Starting /dee2/code/volunteer_pipeline.sh SRR7170828 current disk space = 3088755113984 free memory = 1495815200 SRR7170828 SRAfilesize 6b076469f441d7a7125873235bcaaba2 SRR7170828.sra SRR7170828.sra file validated SRR7170828 is paired end SRR7170828 is conventional basespace SRR7170828 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3955 34.0 33.0 34.0 32.0 34.0 2 33.24575 34.0 33.0 34.0 32.0 34.0 3 33.21375 34.0 33.0 34.0 31.0 34.0 4 33.371 34.0 33.0 34.0 33.0 34.0 5 33.38425 34.0 33.0 34.0 33.0 34.0 6 36.87425 38.0 37.0 38.0 35.0 38.0 7 37.29 38.0 38.0 38.0 36.0 38.0 8 37.44 38.0 38.0 38.0 37.0 38.0 9 37.47075 38.0 38.0 38.0 37.0 38.0 10-14 37.49575 38.0 38.0 38.0 37.0 38.0 15-19 37.432449999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.40595 38.0 38.0 38.0 37.0 38.0 25-29 37.3909 38.0 38.0 38.0 37.0 38.0 30-34 37.33125 38.0 38.0 38.0 37.0 38.0 35-39 37.25814999999999 38.0 38.0 38.0 36.6 38.0 40-44 37.2291 38.0 38.0 38.0 36.2 38.0 45-49 37.08245000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.04595 38.0 38.0 38.0 35.8 38.0 55-59 36.91825 38.0 38.0 38.0 35.2 38.0 60-64 36.81765 38.0 38.0 38.0 35.0 38.0 65-69 36.82545 38.0 38.0 38.0 35.2 38.0 70-74 36.71425 38.0 38.0 38.0 34.8 38.0 75-79 36.6211 38.0 38.0 38.0 34.2 38.0 80-84 36.31295 38.0 37.6 38.0 33.8 38.0 85-89 36.3244 38.0 37.6 38.0 33.8 38.0 90-94 36.131600000000006 38.0 37.0 38.0 33.2 38.0 95-99 36.11565 38.0 37.0 38.0 33.0 38.0 100-104 35.86295 38.0 36.8 38.0 31.8 38.0 105-109 35.6207 38.0 36.6 38.0 30.6 38.0 110-114 35.3727 38.0 36.0 38.0 29.4 38.0 115-119 34.99884999999999 38.0 36.0 38.0 28.0 38.0 120-124 34.667199999999994 38.0 34.8 38.0 26.4 38.0 125-129 34.02485 38.0 33.4 38.0 22.8 38.0 130-134 33.6498 38.0 33.0 38.0 21.4 38.0 135-139 32.8226 38.0 32.8 38.0 17.6 38.0 140-144 32.039 37.4 31.6 38.0 13.2 38.0 145-149 30.5174 36.2 29.2 38.0 6.2 38.0 150-151 24.447499999999998 31.5 15.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 4.0 16 2.0 17 4.0 18 4.0 19 5.0 20 7.0 21 3.0 22 9.0 23 13.0 24 13.0 25 18.0 26 28.0 27 30.0 28 31.0 29 51.0 30 56.0 31 75.0 32 112.0 33 139.0 34 258.0 35 461.0 36 1019.0 37 1654.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.34299017071909 15.752715985514746 10.450077599586136 34.45421624418003 2 20.349999999999998 19.6 37.125 22.925 3 17.825 27.125 28.9 26.150000000000002 4 22.175 32.525 23.25 22.05 5 21.0 36.825 23.474999999999998 18.7 6 16.675 37.3 25.900000000000002 20.125 7 14.674999999999999 22.75 44.525 18.05 8 17.775 22.25 30.975 28.999999999999996 9 17.45 22.55 32.425 27.575 10-14 20.02 29.095 26.655 24.23 15-19 19.759999999999998 27.939999999999998 28.410000000000004 23.89 20-24 19.72 28.1 28.189999999999998 23.990000000000002 25-29 19.865 28.22 28.12 23.794999999999998 30-34 19.17 28.715000000000003 28.425 23.69 35-39 19.89 28.634999999999998 28.275 23.200000000000003 40-44 19.744999999999997 29.315 27.485 23.455000000000002 45-49 20.044999999999998 29.115000000000002 27.495000000000005 23.345 50-54 20.48 28.09 27.97 23.46 55-59 20.04 28.854999999999997 27.57 23.535 60-64 20.54 28.310000000000002 28.26 22.89 65-69 20.64 28.21 27.83 23.32 70-74 20.115 28.28 27.63 23.974999999999998 75-79 19.72 29.085 27.88 23.315 80-84 20.43 28.155 27.650000000000002 23.765 85-89 19.985 28.52 27.905 23.59 90-94 19.805 28.58 27.825 23.79 95-99 20.25 28.96 27.68 23.11 100-104 20.205000000000002 28.95 27.750000000000004 23.095 105-109 21.16 28.435 26.919999999999998 23.485 110-114 20.45 28.26 28.07 23.22 115-119 20.96 28.22 26.91 23.91 120-124 20.775 27.83 27.485 23.91 125-129 20.905 27.88 27.52 23.695 130-134 