Starting /dee2/code/volunteer_pipeline.sh SRR7170830 current disk space = 3087702536192 free memory = 1577251408 SRR7170830 SRAfilesize b08d092424df11e12f0cae969ec46724 SRR7170830.sra SRR7170830.sra file validated SRR7170830 is paired end SRR7170830 is conventional basespace SRR7170830 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170830_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58225 34.0 33.0 34.0 33.0 34.0 2 33.34675 34.0 33.0 34.0 33.0 34.0 3 33.34775 34.0 34.0 34.0 33.0 34.0 4 33.4935 34.0 34.0 34.0 33.0 34.0 5 33.45875 34.0 34.0 34.0 33.0 34.0 6 37.07475 38.0 37.0 38.0 36.0 38.0 7 37.32825 38.0 38.0 38.0 37.0 38.0 8 37.50825 38.0 38.0 38.0 37.0 38.0 9 37.47725 38.0 38.0 38.0 37.0 38.0 10-14 37.5181 38.0 38.0 38.0 38.0 38.0 15-19 37.507349999999995 38.0 38.0 38.0 37.8 38.0 20-24 37.5153 38.0 38.0 38.0 37.4 38.0 25-29 37.43745 38.0 38.0 38.0 37.4 38.0 30-34 37.366200000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.299099999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.263799999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.18390000000001 38.0 38.0 38.0 36.6 38.0 50-54 37.1237 38.0 38.0 38.0 36.0 38.0 55-59 37.03915 38.0 38.0 38.0 36.0 38.0 60-64 36.92795 38.0 38.0 38.0 36.0 38.0 65-69 37.012 38.0 38.0 38.0 36.0 38.0 70-74 36.900150000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.7019 38.0 38.0 38.0 35.0 38.0 80-84 36.5153 38.0 38.0 38.0 34.6 38.0 85-89 36.4202 38.0 38.0 38.0 34.0 38.0 90-94 36.28365 38.0 37.8 38.0 33.8 38.0 95-99 36.055099999999996 38.0 37.2 38.0 33.0 38.0 100-104 35.97279999999999 38.0 37.0 38.0 32.6 38.0 105-109 35.82755000000001 38.0 37.0 38.0 32.2 38.0 110-114 35.7789 38.0 37.0 38.0 31.0 38.0 115-119 35.400999999999996 38.0 36.4 38.0 30.2 38.0 120-124 35.29950000000001 38.0 36.0 38.0 29.4 38.0 125-129 34.83525 38.0 35.8 38.0 27.6 38.0 130-134 34.51645 38.0 34.6 38.0 26.2 38.0 135-139 34.0852 38.0 34.4 38.0 23.4 38.0 140-144 33.51465 38.0 33.0 38.0 21.4 38.0 145-149 32.52985 38.0 33.0 38.0 13.4 38.0 150-151 27.663125 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 3.0 9 0.0 10 0.0 11 2.0 12 1.0 13 0.0 14 2.0 15 2.0 16 1.0 17 3.0 18 10.0 19 5.0 20 6.0 21 6.0 22 4.0 23 5.0 24 18.0 25 17.0 26 14.0 27 15.0 28 34.0 29 35.0 30 53.0 31 66.0 32 75.0 33 117.0 34 167.0 35 335.0 36 821.0 37 2181.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 26.402470406587753 12.789500772002057 22.15645908389089 38.651569737519296 2 21.4 20.424999999999997 34.325 23.849999999999998 3 19.975 26.424999999999997 26.1 27.500000000000004 4 20.075000000000003 35.575 23.549999999999997 20.8 5 20.974999999999998 35.525 24.5 19.0 6 18.7 37.1 24.525 19.675 7 15.174999999999999 23.400000000000002 43.175000000000004 18.25 8 19.2 22.55 30.275000000000002 27.975 9 16.55 25.474999999999998 32.175 25.8 10-14 18.765 30.380000000000003 26.810000000000002 24.044999999999998 15-19 19.134999999999998 29.134999999999998 28.555000000000003 23.175 20-24 19.185 29.215000000000003 28.43 23.169999999999998 25-29 19.405 29.45 27.985 23.16 30-34 19.15 29.79 27.675 23.385 35-39 19.530976548827443 29.561478073903697 27.156357817890896 23.751187559377968 40-44 19.189999999999998 29.160000000000004 28.139999999999997 23.51 45-49 19.53597679883994 28.991449572478622 28.281414070703537 23.1911595579779 50-54 19.675 28.625 27.875 23.825 55-59 19.509999999999998 29.275000000000002 27.689999999999998 23.525 60-64 