Starting /dee2/code/volunteer_pipeline.sh SRR7170833 current disk space = 3088750608384 free memory = 1450094916 SRR7170833 SRAfilesize 6efb722ada90b76d47d948fb77bfd7fe SRR7170833.sra SRR7170833.sra file validated SRR7170833 is paired end SRR7170833 is conventional basespace SRR7170833 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170833_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.2695 34.0 33.0 34.0 33.0 34.0 2 33.295 34.0 33.0 34.0 33.0 34.0 3 33.34325 34.0 34.0 34.0 33.0 34.0 4 33.51075 34.0 34.0 34.0 33.0 34.0 5 33.4825 34.0 34.0 34.0 33.0 34.0 6 37.16575 38.0 37.0 38.0 36.0 38.0 7 37.47875 38.0 38.0 38.0 37.0 38.0 8 37.552 38.0 38.0 38.0 38.0 38.0 9 37.6045 38.0 38.0 38.0 38.0 38.0 10-14 37.6133 38.0 38.0 38.0 38.0 38.0 15-19 37.60065 38.0 38.0 38.0 38.0 38.0 20-24 37.577200000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.5458 38.0 38.0 38.0 38.0 38.0 30-34 37.49095 38.0 38.0 38.0 37.8 38.0 35-39 37.4401 38.0 38.0 38.0 37.4 38.0 40-44 37.436 38.0 38.0 38.0 37.0 38.0 45-49 37.36574999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.27775 38.0 38.0 38.0 37.0 38.0 55-59 37.20635 38.0 38.0 38.0 36.6 38.0 60-64 37.0811 38.0 38.0 38.0 36.0 38.0 65-69 37.19160000000001 38.0 38.0 38.0 36.2 38.0 70-74 37.0293 38.0 38.0 38.0 36.0 38.0 75-79 36.857749999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.6513 38.0 38.0 38.0 35.2 38.0 85-89 36.6021 38.0 38.0 38.0 34.6 38.0 90-94 36.43265 38.0 38.0 38.0 34.0 38.0 95-99 36.34505 38.0 38.0 38.0 34.0 38.0 100-104 36.28075 38.0 38.0 38.0 34.0 38.0 105-109 36.1426 38.0 37.6 38.0 33.6 38.0 110-114 36.05595000000001 38.0 37.2 38.0 33.4 38.0 115-119 35.75875 38.0 37.0 38.0 31.8 38.0 120-124 35.62215 38.0 36.8 38.0 31.0 38.0 125-129 35.25020000000001 38.0 36.0 38.0 29.4 38.0 130-134 34.9426 38.0 35.6 38.0 28.2 38.0 135-139 34.5263 38.0 34.8 38.0 26.4 38.0 140-144 34.0641 38.0 33.2 38.0 24.6 38.0 145-149 33.2448 38.0 33.0 38.0 18.6 38.0 150-151 28.737625 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 2.0 16 1.0 17 5.0 18 3.0 19 12.0 20 5.0 21 7.0 22 5.0 23 9.0 24 6.0 25 9.0 26 14.0 27 24.0 28 23.0 29 32.0 30 38.0 31 43.0 32 65.0 33 102.0 34 158.0 35 285.0 36 737.0 37 2411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.689906347554626 17.221644120707598 10.58792924037461 29.500520291363163 2 19.85 21.375 36.65 22.125 3 17.275 28.849999999999998 30.275000000000002 23.599999999999998 4 21.175 34.0 24.7 20.125 5 19.825 36.775000000000006 25.474999999999998 17.925 6 19.7 35.8 24.875 19.625 7 14.274999999999999 22.6 43.8 19.325 8 16.925 23.799999999999997 30.425 28.849999999999998 9 17.45 24.349999999999998 31.35 26.85 10-14 19.805 29.270000000000003 26.605 24.32 15-19 19.595000000000002 28.749999999999996 28.51 23.145 20-24 19.830000000000002 29.555 27.82 22.795 25-29 19.66 29.43 27.825 23.085 30-34 19.55 29.07 28.084999999999997 23.294999999999998 35-39 19.746974697469746 28.83288328832883 27.97779777977798 23.442344234423445 40-44 19.675 29.285 28.185 22.855 45-49 19.7 29.13 27.965 23.205000000000002 50-54 20.64 27.91 28.03 23.419999999999998 55-59 20.025000000000002 28.389999999999997 27.83 23.755000000000003 60-64 19.955000000000002 28.705000000000002 28.199999999999996 23.14 65-69 19.994999999999997 28.560000000000002 28.02 23.425 70-74 19.955000000000002 29.275000000000002 27.915 22.855 75-79 19.97 29.14 27.665 23.225 80-84 20.115 29.104999999999997 