20.805 28.775000000000002 27.015 23.405 135-139 20.845 27.944999999999997 27.165 24.044999999999998 140-144 20.985 28.235 27.065 23.715 145-149 20.75 28.075 26.724999999999998 24.45 150-151 20.0125 27.725 27.5625 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 2.0 22 1.5 23 4.0 24 7.5 25 6.0 26 7.0 27 9.0 28 10.5 29 17.0 30 25.5 31 33.0 32 39.5 33 48.5 34 65.5 35 90.0 36 108.0 37 122.0 38 146.5 39 156.0 40 174.0 41 208.0 42 234.5 43 257.0 44 258.0 45 261.0 46 249.0 47 236.0 48 233.5 49 206.0 50 176.5 51 137.5 52 98.5 53 77.0 54 60.5 55 56.0 56 48.0 57 31.0 58 22.0 59 19.5 60 20.5 61 13.0 62 5.0 63 3.5 64 2.5 65 3.5 66 2.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52225295448831 98.95 2 0.4023133014835303 0.8 3 0.050289162685441285 0.15 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.5499999999999998 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 2.9 0.0 0.0 0.0 0.0 110-111 3.35 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 4.2125 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 5.3875 0.0 0.0 0.0 0.0 120-121 5.887499999999999 0.0 0.0 0.0 0.0 122-123 6.325 0.0 0.0 0.0 0.0 124-125 6.8625 0.0 0.0 0.0 0.0 126-127 7.65 0.0 0.0 0.0 0.0 128-129 8.3 0.0 0.0 0.0 0.0 130-131 8.9375 0.0 0.0 0.0 0.0 132-133 9.6125 0.0 0.0 0.0 0.0 134-135 10.462499999999999 0.0 0.0 0.0 0.0 136-137 10.9375 0.0 0.0 0.0 0.0 138-139 11.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCTAT 10 0.0068378756 144.95 6 TCTCCTA 10 0.0068378756 144.95 5 >>END_MODULE SRR7170828 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170828_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.931 33.0 33.0 34.0 32.0 34.0 2 33.034 34.0 33.0 34.0 32.0 34.0 3 33.12275 34.0 33.0 34.0 33.0 34.0 4 33.14675 34.0 33.0 34.0 33.0 34.0 5 33.02825 34.0 33.0 34.0 33.0 34.0 6 37.27375 38.0 38.0 38.0 37.0 38.0 7 37.332 38.0 38.0 38.0 37.0 38.0 8 37.348 38.0 38.0 38.0 37.0 38.0 9 37.328 38.0 38.0 38.0 37.0 38.0 10-14 37.30995 38.0 38.0 38.0 37.4 38.0 15-19 37.281400000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.2365 38.0 38.0 38.0 37.0 38.0 25-29 37.16685 38.0 38.0 38.0 37.0 38.0 30-34 37.1428 38.0 38.0 38.0 37.0 38.0 35-39 37.1154 38.0 38.0 38.0 37.0 38.0 40-44 37.08895 38.0 38.0 38.0 37.0 38.0 45-49 37.098699999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.055049999999994 38.0 38.0 38.0 37.0 38.0 55-59 36.96764999999999 38.0 38.0 38.0 36.2 38.0 60-64 36.9207 38.0 38.0 38.0 36.2 38.0 65-69 36.8424 38.0 38.0 38.0 36.0 38.0 70-74 36.78099999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.685900000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.61695 38.0 38.0 38.0 35.6 38.0 85-89 36.467949999999995 38.0 38.0 38.0 34.8 38.0 90-94 36.3391 38.0 38.0 38.0 34.0 38.0 95-99 36.310649999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.10965 38.0 38.0 38.0 33.6 38.0 105-109 35.890150000000006 38.0 37.8 38.0 33.2 38.0 110-114 35.76785 38.0 37.0 38.0 32.8 38.0 115-119 35.59765 38.0 37.0 38.0 31.2 38.0 120-124 35.29455 38.0 36.4 38.0 30.0 38.0 125-129 35.021899999999995 38.0 36.0 38.0 28.6 38.0 130-134 34.360299999999995 38.0 34.8 38.0 25.4 38.0 135-139 33.7717 38.0 33.4 38.0 22.4 38.0 140-144 33.07705 38.0 33.0 38.0 17.0 38.0 145-149 31.942200000000003 38.0 33.0 38.0 10.4 38.0 150-151 26.573749999999997 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 4.0 4 2.0 5 1.0 6 4.0 7 0.0 8 0.0 9 2.0 10 3.0 11 0.0 12 2.0 13 2.0 14 4.0 15 6.0 16 3.0 17 5.0 18 7.0 19 3.0 20 9.0 21 16.0 22 8.0 23 3.0 24 14.0 25 19.0 26 12.0 27 22.0 28 33.0 29 45.0 30 43.0 31 54.0 32 78.0 33 92.0 34 151.0 35 242.0 36 690.0 37 2413.