Starting /dee2/code/volunteer_pipeline.sh SRR7170829 current disk space = 3088758202368 free memory = 1521537264 SRR7170829 SRAfilesize 15bb43bbfb4a77da82b010f7ce830640 SRR7170829.sra SRR7170829.sra file validated SRR7170829 is paired end SRR7170829 is conventional basespace SRR7170829 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170829_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6045 34.0 33.0 34.0 33.0 34.0 2 33.347 34.0 33.0 34.0 33.0 34.0 3 33.3415 34.0 34.0 34.0 33.0 34.0 4 33.4845 34.0 34.0 34.0 33.0 34.0 5 33.479 34.0 34.0 34.0 33.0 34.0 6 37.03275 38.0 37.0 38.0 36.0 38.0 7 37.424 38.0 38.0 38.0 37.0 38.0 8 37.58175 38.0 38.0 38.0 37.0 38.0 9 37.61575 38.0 38.0 38.0 38.0 38.0 10-14 37.5831 38.0 38.0 38.0 38.0 38.0 15-19 37.5172 38.0 38.0 38.0 38.0 38.0 20-24 37.50505 38.0 38.0 38.0 38.0 38.0 25-29 37.45075 38.0 38.0 38.0 37.4 38.0 30-34 37.4008 38.0 38.0 38.0 37.0 38.0 35-39 37.3343 38.0 38.0 38.0 37.0 38.0 40-44 37.28765 38.0 38.0 38.0 36.8 38.0 45-49 37.167500000000004 38.0 38.0 38.0 36.4 38.0 50-54 37.1178 38.0 38.0 38.0 36.0 38.0 55-59 37.097 38.0 38.0 38.0 36.0 38.0 60-64 36.95355 38.0 38.0 38.0 36.0 38.0 65-69 37.00725 38.0 38.0 38.0 36.0 38.0 70-74 36.86615 38.0 38.0 38.0 36.0 38.0 75-79 36.62345 38.0 38.0 38.0 35.0 38.0 80-84 36.41865 38.0 38.0 38.0 34.2 38.0 85-89 36.36865 38.0 38.0 38.0 34.2 38.0 90-94 36.2063 38.0 38.0 38.0 34.0 38.0 95-99 36.17955 38.0 37.8 38.0 34.0 38.0 100-104 35.96775 38.0 37.2 38.0 33.2 38.0 105-109 35.77665 38.0 37.0 38.0 32.0 38.0 110-114 35.4808 38.0 37.0 38.0 31.0 38.0 115-119 35.280950000000004 38.0 36.2 38.0 30.0 38.0 120-124 35.007799999999996 38.0 36.0 38.0 29.2 38.0 125-129 34.4485 38.0 34.6 38.0 26.0 38.0 130-134 34.0345 38.0 33.6 38.0 24.0 38.0 135-139 33.5866 38.0 33.2 38.0 21.4 38.0 140-144 32.72724999999999 38.0 33.0 38.0 16.6 38.0 145-149 31.557800000000004 38.0 31.4 38.0 10.2 38.0 150-151 25.39875 32.5 15.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 1.0 12 3.0 13 1.0 14 4.0 15 1.0 16 2.0 17 4.0 18 7.0 19 25.0 20 4.0 21 3.0 22 9.0 23 13.0 24 15.0 25 14.0 26 19.0 27 23.0 28 33.0 29 32.0 30 44.0 31 49.0 32 75.0 33 133.0 34 193.0 35 337.0 36 948.0 37 2006.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.53347064881565 15.525231719876418 10.22142121524202 31.71987641606591 2 20.95 18.825 36.35 23.875 3 17.825 29.049999999999997 30.275000000000002 22.85 4 19.5 33.675 25.2 21.625 5 20.5 37.7 24.625 17.175 6 18.65 36.65 24.8 19.900000000000002 7 13.750000000000002 23.575 43.95 18.725 8 17.825 24.725 30.0 27.450000000000003 9 17.675 23.849999999999998 32.95 25.525 10-14 20.18 29.575000000000003 26.275 23.97 15-19 19.81 29.439999999999998 26.93 23.82 20-24 19.040000000000003 29.89 27.87 23.200000000000003 25-29 19.470000000000002 29.195 28.000000000000004 23.335 30-34 18.765 29.445 27.845 23.945 35-39 19.48 29.255 27.944999999999997 23.32 40-44 20.175 29.13 27.35 23.345 45-49 19.895 29.104999999999997 27.48 23.52 50-54 20.04 29.445 27.810000000000002 22.705000000000002 55-59 19.55 28.985 27.6 23.865 60-64 20.19 28.59 28.134999999999998 23.085 65-69 19.86 