Starting /dee2/code/volunteer_pipeline.sh SRR7170832 current disk space = 3088722079744 free memory = 1432936884 SRR7170832 SRAfilesize 53515d331c540cf3c91445689d1c8bb6 SRR7170832.sra SRR7170832.sra file validated SRR7170832 is paired end SRR7170832 is conventional basespace SRR7170832 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170832_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3115 34.0 33.0 34.0 31.0 34.0 2 32.87175 34.0 33.0 34.0 31.0 34.0 3 32.84275 34.0 33.0 34.0 30.0 34.0 4 33.166 34.0 33.0 34.0 32.0 34.0 5 33.16475 34.0 33.0 34.0 32.0 34.0 6 36.583 38.0 37.0 38.0 34.0 38.0 7 37.02425 38.0 38.0 38.0 36.0 38.0 8 37.20675 38.0 38.0 38.0 36.0 38.0 9 37.34375 38.0 38.0 38.0 37.0 38.0 10-14 37.35725 38.0 38.0 38.0 37.0 38.0 15-19 37.23225 38.0 38.0 38.0 36.2 38.0 20-24 37.18215 38.0 38.0 38.0 36.2 38.0 25-29 37.211349999999996 38.0 38.0 38.0 36.2 38.0 30-34 37.09305 38.0 38.0 38.0 36.0 38.0 35-39 36.9104 38.0 38.0 38.0 35.6 38.0 40-44 36.804700000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.7913 38.0 38.0 38.0 35.0 38.0 50-54 36.6674 38.0 38.0 38.0 34.4 38.0 55-59 36.61729999999999 38.0 38.0 38.0 34.2 38.0 60-64 36.50665 38.0 37.8 38.0 34.0 38.0 65-69 36.4351 38.0 37.8 38.0 34.0 38.0 70-74 36.35045 38.0 37.4 38.0 33.8 38.0 75-79 36.0801 38.0 37.0 38.0 32.8 38.0 80-84 35.954150000000006 38.0 37.0 38.0 32.8 38.0 85-89 35.701499999999996 38.0 37.0 38.0 31.0 38.0 90-94 35.51515 38.0 36.4 38.0 29.4 38.0 95-99 35.2987 38.0 36.0 38.0 29.0 38.0 100-104 34.673649999999995 38.0 35.2 38.0 26.2 38.0 105-109 34.376000000000005 38.0 34.2 38.0 24.6 38.0 110-114 34.1677 38.0 33.6 38.0 24.2 38.0 115-119 33.75664999999999 38.0 33.2 38.0 22.0 38.0 120-124 32.9178 38.0 32.4 38.0 17.8 38.0 125-129 32.07935 37.2 31.0 38.0 14.0 38.0 130-134 31.423899999999996 36.8 29.4 38.0 13.0 38.0 135-139 30.15 36.0 27.6 38.0 12.2 38.0 140-144 30.03775 36.0 27.8 38.0 7.8 38.0 145-149 28.033749999999998 34.2 21.4 38.0 2.0 38.0 150-151 20.935125 25.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 1.0 9 2.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 5.0 16 2.0 17 1.0 18 14.0 19 15.0 20 15.0 21 11.0 22 23.0 23 17.0 24 26.0 25 25.0 26 35.0 27 49.0 28 56.0 29 75.0 30 91.0 31 100.0 32 160.0 33 229.0 34 334.0 35 619.0 36 1087.0 37 1002.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.553576176548795 14.38447221483648 11.699016219090668 35.36293538952406 2 19.900000000000002 22.45 35.0 22.650000000000002 3 18.682694715752568 28.12421738041573 27.773603806661658 25.41948409717005 4 21.775 34.300000000000004 23.1 20.825 5 20.549999999999997 36.5 24.375 18.575 6 18.7 35.375 26.3 19.625 7 15.049999999999999 22.15 42.8 20.0 8 16.625 23.549999999999997 30.975 28.849999999999998 9 17.349999999999998 23.025000000000002 32.800000000000004 26.825 10-14 20.43 28.65 26.375 24.545 15-19 19.98 28.04 28.134999999999998 23.845 20-24 19.575 28.965000000000003 28.21 23.25 25-29 19.52 28.599999999999998 28.29 23.59 30-34 19.535 28.605000000000004 28.055000000000003 23.805 35-39 20.03 28.715000000000003 27.825 23.43 40-44 19.63 28.98 27.794999999999998 23.595 45-49 19.919999999999998 28.025 28.71 23.345 50-54 19.615 27.74 28.725 23.919999999999998 55-59 20.105 28.215 28.544999999999998 23.135 60-64 20.225 