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.849999999999994 18.825 14.025000000000002 26.3 2 26.433041301627036 24.055068836045056 31.964956195244053 17.546933667083856 3 19.849812265331664 28.410513141426787 32.64080100125156 19.09887359198999 4 23.323323323323322 35.36036036036036 23.24824824824825 18.06806806806807 5 23.754693366708384 37.77221526908636 21.076345431789736 17.39674593241552 6 19.35 39.35 23.150000000000002 18.15 7 18.075 19.25 42.475 20.200000000000003 8 19.775000000000002 24.275 28.1 27.85 9 22.075 23.925 30.125 23.875 10-14 22.612261226122612 29.022902290229023 26.4026402640264 21.962196219621962 15-19 23.035758939734936 28.132033008252062 28.42710677669417 20.40510127531883 20-24 23.06383830298179 28.432059235541324 27.966780068040826 20.53732239343606 25-29 22.503002401921538 28.80804643714972 27.702161729383505 20.986789431545237 30-34 22.81439223339839 28.279037181604366 28.09387979782815 20.812690787169092 35-39 22.257241482815548 28.200510280654363 28.53069188053429 21.011556355995797 40-44 23.21821821821822 28.163163163163162 27.637637637637635 20.98098098098098 45-49 22.4679743795036 28.552842273819056 27.90232185748599 21.076861489191355 50-54 22.99339471577262 28.117493995196156 28.23258606885509 20.656525220176142 55-59 23.10655327663832 28.329164582291146 27.65382691345673 20.910455227613806 60-64 23.251625812906454 28.38419209604802 27.383691845922964 20.98049024512256 65-69 23.268961376826095 27.556533920352212 28.387032219331598 20.787472483490095 70-74 23.058835301180707 27.776665999599757 28.422053231939167 20.74244546728037 75-79 23.948171494321876 27.69022962629446 28.05042773525439 20.31117114412927 80-84 22.73864318591155 28.29697818691215 27.71662997798679 21.247748649189514 85-89 23.608262892012206 27.95478417446106 28.239883959385786 20.19706897414095 90-94 24.235906157770998 27.662448101645744 27.89255164824171 20.209094092341555 95-99 23.246974092227667 28.50855256576973 28.00340102030609 20.24107232169651 100-104 23.590615777099693 27.772497623930768 28.242709219148615 20.394177379820917 105-109 23.322827555155335 27.69022962629446 28.38060933513432 20.606333483415877 110-114 23.760692311540193 28.23770696813566 27.997598919513784 20.004001800810364 115-119 24.25834208814848 28.495672619940965 26.839761869027967 20.406223422882587 120-124 24.732366183091546 28.244122061030513 26.96848424212106 20.05502751375688 125-129 24.62477486491895 28.437062237342403 27.186311787072242 19.7518511106664 130-134 24.962488746623986 28.59857957387216 26.84305291587476 19.595878763629088 135-139 25.34767383691846 28.194097048524263 26.803401700850426 19.654827413706855 140-144 25.418896613814834 28.309908467963783 26.859400790276595 19.41179412794478 145-149 25.98039215686275 28.091236494597837 26.350540216086433 19.57783113245298 150-151 26.36909227306827 28.14453613403351 26.70667666916729 18.779694923730933 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.0 18 1.0 19 1.0 20 1.0 21 1.5 22 2.0 23 3.5 24 4.5 25 5.5 26 6.0 27 8.0 28 10.5 29 16.5 30 22.0 31 19.5 32 33.5 33 47.5 34 52.0 35 68.5 36 87.5 37 113.0 38 156.5 39 177.0 40 188.5 41 222.5 42 257.0 43 266.0 44 265.0 45 268.0 46 245.0 47 228.0 48 206.5 49 180.0 50 151.5 51 125.5 52 120.0 53 107.5 54 90.5 55 66.0 56 44.0 57 32.0 58 24.0 59 19.0 60 13.5 61 9.5 62 8.5 63 6.5 64 3.5 65 3.