27.700000000000003 23.080000000000002 85-89 19.965 29.189999999999998 27.750000000000004 23.095 90-94 20.13 29.005 27.744999999999997 23.119999999999997 95-99 20.380000000000003 28.705000000000002 27.76 23.155 100-104 20.175 29.360000000000003 27.18 23.285 105-109 20.724999999999998 28.46 27.58 23.235 110-114 20.77 28.765 27.3 23.165 115-119 20.435 28.525 27.045 23.995 120-124 20.755000000000003 28.395 27.02 23.830000000000002 125-129 20.544999999999998 28.665000000000003 26.965 23.825 130-134 20.66 28.854999999999997 26.995 23.49 135-139 20.645 28.4 26.935 24.02 140-144 20.330000000000002 29.354999999999997 26.479999999999997 23.835 145-149 20.695 28.194999999999997 27.005000000000003 24.104999999999997 150-151 20.1125 28.3375 26.174999999999997 25.374999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 1.5 17 2.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 4.0 24 5.0 25 5.0 26 12.0 27 14.0 28 12.5 29 19.0 30 28.5 31 38.0 32 42.5 33 51.0 34 73.5 35 94.0 36 122.5 37 142.0 38 135.5 39 158.0 40 198.0 41 225.0 42 248.0 43 258.5 44 259.0 45 253.0 46 248.5 47 226.0 48 194.5 49 183.5 50 159.5 51 130.5 52 101.0 53 73.0 54 73.0 55 56.0 56 39.5 57 34.0 58 20.5 59 14.5 60 10.0 61 8.0 62 6.0 63 3.0 64 1.5 65 2.0 66 1.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52104865137383 98.7 2 0.40332745147466603 0.8 3 0.025207965717166627 0.075 4 0.0 0.0 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025207965717166627 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGCTCATTATCTCGTAT 12 0.3 TruSeq Adapter, Index 2 (97% over 37bp) GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.425 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.5750000000000002 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 2.925 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.137499999999999 0.0 0.0 0.0 0.0 118-119 5.725 0.0 0.0 0.0 0.0 120-121 6.2125 0.0 0.0 0.0 0.0 122-123 6.6375 0.0 0.0 0.0 0.0 124-125 7.1875 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.775 0.0 0.0 0.0 0.0 130-131 9.5125 0.0 0.0 0.0 0.0 132-133 10.1625 0.0 0.0 0.0 0.0 134-135 10.8625 0.0 0.0 0.0 0.0 136-137 11.587499999999999 0.0 0.0 0.0 0.0 138-139 12.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170833 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170833_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.06925 33.0 33.0 34.0 32.0 34.0 2 33.126 34.0 33.0 34.0 33.0 34.0 3 33.149 34.0 33.0 34.0 33.0 34.0 4 33.15825 34.0 33.0 34.0 33.0 34.0 5 33.14525 34.0 33.0 34.0 33.0 34.0 6 37.34425 38.0 38.0 38.0 38.0 38.0 7 37.2945 38.0 38.0 38.0 38.0 38.0 8 37.3405 38.0 38.0 38.0 37.0 38.0 9 37.3095 38.0 38.0 38.0 38.0 38.0 10-14 37.3352 38.0 38.0 38.0 38.0 38.0 15-19 37.31395 38.0 38.0 38.0 37.8 38.0 20-24 37.20385 38.0 38.0 38.0 37.0 38.0 25-29 37.237649999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.18294999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.1306 38.0 38.0 38.0 37.0 38.0 40-44 37.118700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.0998 38.0 38.0 38.0 37.0 38.0 50-54 37.031949999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.0471 38.0 38.0 38.0 37.0 38.0 60-64 37.01825 38.0 38.0 38.0 37.0 38.0 65-69 36.95305 38.0 38.0 38.0 36.6 38.0 70-74 36.9086 38.0 38.0 38.0 36.0 38.0 75-79 36.8467 38.0 38.0 38.0 36.0 38.0 80-84 36.60119999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.5152 38.0 