Starting /dee2/code/volunteer_pipeline.sh SRR7170831 current disk space = 3088385011712 free memory = 1502417568 SRR7170831 SRAfilesize de41f0f580e7098c0fa49be474b7ebfe SRR7170831.sra SRR7170831.sra file validated SRR7170831 is paired end SRR7170831 is conventional basespace SRR7170831 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170831_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.12 34.0 33.0 34.0 32.0 34.0 2 33.149 34.0 33.0 34.0 32.0 34.0 3 33.188 34.0 33.0 34.0 32.0 34.0 4 33.22375 34.0 33.0 34.0 33.0 34.0 5 33.32225 34.0 33.0 34.0 33.0 34.0 6 36.78725 38.0 37.0 38.0 35.0 38.0 7 37.16475 38.0 38.0 38.0 36.0 38.0 8 37.28025 38.0 38.0 38.0 36.0 38.0 9 37.3335 38.0 38.0 38.0 37.0 38.0 10-14 37.3995 38.0 38.0 38.0 37.0 38.0 15-19 37.2981 38.0 38.0 38.0 37.0 38.0 20-24 37.2207 38.0 38.0 38.0 36.4 38.0 25-29 37.2394 38.0 38.0 38.0 36.6 38.0 30-34 37.067449999999994 38.0 38.0 38.0 36.0 38.0 35-39 37.00005 38.0 38.0 38.0 36.0 38.0 40-44 37.02805 38.0 38.0 38.0 36.0 38.0 45-49 36.88115 38.0 38.0 38.0 35.4 38.0 50-54 36.69345 38.0 38.0 38.0 34.6 38.0 55-59 36.56564999999999 38.0 38.0 38.0 34.0 38.0 60-64 36.46495 38.0 38.0 38.0 34.0 38.0 65-69 36.421499999999995 38.0 38.0 38.0 33.8 38.0 70-74 36.35395 38.0 37.8 38.0 34.0 38.0 75-79 36.36055 38.0 37.8 38.0 34.0 38.0 80-84 35.9323 38.0 37.0 38.0 32.6 38.0 85-89 35.99515 38.0 37.0 38.0 33.0 38.0 90-94 35.81535 38.0 37.0 38.0 31.4 38.0 95-99 35.6205 38.0 36.8 38.0 30.6 38.0 100-104 35.1288 38.0 36.0 38.0 28.6 38.0 105-109 34.682 38.0 35.0 38.0 26.2 38.0 110-114 34.17485 38.0 33.8 38.0 23.6 38.0 115-119 33.917699999999996 38.0 33.6 38.0 22.2 38.0 120-124 33.56295 38.0 33.0 38.0 20.4 38.0 125-129 32.71035 38.0 32.4 38.0 15.4 38.0 130-134 32.1136 37.6 31.0 38.0 14.2 38.0 135-139 31.098400000000005 36.8 28.2 38.0 13.0 38.0 140-144 30.634800000000002 36.0 28.2 38.0 10.2 38.0 145-149 28.701100000000004 35.6 24.6 38.0 2.0 38.0 150-151 21.942999999999998 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 3.0 10 3.0 11 0.0 12 2.0 13 5.0 14 1.0 15 0.0 16 4.0 17 5.0 18 6.0 19 13.0 20 14.0 21 8.0 22 6.0 23 22.0 24 23.0 25 40.0 26 36.0 27 32.0 28 52.0 29 79.0 30 85.0 31 101.0 32 138.0 33 194.0 34 283.0 35 502.0 36 1083.0 37 1260.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.54661126980005 17.008569202804466 8.28356271098416 29.161256816411324 2 20.575 19.900000000000002 34.775 24.75 3 17.167167167167165 29.179179179179176 28.87887887887888 24.774774774774773 4 21.025 34.0 24.375 20.599999999999998 5 20.025000000000002 37.35 23.799999999999997 18.825 6 17.125 37.275000000000006 25.6 20.0 7 13.8 23.375 43.875 18.95 8 17.525 23.525 30.125 28.825 9 17.5 22.225 32.65 27.625 10-14 19.64 29.294999999999998 26.55 24.515 15-19 19.835 28.365000000000002 27.92 23.880000000000003 20-24 19.07 28.985 28.555000000000003 23.39 25-29 19.72 28.660000000000004 28.345 23.275000000000002 30-34 19.564999999999998 29.125 27.860000000000003 23.45 35-39 19.915 28.794999999999998 27.875 23.415 40-44 19.744999999999997 28.64 28.185 23.43 45-49 20.04 28.88 27.505000000000003 23.575 50-54 20.185 28.410000000000004 27.994999999999997 23.41 55-59 20.119999999999997 28.71 28.095 23.075000000000003 60-64 20.025000000000002 28.425 28.33 23.22 65-69 19.825 28.87 27.345000000000002 23.96 70-74 19.509999999999998 29.185 28.075 23.23 75-79 20.835 29.099999999999998 26.950000000000003 23.115 80-84 20.005 29.025000000000002 27.42 23.549999999999997 85-89 20.09 28.335 27.935 23.64 90-94 20.615 28.24 28.355000000000004 