 44.0 17.65 8 17.75 23.599999999999998 31.75 26.900000000000002 9 17.7 23.575 31.724999999999998 27.0 10-14 19.85 28.67 27.485 23.995 15-19 19.725 27.950000000000003 29.220000000000002 23.105 20-24 19.655 28.845 27.994999999999997 23.505000000000003 25-29 19.48 29.315 27.96 23.244999999999997 30-34 19.81 29.104999999999997 27.794999999999998 23.29 35-39 19.87198719871987 28.537853785378537 28.312831283128315 23.27732773277328 40-44 19.165 28.7 28.110000000000003 24.025 45-49 20.207020702070206 28.412841284128415 27.642764276427645 23.737373737373737 50-54 19.915 27.975 28.294999999999998 23.815 55-59 19.54 28.634999999999998 28.4 23.425 60-64 19.75 28.775000000000002 28.384999999999998 23.09 65-69 19.509999999999998 29.315 27.51 23.665 70-74 20.035 29.635 27.355 22.975 75-79 19.67 29.299999999999997 28.175 22.855 80-84 20.025000000000002 28.725 27.915 23.335 85-89 20.07 29.29 27.605 23.035 90-94 20.424999999999997 28.93 27.425 23.22 95-99 19.905 29.09 27.560000000000002 23.445 100-104 20.515 29.134999999999998 27.200000000000003 23.150000000000002 105-109 20.005 29.21 27.435 23.35 110-114 20.235 29.165000000000003 27.365000000000002 23.235 115-119 20.125 28.865000000000002 27.22 23.79 120-124 20.169999999999998 29.68 26.674999999999997 23.474999999999998 125-129 21.175 28.46 26.345000000000002 24.02 130-134 20.895 27.825 27.169999999999998 24.11 135-139 21.04 28.744999999999997 26.19 24.025 140-144 20.59 28.139999999999997 27.185 24.085 145-149 20.735 28.355000000000004 26.529999999999998 24.38 150-151 21.099999999999998 27.537499999999998 27.150000000000002 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 2.0 21 1.0 22 1.5 23 2.5 24 3.0 25 5.5 26 7.0 27 12.0 28 16.0 29 17.5 30 24.5 31 31.5 32 41.5 33 55.0 34 68.0 35 87.5 36 113.5 37 144.5 38 146.5 39 160.0 40 209.0 41 235.5 42 254.5 43 254.0 44 245.0 45 247.5 46 247.0 47 240.0 48 223.0 49 193.0 50 151.5 51 111.0 52 94.5 53 83.0 54 61.5 55 52.5 56 46.0 57 34.5 58 25.0 59 18.0 60 9.5 61 3.5 62 1.0 63 3.0 64 2.5 65 1.0 66 1.0 67 1.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36628643852978 98.0 2 0.5069708491761723 1.0 3 0.050697084917617236 0.15 4 0.0 0.0 5 0.025348542458808618 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025348542458808618 0.2 9 0.0 0.0 >10 0.025348542458808618 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 21 0.525 TruSeq Adapter, Index 8 (97% over 36bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTATG 8 0.2 TruSeq Adapter, Index 8 (97% over 35bp) GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.5125 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 1.1125 0.0 0.0 0.0 0.0 90-91 1.2625000000000002 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.8250000000000002 0.0 0.0 0.0 0.0 96-97 2.2249999999999996 0.0 0.0 0.0 0.0 98-99 2.5 0.0 0.0 0.0 0.0 100-101 2.875 0.0 0.0 0.0 0.0 102-103 3.1375 0.0 0.0 0.0 0.0 104-105 3.575 0.0 0.0 0.0 0.0 106-107 4.025 0.0 0.0 0.0 0.0 108-109 4.5 0.0 0.0 0.0 0.0 110-111 4.975 0.0 0.0 0.0 0.0 112-113 5.425000000000001 0.0 0.0 0.0 0.0 114-115 6.025 0.0 0.0 0.0 0.0 116-117 6.775 0.0 0.0 0.0 0.0 118-119 7.4 0.0 0.0 0.0 0.0 120-121 7.9625 0.0 0.0 0.0 0.0 122-123 8.3625 0.0 0.0 0.0 0.0 124-125 8.8875 0.0 0.0 0.0 0.0 126-127 9.575 0.0 0.0 0.0 0.0 128-129 10.1375 0.0 0.0 0.0 0.0 130-131 10.8875 0.0 0.0 0.0 0.0 132-133 11.524999999999999 0.0 0.0 0.0 0.0 134-135 12.1625 0.0 0.0 0.0 0.0 136-137 12.7 0.0 0.0 0.0 0.0 138-139 13.