38.0 38.0 35.4 38.0 90-94 36.47035 38.0 38.0 38.0 34.8 38.0 95-99 36.3275 38.0 38.0 38.0 34.2 38.0 100-104 36.25085 38.0 38.0 38.0 34.2 38.0 105-109 36.050799999999995 38.0 38.0 38.0 34.0 38.0 110-114 35.9225 38.0 38.0 38.0 33.6 38.0 115-119 35.77115 38.0 37.8 38.0 33.2 38.0 120-124 35.5078 38.0 37.2 38.0 31.4 38.0 125-129 35.18945 38.0 36.4 38.0 30.4 38.0 130-134 34.695299999999996 38.0 35.8 38.0 27.2 38.0 135-139 34.06914999999999 38.0 34.8 38.0 23.8 38.0 140-144 33.6528 38.0 33.4 38.0 22.0 38.0 145-149 32.80675 38.0 33.0 38.0 11.6 38.0 150-151 27.89575 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 1.0 5 2.0 6 0.0 7 4.0 8 2.0 9 1.0 10 0.0 11 3.0 12 2.0 13 3.0 14 3.0 15 3.0 16 5.0 17 3.0 18 4.0 19 4.0 20 25.0 21 15.0 22 6.0 23 9.0 24 13.0 25 15.0 26 18.0 27 18.0 28 25.0 29 27.0 30 37.0 31 43.0 32 56.0 33 82.0 34 123.0 35 216.0 36 550.0 37 2670.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4 18.875 13.675 22.05 2 25.650000000000002 25.575 31.65 17.125 3 21.075 27.800000000000004 32.1 19.025 4 24.725 35.225 21.8 18.25 5 23.225 37.15 22.85 16.775000000000002 6 20.575 37.025000000000006 24.25 18.15 7 19.075 19.575 39.675 21.675 8 20.125 25.374999999999996 27.500000000000004 27.0 9 21.525 26.5 28.249999999999996 23.724999999999998 10-14 23.435 28.360000000000003 26.724999999999998 21.48 15-19 22.725 28.065 28.660000000000004 20.549999999999997 20-24 22.470000000000002 29.049999999999997 28.15 20.330000000000002 25-29 22.835 28.235 28.675 20.255000000000003 30-34 22.465 28.305000000000003 28.804999999999996 20.424999999999997 35-39 22.86 27.91 28.485 20.745 40-44 22.66 28.58 28.415000000000003 20.345 45-49 22.919999999999998 27.74 28.64 20.7 50-54 23.225 27.935 28.494999999999997 20.345 55-59 22.78 28.050000000000004 28.505000000000003 20.665 60-64 23.01 27.35 28.389999999999997 21.25 65-69 22.650000000000002 27.200000000000003 28.87 21.279999999999998 70-74 22.805 28.04 28.165000000000003 20.990000000000002 75-79 22.6 28.134999999999998 28.42 20.845 80-84 23.015 28.04 28.07 20.875 85-89 22.695 28.23 28.58 20.495 90-94 22.78 27.62 28.7 20.9 95-99 23.27 27.994999999999997 28.24 20.495 100-104 23.195 28.16 28.28 20.365 105-109 23.605 28.205000000000002 28.249999999999996 19.939999999999998 110-114 23.665 27.925 28.02 20.39 115-119 24.81 28.33 27.12 19.74 120-124 24.26 28.29 28.115000000000002 19.335 125-129 24.62 27.800000000000004 27.744999999999997 19.835 130-134 24.755 27.900000000000002 27.72 19.625 135-139 25.025 28.294999999999998 27.11 19.57 140-144 25.27 27.875 27.134999999999998 19.72 145-149 25.745 27.935 26.900000000000002 19.42 150-151 25.0625 27.6875 27.3125 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.5 17 1.0 18 1.0 19 1.5 20 2.5 21 2.5 22 3.0 23 4.5 24 6.0 25 7.5 26 7.0 27 8.5 28 14.0 29 17.5 30 17.5 31 21.0 32 30.0 33 47.5 34 62.5 35 72.5 36 93.0 37 110.5 38 129.5 39 174.0 40 216.5 41 240.5 42 248.5 43 259.0 44 264.0 45 255.0 46 256.0 47 241.0 48 215.5 49 188.5 50 151.0 51 125.0 52 111.5 53 92.0 54 71.5 55 57.5 56 47.0 57 38.5 58 27.5 59 17.0 60 13.5 61 10.5 62 7.5 63 5.