29.365000000000002 27.22 23.555 70-74 19.74 29.645 27.71 22.905 75-79 19.74 30.055 27.215 22.99 80-84 19.965 29.43 26.995 23.61 85-89 20.715 28.655 27.345000000000002 23.285 90-94 20.29 28.92 27.57 23.22 95-99 20.455000000000002 29.439999999999998 26.99 23.115 100-104 20.105 29.14 27.015 23.74 105-109 20.880000000000003 29.375 26.38 23.365 110-114 20.064999999999998 28.499999999999996 27.584999999999997 23.849999999999998 115-119 20.195 28.939999999999998 27.125 23.74 120-124 21.285 28.49 26.565 23.66 125-129 21.044999999999998 28.585 26.540000000000003 23.830000000000002 130-134 21.099999999999998 28.08 26.384999999999998 24.435000000000002 135-139 20.95 28.52 26.195 24.335 140-144 21.57 28.515 26.105 23.810000000000002 145-149 20.89 28.000000000000004 26.634999999999998 24.474999999999998 150-151 21.5375 27.3625 27.125 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 2.5 19 3.5 20 4.5 21 5.0 22 2.5 23 3.5 24 7.0 25 6.0 26 6.0 27 12.5 28 17.0 29 22.0 30 28.5 31 32.5 32 44.0 33 65.0 34 80.5 35 89.5 36 113.5 37 137.5 38 146.5 39 169.5 40 190.0 41 212.5 42 227.5 43 228.0 44 236.5 45 248.0 46 245.5 47 231.0 48 206.0 49 179.0 50 158.5 51 134.5 52 105.5 53 88.0 54 81.0 55 66.5 56 50.5 57 33.0 58 19.5 59 13.0 60 12.5 61 9.5 62 8.0 63 4.5 64 1.5 65 1.5 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13375796178345 97.275 2 0.6878980891719746 1.35 3 0.05095541401273885 0.15 4 0.025477707006369425 0.1 5 0.0 0.0 6 0.07643312101910828 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025477707006369425 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 27 0.675 TruSeq Adapter, Index 7 (97% over 36bp) CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 6 0.15 No Hit GGACAATCTCGTTGGTAAATGCTACATCCACTGCCAGTTCGTGGGGCATA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8374999999999999 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.6375 0.0 0.0 0.0 0.0 96-97 1.95 0.0 0.0 0.0 0.0 98-99 2.2875 0.0 0.0 0.0 0.0 100-101 2.5375 0.0 0.0 0.0 0.0 102-103 2.8125 0.0 0.0 0.0 0.0 104-105 3.05 0.0 0.0 0.0 0.0 106-107 3.475 0.0 0.0 0.0 0.0 108-109 3.9125 0.0 0.0 0.0 0.0 110-111 4.35 0.0 0.0 0.0 0.0 112-113 4.7625 0.0 0.0 0.0 0.0 114-115 5.1875 0.0 0.0 0.0 0.0 116-117 5.550000000000001 0.0 0.0 0.0 0.0 118-119 6.2625 0.0 0.0 0.0 0.0 120-121 6.675 0.0 0.0 0.0 0.0 122-123 7.225 0.0 0.0 0.0 0.0 124-125 7.95 0.0 0.0 0.0 0.0 126-127 8.8875 0.0 0.0 0.0 0.0 128-129 9.7375 0.0 0.0 0.0 0.0 130-131 10.425 0.0 0.0 0.0 0.0 132-133 11.15 0.0 0.0 0.0 0.0 134-135 12.024999999999999 0.0 0.0 0.0 0.0 136-137 12.95 0.0 0.0 0.0 0.0 138-139 13.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCATCT 10 0.006832588 144.9875 3 >>END_MODULE SRR7170829 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170829_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99925 33.0 33.0 34.0 32.0 34.0 2 33.077 34.0 33.0 34.0 33.0 34.0 3 33.09725 34.0 33.0 34.0 33.0 34.0 4 33.0955 34.0 33.0 34.0 33.0 34.0 5 33.0305 34.0 33.0 34.0 33.0 34.0 6 37.26325 38.0 38.0 38.0 37.0 38.0 7 37.25625 38.0 38.0 38.0 37.0 38.0 8 37.284 38.0 38.0 38.0 37.0 38.0 9 37.40475 38.0 38.0 38.0 38.0 38.0 