19.765 28.7 28.115000000000002 23.419999999999998 65-69 19.415 29.799999999999997 26.895000000000003 23.89 70-74 19.56 29.09 27.975 23.375 75-79 19.42 29.2 27.555000000000003 23.825 80-84 19.645000000000003 29.15 27.36 23.845 85-89 19.28 29.075 27.67 23.974999999999998 90-94 19.220000000000002 29.375 27.305 24.099999999999998 95-99 19.765 28.799999999999997 28.09 23.345 100-104 19.325 29.294999999999998 27.495000000000005 23.885 105-109 19.775000000000002 28.18 28.000000000000004 24.044999999999998 110-114 20.015 28.470000000000002 27.68 23.835 115-119 20.325 28.93 27.57 23.175 120-124 20.195 29.215000000000003 27.060000000000002 23.53 125-129 20.215 28.655 27.389999999999997 23.74 130-134 20.235 28.355000000000004 28.060000000000002 23.35 135-139 19.830000000000002 28.754999999999995 27.72 23.695 140-144 19.96 28.485 27.625 23.93 145-149 20.185 28.28 27.675 23.86 150-151 20.3875 28.8625 26.950000000000003 23.799999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.5 19 1.5 20 2.5 21 3.5 22 4.0 23 5.5 24 6.0 25 7.0 26 8.5 27 9.0 28 15.0 29 16.0 30 24.0 31 36.0 32 40.5 33 61.0 34 89.5 35 94.0 36 101.5 37 136.5 38 150.0 39 165.0 40 190.0 41 224.5 42 260.0 43 261.0 44 244.0 45 242.5 46 253.0 47 255.5 48 227.0 49 180.5 50 140.0 51 118.0 52 104.0 53 78.0 54 62.0 55 48.0 56 36.5 57 24.5 58 17.0 59 14.5 60 10.5 61 7.0 62 4.0 63 3.5 64 3.0 65 1.0 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57221942627076 98.925 2 0.35228988424760943 0.7000000000000001 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.025163563160543533 0.125 6 0.0 0.0 7 0.025163563160543533 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 7 (97% over 38bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACGAGATTCCATCTCGTATG 5 0.125 TruSeq Adapter, Index 7 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.875 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 1.0499999999999998 0.0 0.0 0.0 0.0 130-131 1.125 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.3624999999999998 0.0 0.0 0.0 0.0 136-137 1.4875 0.0 0.0 0.0 0.0 138-139 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170830 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170830_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92175 33.0 33.0 34.0 32.0 34.0 2 32.99625 34.0 33.0 34.0 32.0 34.0 3 32.95025 34.0 33.0 34.0 32.0 34.0 4 32.941 34.0 33.0 34.0 32.0 34.0 5 33.03225 34.0 33.0 34.0 32.0 34.0 6 37.158 38.0 38.0 38.0 37.0 38.0 7 37.212 38.0 38.0 38.0 37.0 38.0 8 37.0745 38.0 38.0 38.0 37.0 38.0 9 37.05575 38.0 38.0 38.0 37.0 38.0 10-14 37.05825 38.0 38.0 38.0 37.0 38.0 15-19 37.09995 38.0 38.0 38.0 37.0 38.0 20-24 36.99415 38.0 38.0 38.0 37.0 38.0 25-29 37.012699999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.97825 38.0 38.0 38.0 36.8 38.0 35-39 36.965650000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.941700000000004 38.0 38.0 38.0 37.0 38.0 45-49 36.94995 38.0 38.0 38.0 36.8 38.0 50-54 36.87185 38.0 38.0 38.0 36.2 38.0 55-59 36.89325 38.0 38.0 38.0 36.0 38.0 60-64 36.827149999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.7493 38.0 38.0 38.0 36.0 38.0 70-74 36.71825 38.0 38.0 38.0 35.8 38.0 75-79 36.718399999999995 38.0 38.0 38.0 35.6 38.0 80-84 36.41969999999999 38.0 38.0 38.0 34.8 38.0 85-89 36.38555 38.0 38.0 38.0 34.8 38.0 90-94 36.38549999999999 38.0 38.0 38.0 34.8 38.0 95-99 36.15415 38.0 38.0 38.0 34.0 38.0 100-104 36.120850000000004 38.0 38.0 