28.76 27.584999999999997 23.43 65-69 20.05 28.799999999999997 27.73 23.419999999999998 70-74 20.44 28.46 28.01 23.09 75-79 19.98 28.59 27.29 24.14 80-84 20.200000000000003 28.46 28.13 23.21 85-89 20.195 28.67 27.810000000000002 23.325000000000003 90-94 20.57 28.610000000000003 27.839999999999996 22.98 95-99 20.745 28.405 27.515 23.335 100-104 20.635 29.060000000000002 27.21 23.095 105-109 20.585 29.015 27.145000000000003 23.255 110-114 20.625 29.060000000000002 27.195000000000004 23.119999999999997 115-119 20.794999999999998 28.444999999999997 27.11 23.65 120-124 21.465 28.305000000000003 26.584999999999997 23.645 125-129 20.655 29.110000000000003 26.465 23.77 130-134 20.474999999999998 28.675 27.05 23.799999999999997 135-139 21.529999999999998 28.455000000000002 26.55 23.465 140-144 21.08 28.810000000000002 26.240000000000002 23.87 145-149 20.49 28.835 26.455000000000002 24.22 150-151 20.6125 29.1875 25.874999999999996 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 1.5 23 2.0 24 4.5 25 5.5 26 8.5 27 10.0 28 12.0 29 15.5 30 19.5 31 26.5 32 36.5 33 46.5 34 69.0 35 91.5 36 96.5 37 105.0 38 134.0 39 173.5 40 207.0 41 234.0 42 257.0 43 272.0 44 254.0 45 248.5 46 265.5 47 237.5 48 218.5 49 199.0 50 149.0 51 120.0 52 99.0 53 84.0 54 74.0 55 55.5 56 41.5 57 32.5 58 25.0 59 23.0 60 16.0 61 7.5 62 5.5 63 4.5 64 2.0 65 1.0 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.975 2 0.0 3 0.17500000000000002 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.5040322580645161 1.0 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025201612903225805 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 27 (97% over 39bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.5 0.0 0.0 0.0 0.0 94-95 1.8125 0.0 0.0 0.0 0.0 96-97 2.2375 0.0 0.0 0.0 0.0 98-99 2.5999999999999996 0.0 0.0 0.0 0.0 100-101 2.9125 0.0 0.0 0.0 0.0 102-103 3.25 0.0 0.0 0.0 0.0 104-105 3.8375 0.0 0.0 0.0 0.0 106-107 4.375 0.0 0.0 0.0 0.0 108-109 4.7375 0.0 0.0 0.0 0.0 110-111 5.2375 0.0 0.0 0.0 0.0 112-113 5.825 0.0 0.0 0.0 0.0 114-115 6.5125 0.0 0.0 0.0 0.0 116-117 7.112500000000001 0.0 0.0 0.0 0.0 118-119 7.800000000000001 0.0 0.0 0.0 0.0 120-121 8.45 0.0 0.0 0.0 0.0 122-123 8.9 0.0 0.0 0.0 0.0 124-125 9.3625 0.0 0.0 0.0 0.0 126-127 10.100000000000001 0.0 0.0 0.0 0.0 128-129 10.9375 0.0 0.0 0.0 0.0 130-131 11.6125 0.0 0.0 0.0 0.0 132-133 12.1875 0.0 0.0 0.0 0.0 134-135 13.0125 0.0 0.0 0.0 0.0 136-137 13.912500000000001 0.0 0.0 0.0 0.0 138-139 14.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATTGT 10 0.0068396386 144.9375 3 AATTGTG 10 0.0068396386 144.9375 4 TCGATCT 20 0.0059476276 28.9875 135-139 >>END_MODULE SRR7170832 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170832_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88625 33.0 33.0 34.0 32.0 34.0 2 32.959 33.0 33.0 34.0 32.0 34.0 3 33.0085 33.0 33.0 34.0 32.0 34.0 4 32.966 34.0 33.0 34.0 32.0 34.0 5 33.01225 34.0 33.0 34.0 32.0 34.0 6 37.18025 38.0 38.0 38.0 37.0 38.0 7 37.20575 38.0 38.0 38.0 37.0 38.0 8 37.1555 38.0 38.0 38.0 37.0 38.0 9 37.24025 38.0 38.0 38.0 37.0 38.0 10-14 37.1883 38.0 38.0 38.0 37.0 38.0 15-19 37.13365 38.0 38.0 38.0 36.6 38.0 20-24 37.106750000000005 38.0 38.0 38.0 36.6 38.0 25-29 37.056650000000005 38.0 38.0 38.0 36.0 38.0 30-34 