10-14 37.36750000000001 38.0 38.0 38.0 37.8 38.0 15-19 37.35615 38.0 38.0 38.0 37.6 38.0 20-24 37.242900000000006 38.0 38.0 38.0 37.2 38.0 25-29 37.1885 38.0 38.0 38.0 37.0 38.0 30-34 37.189499999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.13099999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.16155 38.0 38.0 38.0 37.0 38.0 45-49 37.11635 38.0 38.0 38.0 37.0 38.0 50-54 37.0945 38.0 38.0 38.0 37.0 38.0 55-59 37.05955 38.0 38.0 38.0 37.0 38.0 60-64 37.0402 38.0 38.0 38.0 37.0 38.0 65-69 36.99225 38.0 38.0 38.0 36.6 38.0 70-74 36.94965 38.0 38.0 38.0 36.0 38.0 75-79 36.835750000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.55485 38.0 38.0 38.0 35.4 38.0 85-89 36.51065 38.0 38.0 38.0 35.4 38.0 90-94 36.35265 38.0 38.0 38.0 34.4 38.0 95-99 36.32835 38.0 38.0 38.0 34.2 38.0 100-104 36.07275 38.0 38.0 38.0 34.0 38.0 105-109 35.92895 38.0 38.0 38.0 33.4 38.0 110-114 35.8031 38.0 38.0 38.0 33.2 38.0 115-119 35.55695 38.0 37.0 38.0 31.6 38.0 120-124 35.274449999999995 38.0 37.0 38.0 30.6 38.0 125-129 34.9376 38.0 36.0 38.0 28.0 38.0 130-134 34.299850000000006 38.0 35.2 38.0 24.8 38.0 135-139 33.837999999999994 38.0 33.8 38.0 22.8 38.0 140-144 33.10975 38.0 33.0 38.0 15.8 38.0 145-149 32.048 38.0 33.0 38.0 8.4 38.0 150-151 26.646749999999997 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 2.0 5 5.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 4.0 14 4.0 15 4.0 16 6.0 17 4.0 18 10.0 19 9.0 20 25.0 21 10.0 22 11.0 23 8.0 24 6.0 25 15.0 26 22.0 27 18.0 28 29.0 29 36.0 30 43.0 31 49.0 32 70.0 33 102.0 34 126.0 35 217.0 36 607.0 37 2547.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.275 21.875 13.350000000000001 20.5 2 27.008760951188986 24.30538172715895 32.040050062578224 16.64580725907384 3 21.67709637046308 26.408010012515643 33.46683354192741 18.448060075093867 4 23.692769577182887 35.15136352264198 23.46760070052539 17.68826619964974 5 24.780976220275345 36.92115143929912 21.777221526908637 16.520650813516895 6 20.175 37.525 23.275000000000002 19.025 7 19.675 20.3 40.1 19.925 8 21.625 25.8 27.075 25.5 9 22.275 25.424999999999997 27.800000000000004 24.5 10-14 23.555 27.685 26.93 21.83 15-19 23.995 27.815 27.755000000000003 20.435 20-24 23.178112339318762 28.374931225929075 27.734707147501624 20.712249287250536 25-29 23.488791032826263 28.63290632506005 27.77722177742194 20.101080864691752 30-34 23.67420452271363 27.821693015809483 28.126876125675405 20.37722633580148 35-39 23.004201680672267 28.106242496998803 28.211284513805523 20.67827130852341 40-44 23.606524567197038 27.7944561192835 28.099669768838186 20.499349544681277 45-49 23.035365914661597 27.43234455504977 28.532839777900055 20.999449752388575 50-54 23.121560780390197 27.433716858429214 28.65432716358179 20.790395197598798 55-59 23.76713013904171 27.45323597079124 27.62328698609583 21.15634690407122 60-64 23.8247649529906 27.445489097819564 28.200640128025604 20.529105821164233 65-69 23.573250637723202 27.77472115240334 28.044815685489922 20.607212524383534 70-74 23.40468093618724 28.130626125225046 27.855571114222844 20.609121824364873 75-79 