22.79 95-99 20.43 28.410000000000004 27.544999999999998 23.615 100-104 20.515 28.92 27.450000000000003 23.115 105-109 20.695 28.685 27.310000000000002 23.31 110-114 20.745 29.244999999999997 26.985 23.025000000000002 115-119 20.635 28.754999999999995 27.169999999999998 23.44 120-124 21.22 29.445 26.645000000000003 22.689999999999998 125-129 20.775 28.945 26.900000000000002 23.380000000000003 130-134 20.794999999999998 28.46 26.55 24.195 135-139 21.15 28.555000000000003 26.529999999999998 23.765 140-144 20.7 28.425 26.529999999999998 24.345 145-149 20.86 28.935 26.179999999999996 24.025 150-151 21.55 28.262500000000003 26.275 23.9125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 1.5 18 2.5 19 1.5 20 2.5 21 2.5 22 2.0 23 2.0 24 1.5 25 5.0 26 8.0 27 12.0 28 15.5 29 20.0 30 25.0 31 31.5 32 44.0 33 56.5 34 72.0 35 94.0 36 104.0 37 123.0 38 147.5 39 161.5 40 168.5 41 179.0 42 223.5 43 248.0 44 263.5 45 274.5 46 265.5 47 247.0 48 224.0 49 197.5 50 165.0 51 144.0 52 104.0 53 76.5 54 66.5 55 55.0 56 49.5 57 34.0 58 20.0 59 14.5 60 11.0 61 7.0 62 5.0 63 5.5 64 4.5 65 3.5 66 2.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.7249999999999996 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39409240090886 98.425 2 0.4291845493562232 0.8500000000000001 3 0.07573844988639232 0.22499999999999998 4 0.07573844988639232 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025246149962130777 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 8 0.2 TruSeq Adapter, Index 19 (97% over 38bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5249999999999999 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9874999999999999 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.3375 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.575 0.0 0.0 0.0 0.0 106-107 2.9875 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.5374999999999996 0.0 0.0 0.0 0.0 112-113 3.9625000000000004 0.0 0.0 0.0 0.0 114-115 4.5875 0.0 0.0 0.0 0.0 116-117 5.2125 0.0 0.0 0.0 0.0 118-119 5.9 0.0 0.0 0.0 0.0 120-121 6.3375 0.0 0.0 0.0 0.0 122-123 6.875 0.0 0.0 0.0 0.0 124-125 7.4625 0.0 0.0 0.0 0.0 126-127 8.275 0.0 0.0 0.0 0.0 128-129 8.9875 0.0 0.0 0.0 0.0 130-131 9.7 0.0 0.0 0.0 0.0 132-133 10.325 0.0 0.0 0.0 0.0 134-135 11.024999999999999 0.0 0.0 0.0 0.0 136-137 11.75 0.0 0.0 0.0 0.0 138-139 12.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTGAT 10 0.006830828 145.0 9 GTCACCT 20 0.00593511 29.0 140-144 >>END_MODULE SRR7170831 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170831_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9575 33.0 33.0 34.0 32.0 34.0 2 32.97125 33.0 33.0 34.0 32.0 34.0 3 32.9845 34.0 33.0 34.0 32.0 34.0 4 33.00175 34.0 33.0 34.0 32.0 34.0 5 32.978 34.0 33.0 34.0 32.0 34.0 6 37.12175 38.0 38.0 38.0 37.0 38.0 7 37.17025 38.0 38.0 38.0 37.0 38.0 8 37.151 38.0 38.0 38.0 37.0 38.0 9 37.19825 38.0 38.0 38.0 37.0 38.0 10-14 37.1573 38.0 38.0 38.0 37.0 38.0 15-19 37.12505 38.0 38.0 38.0 36.8 38.0 20-24 37.06695 38.0 38.0 38.0 36.8 38.0 25-29 37.00265 38.0 38.0 38.0 36.6 38.0 30-34 36.96750000000001 38.0 38.0 38.0 36.6 38.0 35-39 36.9525 38.0 38.0 38.0 36.2 38.0 40-44 36.963550000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.98855 38.0 38.0 38.0 36.4 38.0 50-54 36.89704999999999 38.0 38.0 38.0 36.2 38.0 55-59 36.8919 38.0 38.0 38.0 36.0 38.0 60-64 36.80114999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.754200000000004 38.0 38.0 38.0 35.8 38.0 70-74 36.61465 38.0 38.0 38.0 35.0 38.0 75-79 