37.04395 38.0 38.0 38.0 36.2 38.0 35-39 36.99375 38.0 38.0 38.0 36.0 38.0 40-44 36.9743 38.0 38.0 38.0 36.0 38.0 45-49 36.86475 38.0 38.0 38.0 35.8 38.0 50-54 36.817499999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.7931 38.0 38.0 38.0 35.4 38.0 60-64 36.70125 38.0 38.0 38.0 35.0 38.0 65-69 36.57765 38.0 38.0 38.0 34.6 38.0 70-74 36.6192 38.0 38.0 38.0 34.8 38.0 75-79 36.450450000000004 38.0 38.0 38.0 34.0 38.0 80-84 36.29345 38.0 38.0 38.0 34.0 38.0 85-89 36.1865 38.0 38.0 38.0 33.8 38.0 90-94 36.09465 38.0 37.6 38.0 33.6 38.0 95-99 35.93820000000001 38.0 37.2 38.0 33.2 38.0 100-104 35.6897 38.0 37.0 38.0 31.4 38.0 105-109 35.573899999999995 38.0 37.0 38.0 31.0 38.0 110-114 35.34930000000001 38.0 36.8 38.0 29.6 38.0 115-119 34.93815 38.0 35.8 38.0 28.0 38.0 120-124 34.42635 38.0 34.8 38.0 24.8 38.0 125-129 33.89175 38.0 33.6 38.0 22.6 38.0 130-134 33.18575 38.0 33.0 38.0 18.4 38.0 135-139 32.434850000000004 38.0 32.6 38.0 13.4 38.0 140-144 31.322000000000003 37.4 30.4 38.0 12.2 38.0 145-149 29.70955 36.0 28.0 38.0 3.8 38.0 150-151 23.629625 29.5 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 0.0 5 2.0 6 0.0 7 0.0 8 2.0 9 3.0 10 2.0 11 1.0 12 2.0 13 4.0 14 3.0 15 1.0 16 4.0 17 7.0 18 7.0 19 9.0 20 10.0 21 11.0 22 9.0 23 17.0 24 19.0 25 16.0 26 32.0 27 32.0 28 40.0 29 46.0 30 63.0 31 83.0 32 112.0 33 153.0 34 234.0 35 398.0 36 871.0 37 1800.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.550000000000004 18.85 13.950000000000001 28.65 2 24.425 25.525 33.2 16.85 3 20.280070017504375 26.831707926981746 31.98299574893723 20.905226306576644 4 23.030757689422355 35.23380845211303 22.280570142535634 19.454863715928983 5 22.405601400350086 37.90947736934234 23.1807951987997 16.504126031507877 6 19.559779889944974 39.6448224112056 22.861430715357677 17.933966983491743 7 18.25912956478239 19.034517258629315 41.67083541770886 21.03551775887944 8 19.634817408704354 24.58729364682341 28.064032016008007 27.71385692846423 9 20.705176294073517 26.30657664416104 28.782195548887223 24.20605151287822 10-14 22.491245622811405 28.73936968484242 26.348174087043525 22.42121060530265 15-19 22.11326796077647 28.427056233740245 28.53211927156294 20.927556533920352 20-24 22.04653490117588 28.216162121591193 28.416312234175635 21.320990743057294 25-29 22.68314651721377 28.25760608486789 28.68294635708567 20.37630104083267 30-34 21.491118338754063 28.19114335751814 28.901676257192893 21.4160620465349 35-39 22.276707530647986 28.071053289967473 28.89166875156367 20.760570427820866 40-44 22.842131598699027 28.276207155366524 28.41130848136102 20.47035276457343 45-49 22.391271708122716 28.627195836044244 27.751363795605826 21.230168660227218 50-54 22.813250600480384 28.16753402722178 27.767213771016813 21.252001601281027 55-59 22.737052789592195 27.980985739304476 28.14110582937203 21.1408556417313 60-64 22.86715036277208 27.670753064798596 28.396297222917187 21.065799349512133 65-69 22.902176632474355 27.77082812109082 28.541406054540907 20.785589191893923 70-74 23.019170128635068 28.15956754592322 28.189599079032984 20.63166324640873 75-79 23.216699204084698 27.70686289232617 28.527806978024728 20.5486309255644 80-84 23.162371778834125 28.236177132849637 27.600700525394046 21.000750562922192 85-89 