23.785946486621658 27.81695423855964 27.726931732933235 20.67016754188547 80-84 23.3631771119892 28.214875206322215 27.654679137698196 20.767268543990397 85-89 23.851192559627982 28.006400320016 27.936396819840994 20.206010300515025 90-94 23.36967393478696 28.375675135027006 27.765553110622125 20.489097819563913 95-99 23.89 28.144999999999996 28.07 19.895 100-104 24.143621543231486 27.57913687053058 28.09921488223234 20.1780267040056 105-109 24.33108277069267 27.846961740435113 27.916979244811202 19.904976244061015 110-114 24.39121956097805 27.716385819290963 27.651382569128458 20.24101205060253 115-119 24.98249474842453 28.253476042812842 27.558267480244076 19.205761728518556 120-124 24.558683802570386 28.479271890783618 27.104065609841477 19.85797869680452 125-129 24.772431729518857 28.55856757027108 27.328198459537862 19.340802240672204 130-134 25.81258125812581 28.197819781978197 26.527652765276528 19.46194619461946 135-139 25.980196039207843 27.945589117823566 27.00540108021604 19.06881376275255 140-144 26.04520904180836 28.275655131026205 26.990398079615925 18.68873774754951 145-149 26.85671417854464 28.767191797949486 26.356589147286826 18.019504876219056 150-151 27.325 28.425 26.625 17.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 3.5 26 7.0 27 6.5 28 6.5 29 15.0 30 18.5 31 22.0 32 29.0 33 38.0 34 54.0 35 70.5 36 84.0 37 93.0 38 124.5 39 166.0 40 195.0 41 208.5 42 237.5 43 276.5 44 274.0 45 272.5 46 263.5 47 247.0 48 232.5 49 198.0 50 174.0 51 148.5 52 113.5 53 96.5 54 90.0 55 68.0 56 50.5 57 39.5 58 21.0 59 10.0 60 8.0 61 9.5 62 6.0 63 3.0 64 3.0 65 3.0 66 2.0 67 0.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.075 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.034999999999999996 25-29 0.08 30-34 0.06 35-39 0.04 40-44 0.06999999999999999 45-49 0.045 50-54 0.05 55-59 0.03 60-64 0.02 65-69 0.034999999999999996 70-74 0.02 75-79 0.025 80-84 0.034999999999999996 85-89 0.005 90-94 0.02 95-99 0.0 100-104 0.015 105-109 0.025 110-114 0.005 115-119 0.03 120-124 0.015 125-129 0.03 130-134 0.01 135-139 0.02 140-144 0.02 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.875 #Duplication Level Percentage of deduplicated Percentage of total 1 98.95274584929757 96.85000000000001 2 0.8684546615581098 1.7000000000000002 3 0.10217113665389528 0.3 4 0.0 0.0 5 0.0 0.0 6 0.02554278416347382 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.05108556832694764 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 27 0.675 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 13 0.325 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.6375 0.0 0.0 0.0 0.0 96-97 1.9625000000000001 0.0 0.0 0.0 0.0 98-99 2.3125 0.0 0.0 0.0 0.0 100-101 2.5875 0.0 0.0 0.0 0.0 102-103 2.9000000000000004 0.0 0.0 0.0 0.0 104-105 3.1500000000000004 0.0 0.0 0.0 0.0 106-107 3.575 0.0 0.0 0.0 0.0 108-109 4.0375 0.0 0.0 0.0 0.0 110-111 4.487500000000001 0.0 0.0 0.0 0.0 112-113 4.9375 0.0 0.0 0.0 0.0 114-115 5.3625 0.0 0.0 0.0 0.0 116-117 5.725 0.0 0.0 0.0 0.0 118-119 6.4125 0.0 0.0 0.0 0.0 120-121 6.875 0.0 0.0 0.0 0.0 122-123 7.387499999999999 0.0 0.0 0.0 0.0 124-125 8.175 0.0 0.0 0.0 0.0 126-127 9.149999999999999 0.0 0.0 0.0 0.0 128-129 9.95 0.0 0.0 0.0 0.0 130-131 10.6 0.0 0.0 0.0 0.0 132-133 11.35 0.0 0.0 0.0 0.0 134-135 12.2625 0.0 0.0 0.0 0.0 136-137 13.2 0.0 0.0 0.0 0.0 138-139 14.