36.5496 38.0 38.0 38.0 34.6 38.0 80-84 36.38845 38.0 38.0 38.0 34.2 38.0 85-89 36.357600000000005 38.0 38.0 38.0 34.2 38.0 90-94 36.20175 38.0 38.0 38.0 33.8 38.0 95-99 35.96725 38.0 37.6 38.0 33.2 38.0 100-104 35.849599999999995 38.0 37.0 38.0 32.6 38.0 105-109 35.6639 38.0 37.0 38.0 31.4 38.0 110-114 35.4504 38.0 37.0 38.0 30.6 38.0 115-119 35.19745 38.0 36.4 38.0 29.0 38.0 120-124 34.885149999999996 38.0 36.0 38.0 27.8 38.0 125-129 34.31415 38.0 34.4 38.0 24.4 38.0 130-134 33.698499999999996 38.0 33.4 38.0 21.8 38.0 135-139 33.17775 38.0 33.0 38.0 19.0 38.0 140-144 32.43180000000001 38.0 33.0 38.0 13.2 38.0 145-149 31.316699999999997 38.0 32.0 38.0 6.4 38.0 150-151 24.99825 32.5 16.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 4.0 5 3.0 6 2.0 7 1.0 8 1.0 9 0.0 10 2.0 11 2.0 12 0.0 13 1.0 14 2.0 15 6.0 16 3.0 17 3.0 18 6.0 19 6.0 20 13.0 21 6.0 22 13.0 23 13.0 24 17.0 25 18.0 26 23.0 27 43.0 28 22.0 29 41.0 30 59.0 31 71.0 32 99.0 33 103.0 34 174.0 35 307.0 36 769.0 37 2154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.325 20.7 11.275 21.7 2 25.224999999999998 24.425 31.275 19.075 3 21.2 26.700000000000003 31.825 20.275000000000002 4 22.425 36.449999999999996 22.95 18.175 5 23.45 38.1 20.474999999999998 17.974999999999998 6 19.725 39.2 22.6 18.475 7 18.25 20.65 40.825 20.275000000000002 8 19.975 24.375 28.4 27.250000000000004 9 20.3 24.925 30.775000000000002 24.0 10-14 23.18 28.675 26.365 21.78 15-19 22.919999999999998 28.610000000000003 28.17 20.3 20-24 22.81 28.294999999999998 28.465 20.43 25-29 22.759999999999998 28.084999999999997 28.345 20.810000000000002 30-34 22.66 28.249999999999996 28.74 20.349999999999998 35-39 22.6 28.605000000000004 27.96 20.835 40-44 22.825 28.005000000000003 28.165000000000003 21.005 45-49 22.08 28.285 28.610000000000003 21.025 50-54 22.585 27.825 29.025000000000002 20.565 55-59 22.884999999999998 27.439999999999998 28.365000000000002 21.310000000000002 60-64 23.04 28.155 28.215 20.59 65-69 22.68 27.655 28.43 21.235 70-74 23.080000000000002 28.32 28.255000000000003 20.345 75-79 22.45 28.444999999999997 27.67 21.435000000000002 80-84 22.85 28.21 27.83 21.11 85-89 22.81 28.04 28.365000000000002 20.785 90-94 23.435 27.815 28.115000000000002 20.635 95-99 22.905 28.405 27.99 20.7 100-104 23.369999999999997 27.650000000000002 28.32 20.66 105-109 23.655 27.900000000000002 28.02 20.424999999999997 110-114 23.41 27.965 28.575 20.05 115-119 24.060000000000002 28.595 27.045 20.3 120-124 24.7 27.675 27.6 20.025000000000002 125-129 24.45 27.950000000000003 27.860000000000003 19.74 130-134 25.655 27.400000000000002 27.400000000000002 19.545 135-139 25.074999999999996 27.82 27.58 19.525000000000002 140-144 25.485000000000003 27.169999999999998 27.589999999999996 19.755 145-149 25.900000000000002 27.66 27.24 19.2 150-151 26.05 28.1125 26.6625 19.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 2.5 24 1.5 25 2.5 26 4.5 27 7.5 28 12.5 29 17.0 30 19.5 31 28.5 32 41.0 33 45.5 34 68.5 35 87.0 36 89.0 37 111.5 38 142.5 39 166.0 40 179.0 41 209.5 42 259.0 43 271.0 44 267.0 45 274.5 46 259.0 47 234.5 48 225.0 49 201.0 50 156.5 51 128.0 52 105.0 53 85.0 54 75.5 55 61.0 56 43.5 57 33.0 58 26.0 59 20.0 60 11.5 61 4.5 62 3.0 63 2.5 64 3.5 65 4.0 66 3.