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.1 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.025 20-24 0.06 25-29 0.08 30-34 0.08499999999999999 35-39 0.055 40-44 0.1 45-49 0.08 50-54 0.08 55-59 0.05 60-64 0.05 65-69 0.06 70-74 0.06 75-79 0.055 80-84 0.06 85-89 0.034999999999999996 90-94 0.045 95-99 0.03 100-104 0.045 105-109 0.055 110-114 0.045 115-119 0.055 120-124 0.05 125-129 0.06 130-134 0.03 135-139 0.05 140-144 0.034999999999999996 145-149 0.04 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41919191919192 98.425 2 0.3282828282828283 0.65 3 0.15151515151515152 0.44999999999999996 4 0.050505050505050504 0.2 5 0.025252525252525252 0.125 6 0.025252525252525252 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.3125 0.0 0.0 0.0 0.0 96-97 1.4375 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.8625 0.0 0.0 0.0 0.0 102-103 2.0625 0.0 0.0 0.0 0.0 104-105 2.2875 0.0 0.0 0.0 0.0 106-107 2.575 0.0 0.0 0.0 0.0 108-109 2.9124999999999996 0.0 0.0 0.0 0.0 110-111 3.35 0.0 0.0 0.0 0.0 112-113 3.6875 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.7625 0.0 0.0 0.0 0.0 118-119 5.4125 0.0 0.0 0.0 0.0 120-121 5.925000000000001 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 6.987500000000001 0.0 0.0 0.0 0.0 126-127 7.7625 0.0 0.0 0.0 0.0 128-129 8.4 0.0 0.0 0.0 0.0 130-131 9.024999999999999 0.0 0.0 0.0 0.0 132-133 9.7 0.0 0.0 0.0 0.0 134-135 10.5875 0.0 0.0 0.0 0.0 136-137 11.087499999999999 0.0 0.0 0.0 0.0 138-139 11.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733214 spots for SRR7170828.sra Written 733214 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra Read 733207 spots for SRR7170828.sra Written 733207 spots for SRR7170828.sra SRR ids: ['SRR7170828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nbjiajer SRR7170828.sra spots: 14664147 blocks: [[1, 733207], [733208, 1466414], [1466415, 2199621], [2199622, 2932828], [2932829, 3666035], [3666036, 4399242], [4399243, 5132449], [5132450, 5865656], [5865657, 6598863], [6598864, 7332070], [7332071, 8065277], [8065278, 8798484], [8798485, 9531691], [9531692, 10264898], [10264899, 10998105], [10998106, 11731312], [11731313, 12464519], [12464520, 13197726], [13197727, 13930933], [13930934, 14664147]] SRR7170828 file size 4947497 SRR7170828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170828 SRR7170828_1.fastq SRR7170828_2.fastq Input file: SRR7170828_1.fastq Paired file: SRR7170828_2.fastq trimmed: SRR7170828-trimmed-pair1.fastq, SRR7170828-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:56:03 2025 >> started Thu Feb 13 17:56:20 2025 >> done (17.004s) 14664147 read pairs processed; of these: 19683 ( 0.13%) short read pairs filtered out after trimming by size control 26565 ( 0.18%) empty read pairs filtered out after trimming by size control 14617899 (99.68%) read pairs available; of these: 10228010 (69.97%) trimmed read pairs available after processing 4389889 (30.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 9 0.00% 21 9 0.00% 22 15 0.00% 23 12 0.00% 24 8 0.00% 25 11 0.00% 26 17 0.00% 27 14 0.00% 28 16 0.00% 29 18 0.00% 30 19 0.00% 31 15 0.00% 32 21 0.00% 33 20 0.00% 34 15 0.00% 35 25 0.00% 36 29 0.00% 37 33 0.00% 38 25 0.00% 39 48 0.00% 40 57 0.00% 41 57 0.00% 42 72 0.00% 43 62 0.00% 44 84 0.00% 45 90 0.00% 46 78 0.00% 47 110 0.00% 48 127 0.00% 49 165 0.00% 50 190 0.00% 51 253 0.00% 52 200 0.00% 53 302 0.00% 54 329 0.00% 55 299 0.00% 56 363 0.00% 57 398 0.00% 58 470 0.00% 59 593 0.00% 60 653 0.00% 61 756 0.01% 62 813 0.01% 63 945 0.01% 64 1049 0.01% 65 1192 0.01% 66 1233 0.01% 67 1384 0.01% 68 1600 0.01% 69 1787 0.01% 70 2092 0.01% 71 2388 0.02% 72 2790 0.02% 73 3083 0.02% 74 3481 0.02% 75 3763 0.03% 76 4951 0.03% 77 5501 0.04% 78 5075 0.03% 79 5369 0.04% 80 5925 0.04% 81 6719 0.05% 82 7635 0.05% 83 9005 0.06% 84 11014 0.08% 85 10391 0.07% 86 10432 0.07% 87 