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700636 spots for SRR7170829.sra Written 700636 spots for SRR7170829.sra Read 700654 spots for SRR7170829.sra Written 700654 spots for SRR7170829.sra SRR ids: ['SRR7170829.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7psw6fei SRR7170829.sra spots: 14012738 blocks: [[1, 700636], [700637, 1401272], [1401273, 2101908], [2101909, 2802544], [2802545, 3503180], [3503181, 4203816], [4203817, 4904452], [4904453, 5605088], [5605089, 6305724], [6305725, 7006360], [7006361, 7706996], [7706997, 8407632], [8407633, 9108268], [9108269, 9808904], [9808905, 10509540], [10509541, 11210176], [11210177, 11910812], [11910813, 12611448], [12611449, 13312084], [13312085, 14012738]] SRR7170829 file size 4726756 SRR7170829 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170829 SRR7170829_1.fastq SRR7170829_2.fastq Input file: SRR7170829_1.fastq Paired file: SRR7170829_2.fastq trimmed: SRR7170829-trimmed-pair1.fastq, SRR7170829-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:54:39 2025 >> started Thu Feb 13 17:54:55 2025 >> done (16.275s) 14012738 read pairs processed; of these: 28112 ( 0.20%) short read pairs filtered out after trimming by size control 103480 ( 0.74%) empty read pairs filtered out after trimming by size control 13881146 (99.06%) read pairs available; of these: 9530901 (68.66%) trimmed read pairs available after processing 4350245 (31.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 16 0.00% 20 18 0.00% 21 13 0.00% 22 22 0.00% 23 19 0.00% 24 34 0.00% 25 33 0.00% 26 37 0.00% 27 38 0.00% 28 38 0.00% 29 41 0.00% 30 43 0.00% 31 38 0.00% 32 38 0.00% 33 35 0.00% 34 56 0.00% 35 37 0.00% 36 48 0.00% 37 39 0.00% 38 53 0.00% 39 49 0.00% 40 60 0.00% 41 80 0.00% 42 75 0.00% 43 102 0.00% 44 87 0.00% 45 104 0.00% 46 117 0.00% 47 116 0.00% 48 138 0.00% 49 190 0.00% 50 209 0.00% 51 267 0.00% 52 259 0.00% 53 335 0.00% 54 322 0.00% 55 363 0.00% 56 377 0.00% 57 427 0.00% 58 476 0.00% 59 648 0.00% 60 696 0.01% 61 744 0.01% 62 904 0.01% 63 1028 0.01% 64 1140 0.01% 65 1189 0.01% 66 1222 0.01% 67 1323 0.01% 68 1559 0.01% 69 1774 0.01% 70 2093 0.02% 71 2562 0.02% 72 2996 0.02% 73 3514 0.03% 74 3814 0.03% 75 4485 0.03% 76 8283 0.06% 77 8012 0.06% 78 5236 0.04% 79 5466 0.04% 80 5967 0.04% 81 7247 0.05% 82 8411 0.06% 83 9987 0.07% 84 12140 0.09% 85 11775 0.08% 86 11853 0.09% 87 12766 0.09% 88 12832 0.09% 89 13912 0.10% 90 15211 0.11% 91 16919 0.12% 92 18362 0.13% 93 20607 0.15% 94 21810 0.16% 95 23059 0.17% 96 23093 0.17% 97 22808 0.16% 98 23328 0.17% 99 24146 0.17% 100 25816 0.19% 101 27759 0.20% 102 31195 0.22% 103 33589 0.24% 104 35657 0.26% 105 36953 0.27% 106 37577 0.27% 107 37460 0.27% 108 37001 0.27% 109 37487 0.27% 110 38701 0.28% 111 41416 0.30% 112 43861 0.32% 113 47158 0.34% 114 50551 0.36% 115 52551 0.38% 116 53372 0.38% 117 53195 0.38% 118 52686 0.38% 