23.042281711283465 28.121090818113586 28.13109832374281 20.705529146860144 90-94 22.996847004654423 28.30689154696962 27.906511185626343 20.789750262749614 95-99 23.513513513513516 28.033033033033032 27.927927927927925 20.525525525525527 100-104 23.625081319121254 27.918730921283093 27.663513986888855 20.792673772706802 105-109 24.16675007506756 28.11029926934241 27.384646181563404 20.338304474026625 110-114 24.02503128911139 28.08010012515644 27.95994993742178 19.934918648310386 115-119 24.833558592381237 28.54282424788507 26.64063673224208 19.982980427491615 120-124 25.012516271152496 27.65595273856013 27.55081606087914 19.78071492940823 125-129 25.090108129755706 28.213856627953543 26.546856227472972 20.14917901481778 130-134 24.87484981978374 27.99359231077293 27.24269122947537 19.88886663996796 135-139 25.797086941288356 28.064467691075627 27.08844286500826 19.05000250262776 140-144 25.806128580012018 28.00420588824354 26.51712397356299 19.672541558181454 145-149 26.45248461192013 27.143071610869242 27.273182204874143 19.131261572336484 150-151 27.057793345008758 27.933450087565674 26.244683512634477 18.764073054791094 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.5 20 1.0 21 0.5 22 2.0 23 3.0 24 2.5 25 6.0 26 9.5 27 9.5 28 10.5 29 12.5 30 19.5 31 26.0 32 33.0 33 50.5 34 69.5 35 70.5 36 87.5 37 121.0 38 144.5 39 181.0 40 206.5 41 213.0 42 248.0 43 264.0 44 256.0 45 253.0 46 253.5 47 245.5 48 220.0 49 204.0 50 167.5 51 133.5 52 106.5 53 77.5 54 70.0 55 60.0 56 43.0 57 31.5 58 24.0 59 17.5 60 11.5 61 8.5 62 6.0 63 3.0 64 3.0 65 3.5 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.025 5 0.025 6 0.05 7 0.05 8 0.05 9 0.025 10-14 0.05 15-19 0.06 20-24 0.075 25-29 0.08 30-34 0.075 35-39 0.075 40-44 0.075 45-49 0.095 50-54 0.08 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.105 75-79 0.11499999999999999 80-84 0.075 85-89 0.075 90-94 0.095 95-99 0.1 100-104 0.08499999999999999 105-109 0.09 110-114 0.125 115-119 0.11499999999999999 120-124 0.13 125-129 0.12 130-134 0.12 135-139 0.105 140-144 0.13999999999999999 145-149 0.08499999999999999 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39301972685888 98.25 2 0.3540718259989884 0.7000000000000001 3 0.10116337885685382 0.3 4 0.10116337885685382 0.4 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025290844714213456 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 9 0.22499999999999998 Illumina Single End PCR Primer 1 (96% over 32bp) ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.525 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.475 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.1875 0.0 0.0 0.0 0.0 98-99 2.575 0.0 0.0 0.0 0.0 100-101 2.8875 0.0 0.0 0.0 0.0 102-103 3.2375 0.0 0.0 0.0 0.0 104-105 3.8125 0.0 0.0 0.0 0.0 106-107 4.35 0.0 0.0 0.0 0.0 108-109 4.7375 0.0 0.0 0.0 0.0 110-111 5.25 0.0 0.0 0.0 0.0 112-113 5.825 0.0 0.0 0.0 0.0 114-115 6.5375 0.0 0.0 0.0 0.0 116-117 7.175000000000001 0.0 0.0 0.0 0.0 118-119 7.875 0.0 0.0 0.0 0.0 120-121 8.525 0.0 0.0 0.0 0.0 122-123 8.95 0.0 0.0 0.0 0.0 124-125 9.425 0.0 0.0 0.0 0.0 126-127 10.1625 0.0 0.0 0.0 0.0 128-129 10.9875 0.0 0.0 0.0 0.0 130-131 11.725000000000001 0.0 0.0 0.0 0.0 132-133 12.3625 0.0 0.0 0.0 0.0 134-135 13.2375 0.0 0.0 0.0 0.0 136-137 14.15 0.0 0.0 0.0 0.0 138-139 15.