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34177215189874 98.1 2 0.4556962025316456 0.8999999999999999 3 0.0759493670886076 0.22499999999999998 4 0.0759493670886076 0.3 5 0.0 0.0 6 0.025316455696202535 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025316455696202535 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 13 0.325 Illumina Single End PCR Primer 1 (96% over 33bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.1625 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.5875 0.0 0.0 0.0 0.0 100-101 1.775 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.275 0.0 0.0 0.0 0.0 110-111 3.5999999999999996 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114-115 4.6375 0.0 0.0 0.0 0.0 116-117 5.15 0.0 0.0 0.0 0.0 118-119 5.699999999999999 0.0 0.0 0.0 0.0 120-121 6.2 0.0 0.0 0.0 0.0 122-123 6.6375 0.0 0.0 0.0 0.0 124-125 7.1875 0.0 0.0 0.0 0.0 126-127 7.9125 0.0 0.0 0.0 0.0 128-129 8.725 0.0 0.0 0.0 0.0 130-131 9.4875 0.0 0.0 0.0 0.0 132-133 10.175 0.0 0.0 0.0 0.0 134-135 10.8625 0.0 0.0 0.0 0.0 136-137 11.575 0.0 0.0 0.0 0.0 138-139 12.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608521 spots for SRR7170833.sra Written 608521 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra Read 608517 spots for SRR7170833.sra Written 608517 spots for SRR7170833.sra SRR ids: ['SRR7170833.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ncsstxaa SRR7170833.sra spots: 12170344 blocks: [[1, 608517], [608518, 1217034], [1217035, 1825551], [1825552, 2434068], [2434069, 3042585], [3042586, 3651102], [3651103, 4259619], [4259620, 4868136], [4868137, 5476653], [5476654, 6085170], [6085171, 6693687], [6693688, 7302204], [7302205, 7910721], [7910722, 8519238], [8519239, 9127755], [9127756, 9736272], [9736273, 10344789], [10344790, 10953306], [10953307, 11561823], [11561824, 12170344]] SRR7170833 file size 4102429 SRR7170833 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170833 SRR7170833_1.fastq SRR7170833_2.fastq Input file: SRR7170833_1.fastq Paired file: SRR7170833_2.fastq trimmed: SRR7170833-trimmed-pair1.fastq, SRR7170833-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:54:59 2025 >> started Thu Feb 13 17:55:18 2025 >> done (19.616s) 12170344 read pairs processed; of these: 17771 ( 0.15%) short read pairs filtered out after trimming by size control 50077 ( 0.41%) empty read pairs filtered out after trimming by size control 12102496 (99.44%) read pairs available; of these: 7697758 (63.60%) trimmed read pairs available after processing 4404738 (36.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 8 0.00% 20 18 0.00% 21 12 0.00% 22 17 0.00% 23 20 0.00% 24 16 0.00% 25 25 0.00% 26 24 0.00% 27 28 0.00% 28 29 0.00% 29 31 0.00% 30 33 0.00% 31 40 0.00% 32 29 0.00% 33 42 0.00% 34 42 0.00% 35 46 0.00% 36 39 0.00% 37 59 0.00% 38 69 0.00% 39 59 0.00% 40 94 0.00% 41 80 0.00% 42 109 0.00% 43 120 0.00% 44 87 0.00% 45 113 0.00% 46 138 0.00% 47 154 0.00% 48 190 0.00% 49 233 0.00% 50 279 0.00% 51 328 0.00% 52 342 0.00% 53 398 0.00% 54 415 0.00% 55 403 0.00% 56 396 0.00% 57 487 0.00% 58 530 0.00% 59 597 0.00% 60 753 0.01% 61 912 0.01% 62 1044 0.01% 63 1208 0.01% 64 1240 0.01% 65 1234 0.01% 66 1288 0.01% 67 1410 0.01% 68 1565 0.01% 69 1801 0.01% 70 2116 0.02% 71 2563 0.02% 72 3003 0.02% 73 3331 0.03% 74 3614 0.03% 75 4029 0.03% 76 6598 0.05% 77 6653 0.05% 78 4928 0.04% 79 5117 0.04% 80 5748 0.05% 81 6547 0.05% 82 7592 0.06% 83 8319 0.07% 84 9632 0.08% 85 10428 0.09% 86 10603 0.09% 87 11208 0.09% 88 11554 0.10% 89 11840 0.10% 90 13348 0.11% 91 14490 0.12% 92 15920 0.13% 93 17652 0.15% 94 18786 0.16% 95 19374 0.16% 96 19608 0.16% 97 20055 0.17% 98 19785 0.16% 99 20541 0.17% 100 21901 0.18% 101 23465 0.19% 102 25567 0.21% 