38.0 33.8 38.0 105-109 35.804500000000004 38.0 37.8 38.0 33.0 38.0 110-114 35.77139999999999 38.0 37.6 38.0 33.0 38.0 115-119 35.549 38.0 37.2 38.0 31.4 38.0 120-124 35.3464 38.0 37.0 38.0 30.6 38.0 125-129 35.1212 38.0 36.2 38.0 28.6 38.0 130-134 34.65045 38.0 35.8 38.0 27.2 38.0 135-139 34.038850000000004 38.0 34.2 38.0 23.0 38.0 140-144 33.477549999999994 38.0 33.0 38.0 20.8 38.0 145-149 32.754599999999996 38.0 33.0 38.0 12.4 38.0 150-151 28.166249999999998 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 6.0 4 0.0 5 1.0 6 0.0 7 2.0 8 0.0 9 0.0 10 2.0 11 4.0 12 3.0 13 3.0 14 4.0 15 3.0 16 6.0 17 4.0 18 3.0 19 8.0 20 13.0 21 16.0 22 11.0 23 10.0 24 10.0 25 15.0 26 29.0 27 21.0 28 21.0 29 42.0 30 39.0 31 48.0 32 67.0 33 80.0 34 147.0 35 231.0 36 590.0 37 2547.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.625 15.25 26.950000000000003 30.175 2 27.750000000000004 20.974999999999998 33.775 17.5 3 21.9 24.55 32.800000000000004 20.75 4 23.724999999999998 32.925 23.5 19.85 5 24.825 34.5 22.75 17.925 6 21.7 35.65 23.925 18.725 7 18.575 18.5 43.375 19.55 8 23.7 24.675 26.974999999999998 24.65 9 21.725 24.425 28.925 24.925 10-14 23.015 28.849999999999998 26.995 21.14 15-19 22.545 28.15 28.485 20.82 20-24 22.91 28.63 28.084999999999997 20.375 25-29 22.835 28.155 28.715000000000003 20.294999999999998 30-34 22.830000000000002 27.884999999999998 28.34 20.945 35-39 23.035 28.125 28.035 20.805 40-44 22.665 28.199999999999996 28.415000000000003 20.72 45-49 22.869999999999997 27.900000000000002 28.57 20.66 50-54 23.5 28.095 27.77 20.635 55-59 23.425 28.134999999999998 27.935 20.505000000000003 60-64 23.395 27.965 28.015 20.625 65-69 22.755 28.13 28.645 20.47 70-74 23.14 28.360000000000003 27.845 20.655 75-79 23.43 27.36 28.904999999999998 20.305 80-84 23.385 28.244999999999997 28.15 20.22 85-89 23.27 28.255000000000003 27.98 20.495 90-94 23.244999999999997 28.335 27.93 20.49 95-99 23.61 27.845 28.235 20.31 100-104 24.02 28.655 27.54 19.785 105-109 23.445 28.08 28.144999999999996 20.330000000000002 110-114 23.785 28.26 28.175 19.78 115-119 23.745 28.165000000000003 27.71 20.380000000000003 120-124 23.990000000000002 27.88 27.925 20.205000000000002 125-129 23.69 28.095 27.83 20.385 130-134 23.57 28.000000000000004 28.165000000000003 20.265 135-139 23.25 28.325 27.99 20.435 140-144 23.68 28.215 27.689999999999998 20.415 145-149 23.355 27.810000000000002 28.395 20.44 150-151 23.799999999999997 27.6125 28.787499999999998 19.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 2.5 21 4.0 22 3.5 23 2.0 24 3.0 25 3.5 26 6.5 27 10.0 28 10.5 29 14.0 30 20.0 31 22.0 32 27.5 33 35.0 34 51.0 35 72.0 36 87.5 37 112.5 38 132.0 39 167.0 40 201.0 41 224.5 42 262.5 43 279.0 44 273.5 45 272.5 46 273.0 47 249.5 48 218.5 49 194.0 50 168.0 51 129.5 52 95.0 53 88.5 54 69.5 55 48.5 56 46.0 57 33.5 58 19.5 59 17.0 60 13.5 61 9.5 62 7.0 63 3.5 64 4.0 65 2.5 66 0.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.444724886421 98.5 2 0.3281171125694094 0.65 3 0.10095911155981827 0.3 4 0.10095911155981827 0.4 5 0.0 0.0 6 0.025239777889954566 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 6 0.15 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.025 0.0 104-105 0.21250000000000002 0.0 0.0 0.025 0.0 106-107 0.2625 0.0 0.0 0.025 0.0 108-109 0.3375 0.0 0.0 0.025 0.0 110-111 0.44999999999999996 0.0 0.0 0.025 0.0 112-113 0.4875 0.0 0.0 0.025 0.0 114-115 0.575 