11171 0.08% 88 12000 0.08% 89 12997 0.09% 90 13736 0.09% 91 14902 0.10% 92 16432 0.11% 93 17598 0.12% 94 19007 0.13% 95 20156 0.14% 96 21015 0.14% 97 21582 0.15% 98 22327 0.15% 99 23303 0.16% 100 24807 0.17% 101 26128 0.18% 102 27825 0.19% 103 29549 0.20% 104 30984 0.21% 105 32229 0.22% 106 33538 0.23% 107 34377 0.24% 108 35104 0.24% 109 36120 0.25% 110 37057 0.25% 111 38759 0.27% 112 40620 0.28% 113 42632 0.29% 114 44235 0.30% 115 46540 0.32% 116 47583 0.33% 117 49283 0.34% 118 49478 0.34% 119 50695 0.35% 120 52920 0.36% 121 54537 0.37% 122 56164 0.38% 123 59663 0.41% 124 62164 0.43% 125 64647 0.44% 126 67194 0.46% 127 69076 0.47% 128 71044 0.49% 129 74349 0.51% 130 76418 0.52% 131 79504 0.54% 132 84155 0.58% 133 89879 0.61% 134 95055 0.65% 135 101706 0.70% 136 108401 0.74% 137 115146 0.79% 138 123237 0.84% 139 132984 0.91% 140 143256 0.98% 141 157451 1.08% 142 176310 1.21% 143 198741 1.36% 144 232673 1.59% 145 274949 1.88% 146 342054 2.34% 147 452451 3.10% 148 665585 4.55% 149 1205414 8.25% 150 3641391 24.91% 151 4389889 30.03% 14617899 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=20 prefix-density=0.40 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=34.82 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=11.2 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=25 prefix-density=0.32 prefix-fanout=1.9 sequence=CCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=71.16 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.6 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR7170828 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:57:01 Started mapping on | Feb 13 17:57:01 Finished on | Feb 13 17:58:22 Mapping speed, Million of reads per hour | 649.68 Number of input reads | 14617899 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 13867262 Uniquely mapped reads % | 94.86% Average mapped length | 286.96 Number of splices: Total | 12860992 Number of splices: Annotated (sjdb) | 12537580 Number of splices: GT/AG | 12616400 Number of splices: GC/AG | 191059 Number of splices: AT/AC | 8069 Number of splices: Non-canonical | 45464 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363845 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 97960 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.84% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 399413 399413 399413 N_multimapping 363845 363845 363845 N_noFeature 672852 13594789 805448 N_ambiguous 235272 1320 94435 UnstrandedReadsAssigned:12959138 PositiveStrandReadsAssigned:271153 NegativeStrandReadsAssigned:12967379 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170828 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170828-trimmed-pair1.fastq SRR7170828-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,617,899 reads, 12,969,651 reads pseudoaligned [quant] estimated average fragment length: 227.816 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR7170828.ke.tsv 34699 SRR7170828.se.tsv 87100 total ==> SRR7170828.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.18 501 20.6043 Potri.005G024800.1.v4.1 1035 808.184 272 24.7924 Potri.004G059700.1.v4.1 961 734.232 18 1.80593 Potri.007G009000.2.v4.1 1416 1189.18 0 0 Potri.003G141000.2.v4.1 2943 2716.18 686 18.6048 Potri.016G087400.1.v4.1 270 93.3184 660 520.999 Potri.015G069301.1.v4.1 564 343.93 0 0 Potri.010G195200.1.v4.1 1773 1546.18 76 3.62087 Potri.012G127500.1.v4.1 977 750.205 75 7.36447 ==> SRR7170828.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 892 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170828 completed mapping pipeline successfully