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGTGG 10 0.006830828 145.0 4 GAGAGTG 10 0.006830828 145.0 3 >>END_MODULE Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618458 spots for SRR7170832.sra Written 2618458 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra Read 2618452 spots for SRR7170832.sra Written 2618452 spots for SRR7170832.sra SRR ids: ['SRR7170832.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9aptpdf0 SRR7170832.sra spots: 52369046 blocks: [[1, 2618452], [2618453, 5236904], [5236905, 7855356], [7855357, 10473808], [10473809, 13092260], [13092261, 15710712], [15710713, 18329164], [18329165, 20947616], [20947617, 23566068], [23566069, 26184520], [26184521, 28802972], [28802973, 31421424], [31421425, 34039876], [34039877, 36658328], [36658329, 39276780], [39276781, 41895232], [41895233, 44513684], [44513685, 47132136], [47132137, 49750588], [49750589, 52369046]] SRR7170832 file size 17724450 SRR7170832 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170832 SRR7170832_1.fastq SRR7170832_2.fastq Input file: SRR7170832_1.fastq Paired file: SRR7170832_2.fastq trimmed: SRR7170832-trimmed-pair1.fastq, SRR7170832-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:07:32 2025 >> started Thu Feb 13 18:08:45 2025 >> done (73.004s) 52369046 read pairs processed; of these: 68626 ( 0.13%) short read pairs filtered out after trimming by size control 163585 ( 0.31%) empty read pairs filtered out after trimming by size control 52136835 (99.56%) read pairs available; of these: 38594722 (74.03%) trimmed read pairs available after processing 13542113 (25.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 60 0.00% 19 56 0.00% 20 60 0.00% 21 52 0.00% 22 64 0.00% 23 72 0.00% 24 81 0.00% 25 60 0.00% 26 79 0.00% 27 77 0.00% 28 81 0.00% 29 78 0.00% 30 92 0.00% 31 110 0.00% 32 135 0.00% 33 142 0.00% 34 138 0.00% 35 175 0.00% 36 206 0.00% 37 204 0.00% 38 271 0.00% 39 359 0.00% 40 366 0.00% 41 404 0.00% 42 463 0.00% 43 477 0.00% 44 538 0.00% 45 607 0.00% 46 669 0.00% 47 759 0.00% 48 863 0.00% 49 1150 0.00% 50 1312 0.00% 51 1511 0.00% 52 1694 0.00% 53 1877 0.00% 54 1905 0.00% 55 2006 0.00% 56 2218 0.00% 57 2483 0.00% 58 2895 0.01% 59 3347 0.01% 60 3924 0.01% 61 4532 0.01% 62 5045 0.01% 63 5685 0.01% 64 5970 0.01% 65 6401 0.01% 66 6991 0.01% 67 7711 0.01% 68 8575 0.02% 69 9825 0.02% 70 11565 0.02% 71 13262 0.03% 72 15143 0.03% 73 16903 0.03% 74 18466 0.04% 75 20323 0.04% 76 25294 0.05% 77 27436 0.05% 78 26326 0.05% 79 27451 0.05% 80 30867 0.06% 81 34509 0.07% 82 38643 0.07% 83 43886 0.08% 84 50709 0.10% 85 51858 0.10% 86 53382 0.10% 87 56691 0.11% 88 58929 0.11% 89 62559 0.12% 90 67546 0.13% 91 73813 0.14% 92 80552 0.15% 93 87408 0.17% 94 92961 0.18% 95 97676 0.19% 96 100095 0.19% 97 102256 0.20% 98 104782 0.20% 99 109263 0.21% 100 116462 0.22% 101 121847 0.23% 102 130242 0.25% 103 137967 0.26% 104 143931 0.28% 105 150155 0.29% 106 153055 0.29% 107 155553 0.30% 108 157722 0.30% 109 160892 0.31% 110 165595 0.32% 111 173332 0.33% 112 182006 0.35% 113 190286 0.36% 114 197600 0.38% 115 204704 0.39% 116 209995 0.40% 117 213454 0.41% 118 216845 0.42% 119 219148 0.42% 120 227007 0.44% 121 234667 0.45% 122 242279 0.46% 123 255899 0.49% 124 267352 