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTCATA 10 0.0068343505 144.975 7 TTCATAT 10 0.0068343505 144.975 8 TAAACAA 10 0.0068343505 144.975 9 CAACTTC 10 0.0068343505 144.975 4 ACTTCAT 10 0.0068343505 144.975 6 AAGCCTC 10 0.0068343505 144.975 5 ATCTGCC 10 0.0068343505 144.975 145 TCATATA 10 0.0068343505 144.975 9 >>END_MODULE SRR7170827 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9955 33.0 33.0 34.0 32.0 34.0 2 33.07675 34.0 33.0 34.0 32.0 34.0 3 33.04125 34.0 33.0 34.0 33.0 34.0 4 32.9975 34.0 33.0 34.0 33.0 34.0 5 32.98125 34.0 33.0 34.0 33.0 34.0 6 37.1445 38.0 38.0 38.0 37.0 38.0 7 37.16925 38.0 38.0 38.0 37.0 38.0 8 37.12675 38.0 38.0 38.0 37.0 38.0 9 37.11825 38.0 38.0 38.0 37.0 38.0 10-14 37.12225 38.0 38.0 38.0 37.0 38.0 15-19 37.1657 38.0 38.0 38.0 37.0 38.0 20-24 37.08135 38.0 38.0 38.0 37.0 38.0 25-29 37.07555 38.0 38.0 38.0 37.0 38.0 30-34 37.072649999999996 38.0 38.0 38.0 37.0 38.0 35-39 36.963350000000005 38.0 38.0 38.0 37.0 38.0 40-44 36.968 38.0 38.0 38.0 37.0 38.0 45-49 36.956999999999994 38.0 38.0 38.0 37.0 38.0 50-54 36.89125 38.0 38.0 38.0 37.0 38.0 55-59 36.8345 38.0 38.0 38.0 36.8 38.0 60-64 36.8082 38.0 38.0 38.0 36.4 38.0 65-69 36.719249999999995 38.0 38.0 38.0 36.2 38.0 70-74 36.695899999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.69615 38.0 38.0 38.0 36.0 38.0 80-84 36.31195 38.0 38.0 38.0 35.2 38.0 85-89 36.2462 38.0 38.0 38.0 35.0 38.0 90-94 36.1588 38.0 38.0 38.0 34.4 38.0 95-99 36.0205 38.0 38.0 38.0 34.0 38.0 100-104 35.952099999999994 38.0 38.0 38.0 34.0 38.0 105-109 35.8138 38.0 38.0 38.0 33.6 38.0 110-114 35.66875 38.0 38.0 38.0 33.2 38.0 115-119 35.528650000000006 38.0 38.0 38.0 32.2 38.0 120-124 35.30555 38.0 37.2 38.0 31.4 38.0 125-129 34.8986 38.0 36.4 38.0 28.0 38.0 130-134 34.49915 38.0 35.8 38.0 26.2 38.0 135-139 33.85765 38.0 34.4 38.0 21.6 38.0 140-144 33.2376 38.0 33.0 38.0 17.4 38.0 145-149 32.4998 38.0 33.0 38.0 10.8 38.0 150-151 27.777625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 3.0 5 3.0 6 4.0 7 2.0 8 2.0 9 3.0 10 3.0 11 5.0 12 7.0 13 5.0 14 4.0 15 3.0 16 4.0 17 2.0 18 9.0 19 14.0 20 22.0 21 10.0 22 11.0 23 7.0 24 21.0 25 12.0 26 21.0 27 19.0 28 22.0 29 34.0 30 37.0 31 60.0 32 64.0 33 75.0 34 91.0 35 208.0 36 515.0 37 2684.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.875 17.849999999999998 14.025000000000002 21.25 2 24.875 23.75 32.025 19.35 3 20.275000000000002 26.775 33.95 19.0 4 24.875 34.275 21.825 19.025 5 25.025 36.825 22.075 16.075 6 20.549999999999997 35.875 25.3 18.275 7 19.025 20.225 39.925 20.825 8 21.05 24.675 28.799999999999997 25.474999999999998 9 21.8 25.575 29.95 22.675 10-14 23.485 28.57 26.91 21.035 15-19 22.720000000000002 27.700000000000003 28.82 20.76 20-24 22.634999999999998 28.849999999999998 28.57 