Starting /dee2/code/volunteer_pipeline.sh SRR7170834 current disk space = 3088297357312 free memory = 1540670848 SRR7170834 SRAfilesize 5a0ee06ddfc9135478b5a8d3d7d70b7f SRR7170834.sra SRR7170834.sra file validated SRR7170834 is paired end SRR7170834 is conventional basespace SRR7170834 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170834_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.76175 34.0 33.0 34.0 32.0 34.0 2 33.19575 34.0 33.0 34.0 32.0 34.0 3 33.10975 34.0 33.0 34.0 31.0 34.0 4 33.265 34.0 33.0 34.0 33.0 34.0 5 33.2625 34.0 33.0 34.0 33.0 34.0 6 36.689 38.0 37.0 38.0 34.0 38.0 7 37.14075 38.0 38.0 38.0 36.0 38.0 8 37.287 38.0 38.0 38.0 36.0 38.0 9 37.3035 38.0 38.0 38.0 37.0 38.0 10-14 37.33485 38.0 38.0 38.0 37.0 38.0 15-19 37.29485 38.0 38.0 38.0 36.6 38.0 20-24 37.215199999999996 38.0 38.0 38.0 36.2 38.0 25-29 37.189350000000005 38.0 38.0 38.0 36.4 38.0 30-34 37.10435 38.0 38.0 38.0 36.0 38.0 35-39 37.0154 38.0 38.0 38.0 35.8 38.0 40-44 36.869350000000004 38.0 38.0 38.0 35.2 38.0 45-49 36.8615 38.0 38.0 38.0 35.2 38.0 50-54 36.5928 38.0 38.0 38.0 34.2 38.0 55-59 36.55215 38.0 38.0 38.0 34.0 38.0 60-64 36.477250000000005 38.0 37.8 38.0 34.0 38.0 65-69 36.35425 38.0 37.6 38.0 33.8 38.0 70-74 36.369150000000005 38.0 37.6 38.0 33.6 38.0 75-79 36.156000000000006 38.0 37.0 38.0 33.0 38.0 80-84 36.086850000000005 38.0 37.0 38.0 33.0 38.0 85-89 35.78195 38.0 36.8 38.0 30.8 38.0 90-94 35.59315 38.0 36.6 38.0 30.4 38.0 95-99 35.356100000000005 38.0 36.2 38.0 29.2 38.0 100-104 34.7383 38.0 35.2 38.0 25.8 38.0 105-109 34.620799999999996 38.0 34.8 38.0 25.6 38.0 110-114 34.303 38.0 34.2 38.0 24.2 38.0 115-119 33.931200000000004 38.0 33.2 38.0 22.4 38.0 120-124 33.1577 38.0 33.0 38.0 17.8 38.0 125-129 32.27890000000001 37.8 31.0 38.0 14.0 38.0 130-134 31.56205 36.8 29.2 38.0 13.2 38.0 135-139 30.58155 36.0 28.0 38.0 13.0 38.0 140-144 30.4429 36.0 28.2 38.0 10.0 38.0 145-149 28.504649999999998 35.2 23.8 38.0 2.0 38.0 150-151 21.488625 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 2.0 15 2.0 16 5.0 17 4.0 18 11.0 19 12.0 20 11.0 21 6.0 22 17.0 23 30.0 24 22.0 25 31.0 26 42.0 27 45.0 28 56.0 29 72.0 30 90.0 31 107.0 32 139.0 33 199.0 34 330.0 35 501.0 36 1206.0 37 1056.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.201625190452006 14.601320467242255 11.630269172168614 36.56678517013712 2 20.974999999999998 19.275000000000002 35.949999999999996 23.799999999999997 3 17.981467568244426 27.197595792637113 27.948910593538695 26.872026045579766 4 21.325 34.0 23.1 21.575 5 21.925 36.85 23.65 17.575 6 17.775 38.324999999999996 24.975 18.925 7 13.8 24.925 43.3 17.974999999999998 8 18.4 22.925 30.975 27.700000000000003 9 17.849999999999998 23.799999999999997 33.35 25.0 10-14 19.794999999999998 30.514999999999997 26.090000000000003 23.599999999999998 15-19 19.875 29.299999999999997 27.755000000000003 23.07 20-24 19.595000000000002 29.799999999999997 27.48 23.125 25-29 19.355 30.659999999999997 26.834999999999997 23.150000000000002 30-34 19.71 29.299999999999997 27.71 23.28 35-39 19.744999999999997 29.470000000000002 27.694999999999997 23.09 40-44 20.24 29.775000000000002 27.355 22.63 45-49 20.080000000000002 29.695 27.284999999999997 22.939999999999998 50-54 20.3 29.4 27.634999999999998 22.665 55-59 19.77 29.299999999999997 27.694999999999997 23.235 60-64 20.26 29.375 26.995 23.369999999999997 65-69 20.04 29.74 26.82 23.400000000000002 70-74 20.265 29.360000000000003 27.339999999999996 23.035 75-79 20.255000000000003 29.275000000000002 27.12 23.35 80-84 20.47 29.21 27.189999999999998 23.13 85-89 20.415 29.48 