0.0 0.0 0.025 0.0 116-117 0.6625000000000001 0.0 0.0 0.025 0.0 118-119 0.7125 0.0 0.0 0.025 0.0 120-121 0.8 0.0 0.0 0.025 0.0 122-123 0.825 0.0 0.0 0.025 0.0 124-125 0.875 0.0 0.0 0.025 0.0 126-127 0.9624999999999999 0.0 0.0 0.025 0.0 128-129 1.0499999999999998 0.0 0.0 0.025 0.0 130-131 1.1375 0.0 0.0 0.025 0.0 132-133 1.2625000000000002 0.0 0.0 0.025 0.0 134-135 1.375 0.0 0.0 0.025 0.0 136-137 1.4625 0.0 0.0 0.025 0.0 138-139 1.55 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCCTGC 10 0.006830828 145.0 9 >>END_MODULE Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra Read 488621 spots for SRR7170830.sra Written 488621 spots for SRR7170830.sra Read 488608 spots for SRR7170830.sra Written 488608 spots for SRR7170830.sra SRR ids: ['SRR7170830.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9a8cs4vm SRR7170830.sra spots: 9772173 blocks: [[1, 488608], [488609, 977216], [977217, 1465824], [1465825, 1954432], [1954433, 2443040], [2443041, 2931648], [2931649, 3420256], [3420257, 3908864], [3908865, 4397472], [4397473, 4886080], [4886081, 5374688], [5374689, 5863296], [5863297, 6351904], [6351905, 6840512], [6840513, 7329120], [7329121, 7817728], [7817729, 8306336], [8306337, 8794944], [8794945, 9283552], [9283553, 9772173]] SRR7170830 file size 3290213 SRR7170830 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170830 SRR7170830_1.fastq SRR7170830_2.fastq Input file: SRR7170830_1.fastq Paired file: SRR7170830_2.fastq trimmed: SRR7170830-trimmed-pair1.fastq, SRR7170830-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:48:55 2025 >> started Thu Feb 13 18:49:06 2025 >> done (11.661s) 9772173 read pairs processed; of these: 14362 ( 0.15%) short read pairs filtered out after trimming by size control 64286 ( 0.66%) empty read pairs filtered out after trimming by size control 9693525 (99.20%) read pairs available; of these: 5717543 (58.98%) trimmed read pairs available after processing 3975982 (41.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 11 0.00% 20 7 0.00% 21 7 0.00% 22 9 0.00% 23 11 0.00% 24 6 0.00% 25 9 0.00% 26 12 0.00% 27 14 0.00% 28 8 0.00% 29 14 0.00% 30 19 0.00% 31 13 0.00% 32 15 0.00% 33 15 0.00% 34 19 0.00% 35 17 0.00% 36 15 0.00% 37 10 0.00% 38 19 0.00% 39 22 0.00% 40 19 0.00% 41 19 0.00% 42 27 0.00% 43 20 0.00% 44 32 0.00% 45 49 0.00% 46 52 0.00% 47 121 0.00% 48 51 0.00% 49 37 0.00% 50 39 0.00% 51 45 0.00% 52 54 0.00% 53 67 0.00% 54 59 0.00% 55 54 0.00% 56 63 0.00% 57 79 0.00% 58 89 0.00% 59 104 0.00% 60 99 0.00% 61 131 0.00% 62 138 0.00% 63 176 0.00% 64 132 0.00% 65 122 0.00% 66 154 0.00% 67 160 0.00% 68 208 0.00% 69 204 0.00% 70 221 0.00% 71 258 0.00% 72 335 0.00% 73 410 0.00% 74 590 0.01% 75 939 0.01% 76 3353 0.03% 77 4746 0.05% 78 2137 0.02% 79 1355 0.01% 80 1153 0.01% 81 1076 0.01% 82 1074 0.01% 83 1253 0.01% 84 1697 0.02% 85 1905 0.02% 86 1920 0.02% 87 2158 0.02% 88 2332 0.02% 89 2434 0.03% 90 2456 0.03% 91 2509 0.03% 92 2777 0.03% 93 2867 0.03% 94 2985 0.03% 95 2967 0.03% 96 3236 0.03% 97 3360 0.03% 98 3564 0.04% 99 3607 0.04% 100 3718 0.04% 101 3960 0.04% 102 4233 0.04% 103 4506 0.05% 104 4855 0.05% 105 5151 0.05% 106 5364 0.06% 107 5477 0.06% 108 5836 0.06% 109 6276 0.06% 110 6775 0.07% 111 7120 0.07% 112 7647 0.08% 113 8015 0.08% 114 8424 0.09% 115 8963 0.09% 116 9559 0.10% 117 10267 0.11% 118 10788 0.11% 119 11317 0.12% 120 12169 0.13% 121 12725 0.13% 122 13872 0.14% 123 14266 0.15% 124 15719 