0.51% 125 276524 0.53% 126 286352 0.55% 127 293465 0.56% 128 301000 0.58% 129 311107 0.60% 130 322332 0.62% 131 335631 0.64% 132 351868 0.67% 133 374123 0.72% 134 398480 0.76% 135 420752 0.81% 136 445749 0.85% 137 471938 0.91% 138 499292 0.96% 139 532660 1.02% 140 570975 1.10% 141 619294 1.19% 142 689597 1.32% 143 779710 1.50% 144 897575 1.72% 145 1064123 2.04% 146 1316930 2.53% 147 1720424 3.30% 148 2466248 4.73% 149 4343830 8.33% 150 12181339 23.36% 151 13542113 25.97% 52136835 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=17 prefix-density=0.33 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.16 sequence-density-rank=18 fanout-score=11.55 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=2.6 sequence=TGCTTGCTTCTAATCTTAA criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=28 prefix-density=0.58 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=72.63 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.2 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7170832 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:09:30 Started mapping on | Feb 13 18:09:30 Finished on | Feb 13 18:14:53 Mapping speed, Million of reads per hour | 581.09 Number of input reads | 52136835 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 49328914 Uniquely mapped reads % | 94.61% Average mapped length | 283.60 Number of splices: Total | 45726856 Number of splices: Annotated (sjdb) | 44533202 Number of splices: GT/AG | 44857610 Number of splices: GC/AG | 660602 Number of splices: AT/AC | 27719 Number of splices: Non-canonical | 180925 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1498826 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 113816 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.23% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1357201 1357201 1357201 N_multimapping 1498826 1498826 1498826 N_noFeature 2186939 48438006 2670172 N_ambiguous 777463 3859 367367 UnstrandedReadsAssigned:46364512 PositiveStrandReadsAssigned:887049 NegativeStrandReadsAssigned:46291375 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=136 echo kmer=131 SRR7170832 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170832-trimmed-pair1.fastq SRR7170832-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,136,835 reads, 46,211,994 reads pseudoaligned [quant] estimated average fragment length: 222.286 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,261 rounds 52401 SRR7170832.ke.tsv 34699 SRR7170832.se.tsv 87100 total ==> SRR7170832.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.71 2893 35.9809 Potri.005G024800.1.v4.1 1035 813.714 1068 29.3294 Potri.004G059700.1.v4.1 961 739.753 39 1.1781 Potri.007G009000.2.v4.1 1416 1194.71 0 0 Potri.003G141000.2.v4.1 2943 2721.71 3207.75 26.3367 Potri.016G087400.1.v4.1 270 99.948 4266 953.783 Potri.015G069301.1.v4.1 564 349.363 0 0 Potri.010G195200.1.v4.1 1773 1551.71 1477.91 21.2833 Potri.012G127500.1.v4.1 977 755.734 398 11.7684 ==> SRR7170832.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1997 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 752 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 749 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 46 SRR7170832 completed mapping pipeline successfully