19.945 25-29 23.11 28.315 28.000000000000004 20.575 30-34 22.7 28.599999999999998 28.525 20.175 35-39 22.15 28.860000000000003 28.51 20.48 40-44 22.305 28.415000000000003 28.884999999999998 20.395 45-49 22.605 27.750000000000004 29.354999999999997 20.29 50-54 22.515 28.33 28.345 20.810000000000002 55-59 23.175 27.48 28.785 20.560000000000002 60-64 22.795 27.24 28.810000000000002 21.154999999999998 65-69 22.96 28.32 28.610000000000003 20.11 70-74 23.39 28.465 27.555000000000003 20.59 75-79 22.345000000000002 28.99 28.455000000000002 20.21 80-84 22.745 28.299999999999997 28.365000000000002 20.59 85-89 23.06 28.28 27.765 20.895 90-94 23.22 27.99 28.595 20.195 95-99 23.150000000000002 28.249999999999996 28.59 20.01 100-104 24.04 28.194999999999997 27.750000000000004 20.015 105-109 24.165 28.615000000000002 27.455000000000002 19.765 110-114 23.445 28.22 28.505000000000003 19.830000000000002 115-119 24.36 28.65 27.315 19.675 120-124 24.185000000000002 29.21 28.07 18.535 125-129 24.935 28.910000000000004 27.05 19.105 130-134 24.990000000000002 28.875 27.235 18.9 135-139 25.580000000000002 28.79 27.41 18.22 140-144 25.324999999999996 29.134999999999998 26.995 18.545 145-149 25.55 28.470000000000002 27.3 18.68 150-151 25.900000000000002 29.075 27.537499999999998 17.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 0.0 17 1.0 18 1.0 19 0.5 20 1.5 21 1.5 22 3.0 23 3.5 24 2.5 25 5.5 26 7.5 27 7.5 28 12.0 29 16.0 30 22.0 31 24.0 32 31.0 33 44.0 34 61.0 35 88.5 36 106.5 37 113.0 38 141.5 39 189.0 40 213.5 41 233.5 42 259.5 43 270.5 44 259.0 45 248.0 46 253.5 47 239.5 48 218.0 49 190.0 50 156.0 51 131.0 52 100.5 53 78.5 54 65.5 55 48.5 56 35.0 57 28.5 58 23.0 59 19.0 60 14.5 61 9.5 62 4.5 63 2.5 64 2.0 65 1.0 66 0.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31472081218274 97.82499999999999 2 0.532994923857868 1.05 3 0.050761421319796954 0.15 4 0.025380710659898477 0.1 5 0.050761421319796954 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025380710659898477 0.625 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 25 0.625 Illumina Single End PCR Primer 1 (96% over 32bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.5375 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.7625 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.2125 0.0 0.0 0.0 0.0 90-91 1.3875000000000002 0.0 0.0 0.0 0.0 92-93 1.5750000000000002 0.0 0.0 0.0 0.0 94-95 1.9 0.0 0.0 0.0 0.0 96-97 2.3 0.0 0.0 0.0 0.0 98-99 2.5625 0.0 0.0 0.0 0.0 100-101 2.8875 0.0 0.0 0.0 0.0 102-103 3.1375 0.0 0.0 0.0 0.0 104-105 3.55 0.0 0.0 0.0 0.0 106-107 4.0 0.0 0.0 0.0 0.0 108-109 4.449999999999999 0.0 0.0 0.0 0.0 110-111 4.9125 0.0 0.0 0.0 0.0 112-113 5.35 0.0 0.0 0.0 0.0 114-115 5.9375 0.0 0.0 0.0 0.0 116-117 6.6375 0.0 0.0 0.0 0.0 118-119 7.2375 0.0 0.0 0.0 0.0 120-121 7.8 0.0 0.0 0.0 0.0 122-123 8.175 0.0 0.0 0.0 0.0 124-125 8.675 0.0 0.0 0.0 0.0 126-127 9.425 0.0 0.0 0.0 0.0 128-129 10.0625 0.0 0.0 0.0 0.0 130-131 10.8125 0.0 0.0 0.0 0.0 132-133 11.3875 0.0 0.0 0.0 0.0 134-135 12.0125 0.0 0.0 0.0 0.0 136-137 12.55 0.0 0.0 0.0 0.0 138-139 13.