0.16% 125 16895 0.17% 126 18197 0.19% 127 19358 0.20% 128 20864 0.22% 129 22440 0.23% 130 24527 0.25% 131 25874 0.27% 132 28231 0.29% 133 30906 0.32% 134 33507 0.35% 135 36882 0.38% 136 40345 0.42% 137 44834 0.46% 138 48979 0.51% 139 55268 0.57% 140 62523 0.64% 141 70612 0.73% 142 82051 0.85% 143 97812 1.01% 144 117796 1.22% 145 144971 1.50% 146 189367 1.95% 147 263011 2.71% 148 407630 4.21% 149 788310 8.13% 150 2754796 28.42% 151 3975982 41.02% 9693525 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=5.56 fanout-score-rank=17 prefix-density=0.40 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCAACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=42.06 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.9 sequence=AATTTTATTGCGCATACAGAGATTACATAACTCTGAATAAAAAGACTACAAAACGTTCATAGGTAACATTTACAGGATTGCAATAGTACTAAAGGAAACCTGTAGCATATGCATATCTGCCATGGCTCACTCGGAGCTTTTATTTAATTTCCAACGACCATATAATTACATTGGTAATGGAAATGAAAGTAATAGATAGCCCTGGTGCTTTGAGCTCACAGCTTTTACCACTAGATAATGGACCCAAATCAAACTACTCTTTCATTTTCAAGGGCGATGGCAGCTACGCTTGTAA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=34 prefix-density=0.77 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=71.35 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.7 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGC SRR7170830 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:49:53 Started mapping on | Feb 13 18:49:54 Finished on | Feb 13 18:51:11 Mapping speed, Million of reads per hour | 453.20 Number of input reads | 9693525 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 9100008 Uniquely mapped reads % | 93.88% Average mapped length | 294.92 Number of splices: Total | 8901747 Number of splices: Annotated (sjdb) | 8688512 Number of splices: GT/AG | 8743533 Number of splices: GC/AG | 123502 Number of splices: AT/AC | 5819 Number of splices: Non-canonical | 28893 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277981 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 10384 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.09% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 328747 328747 328747 N_multimapping 277981 277981 277981 N_noFeature 314865 8946000 359850 N_ambiguous 188931 779 79665 UnstrandedReadsAssigned:8596212 PositiveStrandReadsAssigned:153229 NegativeStrandReadsAssigned:8660493 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170830 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170830-trimmed-pair1.fastq SRR7170830-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 9,693,525 reads, 8,610,403 reads pseudoaligned [quant] estimated average fragment length: 299.999 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7170830.ke.tsv 34699 SRR7170830.se.tsv 87100 total ==> SRR7170830.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719 1058 59.7178 Potri.005G024800.1.v4.1 1035 736.001 281 37.0444 Potri.004G059700.1.v4.1 961 662.104 3 0.439633 Potri.007G009000.2.v4.1 1416 1117 0 0 Potri.003G141000.2.v4.1 2943 2644 526.436 19.3187 Potri.016G087400.1.v4.1 270 61.9882 806 1261.6 Potri.015G069301.1.v4.1 564 276.002 0 0 Potri.010G195200.1.v4.1 1773 1474 417 27.4494 Potri.012G127500.1.v4.1 977 678.061 100 14.3095 ==> SRR7170830.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 140 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 202 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR7170830 completed mapping pipeline successfully