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2909597366422 98.02499999999999 2 0.4558115978728792 0.8999999999999999 3 0.12661433274246645 0.375 4 0.07596859964547988 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.05064573309698658 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5375 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7125 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.7999999999999998 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.625 0.0 0.0 0.0 0.0 106-107 3.0375 0.0 0.0 0.0 0.0 108-109 3.2750000000000004 0.0 0.0 0.0 0.0 110-111 3.6375 0.0 0.0 0.0 0.0 112-113 4.0625 0.0 0.0 0.0 0.0 114-115 4.7 0.0 0.0 0.0 0.0 116-117 5.35 0.0 0.0 0.0 0.0 118-119 6.0375 0.0 0.0 0.0 0.0 120-121 6.5375 0.0 0.0 0.0 0.0 122-123 7.1 0.0 0.0 0.0 0.0 124-125 7.7 0.0 0.0 0.0 0.0 126-127 8.587499999999999 0.0 0.0 0.0 0.0 128-129 9.350000000000001 0.0 0.0 0.0 0.0 130-131 10.075 0.0 0.0 0.0 0.0 132-133 10.75 0.0 0.0 0.0 0.0 134-135 11.4875 0.0 0.0 0.0 0.0 136-137 12.2625 0.0 0.0 0.0 0.0 138-139 13.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAGG 10 0.006830828 145.0 9 TGACTTG 10 0.006830828 145.0 3 GCAACGT 10 0.006830828 145.0 1 >>END_MODULE Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818374 spots for SRR7170831.sra Written 818374 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra Read 818370 spots for SRR7170831.sra Written 818370 spots for SRR7170831.sra SRR ids: ['SRR7170831.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x25arig9 SRR7170831.sra spots: 16367404 blocks: [[1, 818370], [818371, 1636740], [1636741, 2455110], [2455111, 3273480], [3273481, 4091850], [4091851, 4910220], [4910221, 5728590], [5728591, 6546960], [6546961, 7365330], [7365331, 8183700], [8183701, 9002070], [9002071, 9820440], [9820441, 10638810], [10638811, 11457180], [11457181, 12275550], [12275551, 13093920], [13093921, 13912290], [13912291, 14730660], [14730661, 15549030], [15549031, 16367404]] SRR7170831 file size 5524675 SRR7170831 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170831 SRR7170831_1.fastq SRR7170831_2.fastq Input file: SRR7170831_1.fastq Paired file: SRR7170831_2.fastq trimmed: SRR7170831-trimmed-pair1.fastq, SRR7170831-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:14:27 2025 >> started Thu Feb 13 18:14:44 2025 >> done (17.066s) 16367404 read pairs processed; of these: 29408 ( 0.18%) short read pairs filtered out after trimming by size control 42331 ( 0.26%) empty read pairs filtered out after trimming by size control 16295665 (99.56%) read pairs available; of these: 11631718 (71.38%) trimmed read pairs available after processing 4663947 (28.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 23 0.00% 20 24 0.00% 21 22 0.00% 22 32 0.00% 23 40 0.00% 24 40 0.00% 25 31 0.00% 26 47 0.00% 27 45 0.00% 28 44 0.00% 29 46 0.00% 30 36 0.00% 31 34 0.00% 32 45 0.00% 33 52 0.00% 34 51 0.00% 35 59 0.00% 36 54 0.00% 37 57 0.00% 38 57 0.00% 39 64 0.00% 40 87 0.00% 41 70 0.00% 42 81 0.00% 43 89 0.00% 44 87 0.00% 45 102 0.00% 46 112 0.00% 47 130 0.00% 48 155 0.00% 49 167 0.00% 50 229 0.00% 51 245 0.00% 52 288 0.00% 53 310 0.00% 54 339 0.00% 55 334 0.00% 56 400 0.00% 57 377 0.00% 58 524 0.00% 59 589 0.00% 60 715 0.00% 61 766 0.00% 62 821 0.01% 63 1010 0.01% 64 1116 0.01% 65 1218 0.01% 66 1276 0.01% 67 1348 0.01% 68 1563 0.01% 69 1770 0.01% 70 2117 0.01% 71 2484 0.02% 72 3028 0.02% 73 3267 0.02% 74 3546 0.02% 75 4038 0.02% 76 5504 0.03% 77 5592 0.03% 78 5054 0.03% 79 5491 0.03% 80 6224 0.04% 81 7432 0.05% 82 8495 0.05% 83 9746 0.06% 84 11161 0.07% 85 11954 0.07% 86 12785 0.08% 87 13616 0.08% 88 14144 0.09% 89 15047 0.09% 90 16488 0.10% 91 18017 0.11% 92 19601 0.12% 93 22071 0.14% 94 23278 0.14% 95 24595 0.15% 96 24536 0.15% 97 25721 