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTAC 10 0.006830828 145.0 9 GACATCT 10 0.006830828 145.0 3 CAGGAAG 10 0.006830828 145.0 2 GGGACAT 25 8.7132835E-4 87.0 1 ACAACTT 20 0.00593511 29.0 25-29 >>END_MODULE Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583698 spots for SRR7170827.sra Written 583698 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra Read 583681 spots for SRR7170827.sra Written 583681 spots for SRR7170827.sra SRR ids: ['SRR7170827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ay27fdau SRR7170827.sra spots: 11673637 blocks: [[1, 583681], [583682, 1167362], [1167363, 1751043], [1751044, 2334724], [2334725, 2918405], [2918406, 3502086], [3502087, 4085767], [4085768, 4669448], [4669449, 5253129], [5253130, 5836810], [5836811, 6420491], [6420492, 7004172], [7004173, 7587853], [7587854, 8171534], [8171535, 8755215], [8755216, 9338896], [9338897, 9922577], [9922578, 10506258], [10506259, 11089939], [11089940, 11673637]] SRR7170827 file size 3934112 SRR7170827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170827 SRR7170827_1.fastq SRR7170827_2.fastq Input file: SRR7170827_1.fastq Paired file: SRR7170827_2.fastq trimmed: SRR7170827-trimmed-pair1.fastq, SRR7170827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:38:00 2025 >> started Thu Feb 13 17:38:12 2025 >> done (12.260s) 11673637 read pairs processed; of these: 23124 ( 0.20%) short read pairs filtered out after trimming by size control 114541 ( 0.98%) empty read pairs filtered out after trimming by size control 11535972 (98.82%) read pairs available; of these: 7492510 (64.95%) trimmed read pairs available after processing 4043462 (35.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 19 0.00% 20 16 0.00% 21 19 0.00% 22 16 0.00% 23 20 0.00% 24 30 0.00% 25 33 0.00% 26 21 0.00% 27 40 0.00% 28 42 0.00% 29 28 0.00% 30 43 0.00% 31 41 0.00% 32 39 0.00% 33 36 0.00% 34 60 0.00% 35 61 0.00% 36 41 0.00% 37 61 0.00% 38 89 0.00% 39 82 0.00% 40 118 0.00% 41 105 0.00% 42 129 0.00% 43 151 0.00% 44 123 0.00% 45 177 0.00% 46 201 0.00% 47 206 0.00% 48 232 0.00% 49 283 0.00% 50 339 0.00% 51 388 0.00% 52 452 0.00% 53 491 0.00% 54 468 0.00% 55 501 0.00% 56 584 0.01% 57 655 0.01% 58 770 0.01% 59 844 0.01% 60 1007 0.01% 61 1130 0.01% 62 1330 0.01% 63 1441 0.01% 64 1546 0.01% 65 1509 0.01% 66 1650 0.01% 67 1823 0.02% 68 1985 0.02% 69 2265 0.02% 70 2580 0.02% 71 3009 0.03% 72 3558 0.03% 73 4090 0.04% 74 4731 0.04% 75 6114 0.05% 76 14273 0.12% 77 15239 0.13% 78 8593 0.07% 79 7432 0.06% 80 7462 0.06% 81 8152 0.07% 82 8959 0.08% 83 9928 0.09% 84 11119 0.10% 85 11842 0.10% 86 12569 0.11% 87 13093 0.11% 88 13502 0.12% 89 14153 0.12% 90 15494 0.13% 91 16352 0.14% 92 17896 0.16% 93 18987 0.16% 94 20251 0.18% 95 21364 0.19% 96 21379 0.19% 97 21817 0.19% 98 22160 0.19% 99 23212 0.20% 100 23999 0.21% 101 25179 0.22% 102 27133 0.24% 103 28444 0.25% 104 29788 0.26% 105 30777 0.27% 106 31347 0.27% 107 31708 0.27% 108 31969 0.28% 109 32228 0.28% 110 32946 0.29% 111 34433 0.30% 112 36275 0.31% 113 37514 0.33% 114 39374 0.34% 115 39982 0.35% 116 40895 0.35% 117 42071 0.36% 118 41738 0.36% 119 42415 