119 52056 0.38% 120 53771 0.39% 121 56168 0.40% 122 58939 0.42% 123 63361 0.46% 124 66881 0.48% 125 70605 0.51% 126 72546 0.52% 127 72673 0.52% 128 72524 0.52% 129 73709 0.53% 130 75015 0.54% 131 77361 0.56% 132 81577 0.59% 133 87857 0.63% 134 94644 0.68% 135 101184 0.73% 136 105285 0.76% 137 110625 0.80% 138 115385 0.83% 139 119758 0.86% 140 126811 0.91% 141 137227 0.99% 142 152047 1.10% 143 171603 1.24% 144 198613 1.43% 145 234437 1.69% 146 290505 2.09% 147 377497 2.72% 148 559562 4.03% 149 1036375 7.47% 150 3410537 24.57% 151 4350245 31.34% 13881146 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.90 fanout-score-rank=18 prefix-density=0.47 prefix-fanout=2.5 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=92.90 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=21 prefix-density=0.65 prefix-fanout=2.2 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.22 sequence-density-rank=22 fanout-score=11.75 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=7.0 sequence=AGAAGCAAGCAAAGTTGAGTGCT SRR7170829 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:55:40 Started mapping on | Feb 13 17:55:40 Finished on | Feb 13 17:57:34 Mapping speed, Million of reads per hour | 438.35 Number of input reads | 13881146 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 12877130 Uniquely mapped reads % | 92.77% Average mapped length | 285.92 Number of splices: Total | 11457709 Number of splices: Annotated (sjdb) | 11179892 Number of splices: GT/AG | 11239572 Number of splices: GC/AG | 160253 Number of splices: AT/AC | 8642 Number of splices: Non-canonical | 49242 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368212 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 19724 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 656619 656619 656619 N_multimapping 368212 368212 368212 N_noFeature 466501 12578406 577821 N_ambiguous 278785 1269 90652 UnstrandedReadsAssigned:12131844 PositiveStrandReadsAssigned:297455 NegativeStrandReadsAssigned:12208657 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170829 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170829-trimmed-pair1.fastq SRR7170829-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,881,146 reads, 12,184,150 reads pseudoaligned [quant] estimated average fragment length: 211.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR7170829.ke.tsv 34699 SRR7170829.se.tsv 87100 total ==> SRR7170829.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1807.35 783 26.8737 Potri.005G024800.1.v4.1 1035 824.351 568 42.741 Potri.004G059700.1.v4.1 961 750.367 4 0.33067 Potri.007G009000.2.v4.1 1416 1205.35 0 0 Potri.003G141000.2.v4.1 2943 2732.35 771.268 17.5096 Potri.016G087400.1.v4.1 270 96.8274 1233 789.902 Potri.015G069301.1.v4.1 564 356.834 0 0 Potri.010G195200.1.v4.1 1773 1562.35 429.984 17.0719 Potri.012G127500.1.v4.1 977 766.356 79 6.39447 ==> SRR7170829.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 526 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 56 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR7170829 completed mapping pipeline successfully