0.16% 98 26253 0.16% 99 27453 0.17% 100 29404 0.18% 101 31723 0.19% 102 34896 0.21% 103 37546 0.23% 104 39338 0.24% 105 40811 0.25% 106 41273 0.25% 107 41922 0.26% 108 42644 0.26% 109 43706 0.27% 110 45415 0.28% 111 48274 0.30% 112 51178 0.31% 113 54227 0.33% 114 57237 0.35% 115 59924 0.37% 116 60914 0.37% 117 61692 0.38% 118 62063 0.38% 119 62628 0.38% 120 64444 0.40% 121 67433 0.41% 122 70851 0.43% 123 75646 0.46% 124 79955 0.49% 125 83083 0.51% 126 86496 0.53% 127 87598 0.54% 128 88539 0.54% 129 91008 0.56% 130 93514 0.57% 131 96992 0.60% 132 103410 0.63% 133 110507 0.68% 134 118413 0.73% 135 126839 0.78% 136 133144 0.82% 137 140572 0.86% 138 148766 0.91% 139 158232 0.97% 140 168044 1.03% 141 182658 1.12% 142 202073 1.24% 143 227438 1.40% 144 264884 1.63% 145 311985 1.91% 146 381066 2.34% 147 499654 3.07% 148 723995 4.44% 149 1304027 8.00% 150 3997657 24.53% 151 4663947 28.62% 16295665 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=10 prefix-density=0.58 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=21.55 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGT criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=0.80 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.31 sequence-density-rank=13 fanout-score=7.01 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=4.4 sequence=AAGAAAGCTTACCCTAAC SRR7170831 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:15:26 Started mapping on | Feb 13 18:15:27 Finished on | Feb 13 18:17:04 Mapping speed, Million of reads per hour | 604.79 Number of input reads | 16295665 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 15393741 Uniquely mapped reads % | 94.47% Average mapped length | 285.81 Number of splices: Total | 14477010 Number of splices: Annotated (sjdb) | 14103447 Number of splices: GT/AG | 14195977 Number of splices: GC/AG | 214561 Number of splices: AT/AC | 9316 Number of splices: Non-canonical | 57156 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397608 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 38754 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.79% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 529979 529979 529979 N_multimapping 397608 397608 397608 N_noFeature 705911 15067160 880625 N_ambiguous 260078 1399 107197 UnstrandedReadsAssigned:14427752 PositiveStrandReadsAssigned:325182 NegativeStrandReadsAssigned:14405919 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170831 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170831-trimmed-pair1.fastq SRR7170831-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,295,665 reads, 14,386,682 reads pseudoaligned [quant] estimated average fragment length: 214.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 989 rounds 52401 SRR7170831.ke.tsv 34699 SRR7170831.se.tsv 87100 total ==> SRR7170831.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1804.07 665 23.7328 Potri.005G024800.1.v4.1 1035 821.066 151 11.8407 Potri.004G059700.1.v4.1 961 747.112 2 0.172355 Potri.007G009000.2.v4.1 1416 1202.07 0 0 Potri.003G141000.2.v4.1 2943 2729.07 706.734 16.6733 Potri.016G087400.1.v4.1 270 95.341 766 517.283 Potri.015G069301.1.v4.1 564 355.103 0 0 Potri.010G195200.1.v4.1 1773 1559.07 122 5.03819 Potri.012G127500.1.v4.1 977 763.097 152 12.8246 ==> SRR7170831.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 482 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 298 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170831 completed mapping pipeline successfully