0.37% 120 42891 0.37% 121 44133 0.38% 122 45582 0.40% 123 48177 0.42% 124 49488 0.43% 125 50755 0.44% 126 52808 0.46% 127 53871 0.47% 128 54533 0.47% 129 55884 0.48% 130 56906 0.49% 131 58799 0.51% 132 61456 0.53% 133 64686 0.56% 134 67766 0.59% 135 72113 0.63% 136 74794 0.65% 137 78928 0.68% 138 83047 0.72% 139 87955 0.76% 140 93266 0.81% 141 100257 0.87% 142 110968 0.96% 143 125694 1.09% 144 144611 1.25% 145 169944 1.47% 146 209946 1.82% 147 277197 2.40% 148 411207 3.56% 149 777538 6.74% 150 2784029 24.13% 151 4043462 35.05% 11535972 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.51 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=12.77 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=1.6 sequence=GTGCAAGTGGATAGGGGAGAGAAGACGATGGTAGCTAAGAGAAAGCATACGATAAGAAAGGCCTTCATCTTGGAAATATATGTGACTAA criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=12 prefix-density=0.71 prefix-fanout=2.5 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=12.85 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.5 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTAC SRR7170827 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:38:57 Started mapping on | Feb 13 17:38:57 Finished on | Feb 13 17:40:08 Mapping speed, Million of reads per hour | 584.92 Number of input reads | 11535972 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 10935132 Uniquely mapped reads % | 94.79% Average mapped length | 285.75 Number of splices: Total | 10093735 Number of splices: Annotated (sjdb) | 9806797 Number of splices: GT/AG | 9891025 Number of splices: GC/AG | 156005 Number of splices: AT/AC | 6314 Number of splices: Non-canonical | 40391 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 288207 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 25956 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 332762 332762 332762 N_multimapping 288207 288207 288207 N_noFeature 610558 10700819 738469 N_ambiguous 190599 1131 83369 UnstrandedReadsAssigned:10133975 PositiveStrandReadsAssigned:233182 NegativeStrandReadsAssigned:10113294 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR7170827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170827-trimmed-pair1.fastq SRR7170827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,535,972 reads, 10,105,850 reads pseudoaligned [quant] estimated average fragment length: 223.554 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7170827.ke.tsv 34699 SRR7170827.se.tsv 87100 total ==> SRR7170827.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.45 381 21.0384 Potri.005G024800.1.v4.1 1035 812.446 107 13.0572 Potri.004G059700.1.v4.1 961 738.514 4 0.536985 Potri.007G009000.2.v4.1 1416 1193.45 0 0 Potri.003G141000.2.v4.1 2943 2720.45 490 17.8573 Potri.016G087400.1.v4.1 270 97.3485 494 503.105 Potri.015G069301.1.v4.1 564 348.033 0 0 Potri.010G195200.1.v4.1 1773 1550.45 33 2.11017 Potri.012G127500.1.v4.1 977 754.498 65 8.54114 ==> SRR7170827.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 359 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7170827 completed mapping pipeline successfully