103 27653 0.23% 104 28832 0.24% 105 30190 0.25% 106 30072 0.25% 107 30142 0.25% 108 30325 0.25% 109 30213 0.25% 110 31403 0.26% 111 32883 0.27% 112 35280 0.29% 113 37186 0.31% 114 39556 0.33% 115 40604 0.34% 116 41322 0.34% 117 41118 0.34% 118 41179 0.34% 119 41283 0.34% 120 42402 0.35% 121 44028 0.36% 122 45612 0.38% 123 48825 0.40% 124 51344 0.42% 125 53114 0.44% 126 55177 0.46% 127 55076 0.46% 128 55337 0.46% 129 56717 0.47% 130 57080 0.47% 131 59799 0.49% 132 63084 0.52% 133 66485 0.55% 134 70486 0.58% 135 75012 0.62% 136 78387 0.65% 137 82482 0.68% 138 85571 0.71% 139 90785 0.75% 140 94755 0.78% 141 103074 0.85% 142 114003 0.94% 143 129595 1.07% 144 150517 1.24% 145 178143 1.47% 146 219945 1.82% 147 289674 2.39% 148 428390 3.54% 149 811112 6.70% 150 2947941 24.36% 151 4404738 36.40% 12102496 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=15 prefix-density=0.29 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=25 fanout-score=13.29 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=3.1 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=27 prefix-density=0.42 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=28 fanout-score=23.01 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=8.4 sequence=AGCAATGGCAGC SRR7170833 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 17:56:05 Started mapping on | Feb 13 17:56:05 Finished on | Feb 13 17:57:30 Mapping speed, Million of reads per hour | 512.58 Number of input reads | 12102496 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 11359104 Uniquely mapped reads % | 93.86% Average mapped length | 286.83 Number of splices: Total | 10520580 Number of splices: Annotated (sjdb) | 10231926 Number of splices: GT/AG | 10317686 Number of splices: GC/AG | 151680 Number of splices: AT/AC | 7024 Number of splices: Non-canonical | 44190 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 372229 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 33123 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.73% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 388145 388145 388145 N_multimapping 372229 372229 372229 N_noFeature 508676 11151406 612927 N_ambiguous 200417 937 96423 UnstrandedReadsAssigned:10650011 PositiveStrandReadsAssigned:206761 NegativeStrandReadsAssigned:10649754 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR7170833 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170833-trimmed-pair1.fastq SRR7170833-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,102,496 reads, 10,620,338 reads pseudoaligned [quant] estimated average fragment length: 225.702 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7170833.ke.tsv 34699 SRR7170833.se.tsv 87100 total ==> SRR7170833.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.3 1118 59.7421 Potri.005G024800.1.v4.1 1035 810.298 242 28.6195 Potri.004G059700.1.v4.1 961 736.374 3 0.390404 Potri.007G009000.2.v4.1 1416 1191.3 0 0 Potri.003G141000.2.v4.1 2943 2718.3 579.813 20.4401 Potri.016G087400.1.v4.1 270 96.017 1080 1077.87 Potri.015G069301.1.v4.1 564 346.514 0 0 Potri.010G195200.1.v4.1 1773 1548.3 644 39.8586 Potri.012G127500.1.v4.1 977 752.339 119 15.1574 ==> SRR7170833.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 168 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 231 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7170833 completed mapping pipeline successfully