26.840000000000003 23.265 90-94 20.57 29.49 27.05 22.89 95-99 20.585 28.444999999999997 27.52 23.45 100-104 20.585 28.955 27.565 22.895 105-109 20.855 28.465 27.555000000000003 23.125 110-114 20.52 28.845 26.91 23.724999999999998 115-119 21.48 28.439999999999998 26.85 23.23 120-124 20.815 28.77 26.41 24.005000000000003 125-129 21.115000000000002 28.865000000000002 26.55 23.47 130-134 21.335 29.68 25.955000000000002 23.03 135-139 21.42 28.355000000000004 26.150000000000002 24.075 140-144 21.48 28.78 26.375 23.365 145-149 21.0 29.099999999999998 26.265 23.635 150-151 21.875 28.4375 26.1625 23.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 3.0 24 2.5 25 3.5 26 8.0 27 14.5 28 19.5 29 18.5 30 24.5 31 41.5 32 54.0 33 59.5 34 76.5 35 104.0 36 127.0 37 145.0 38 156.0 39 168.0 40 182.5 41 196.5 42 217.5 43 230.5 44 240.0 45 249.0 46 225.0 47 211.5 48 212.5 49 199.0 50 174.0 51 141.0 52 120.5 53 91.5 54 68.5 55 53.0 56 39.0 57 33.5 58 25.5 59 16.0 60 8.5 61 8.5 62 7.5 63 6.0 64 5.0 65 3.0 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.17500000000000002 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6547469151347267 1.3 3 0.0 0.0 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.3125 0.0 0.0 0.0 0.0 98-99 1.575 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.1875 0.0 0.0 0.0 0.0 104-105 2.4749999999999996 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.85 0.0 0.0 0.0 0.0 114-115 4.2625 0.0 0.0 0.0 0.0 116-117 4.8875 0.0 0.0 0.0 0.0 118-119 5.324999999999999 0.0 0.0 0.0 0.0 120-121 5.9125 0.0 0.0 0.0 0.0 122-123 6.625 0.0 0.0 0.0 0.0 124-125 7.5375 0.0 0.0 0.0 0.0 126-127 8.275 0.0 0.0 0.0 0.0 128-129 8.7625 0.0 0.0 0.0 0.0 130-131 9.35 0.0 0.0 0.0 0.0 132-133 10.1 0.0 0.0 0.0 0.0 134-135 10.7625 0.0 0.0 0.0 0.0 136-137 11.625 0.0 0.0 0.0 0.0 138-139 12.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCTC 10 0.0068396386 144.9375 4 >>END_MODULE SRR7170834 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170834_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97925 33.0 33.0 34.0 32.0 34.0 2 33.11425 34.0 33.0 34.0 32.0 34.0 3 33.1165 34.0 33.0 34.0 32.0 34.0 4 33.04625 34.0 33.0 34.0 32.0 34.0 5 33.06825 34.0 33.0 34.0 32.0 34.0 6 37.2535 38.0 38.0 38.0 37.0 38.0 7 37.29275 38.0 38.0 38.0 37.0 38.0 8 37.33 38.0 38.0 38.0 37.0 38.0 9 37.33825 38.0 38.0 38.0 37.0 38.0 10-14 37.32025 38.0 38.0 38.0 37.0 38.0 15-19 37.2949 38.0 38.0 38.0 37.0 38.0 20-24 37.20865 38.0 38.0 38.0 37.0 38.0 25-29 37.16995 38.0 38.0 38.0 37.0 38.0 30-34 37.13125 38.0 38.0 38.0 36.8 38.0 35-39 37.10925 38.0 38.0 38.0 36.4 38.0 40-44 37.17620000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.09310000000001 38.0 38.0 38.0 36.4 38.0 50-54 37.0501 38.0 38.0 38.0 36.2 38.0 55-59 36.95925 38.0 38.0 38.0 36.0 38.0 60-64 36.925599999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.86245 38.0 38.0 38.0 35.6 38.0 70-74 36.8522 38.0 38.0 38.0 36.0 38.0 75-79 36.7762 38.0 38.0 38.0 35.2 38.0 80-84 36.558350000000004 38.0 38.0 38.0 34.4 38.0 85-89 36.5253 38.0 38.0 38.0 34.4 38.0 90-94 36.32675 38.0 38.0 38.0 34.0 38.0 95-99 36.238749999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.07005 38.0 37.2 38.0 33.2 38.0 105-109 35.972249999999995 38.0 37.4 38.0 33.2 38.0 110-114 35.7863 38.0 37.0 38.0 31.8 38.0 115-119 35.43455 38.0 36.4 38.0 30.2 38.0 120-124 35.09395 38.0 36.0 38.0 28.6 38.0 125-129 34.488749999999996 38.0 34.6 38.0 25.6 38.0 130-134 34.02225 38.0 33.4 38.0 23.6 38.0 135-139 33.374900000000004 38.0 33.0 38.0 20.2 38.0 140-144 32.33535 38.0 32.6 38.0 13.4 38.0 145-149 30.945249999999998 37.2 30.6 38.0 8.2 38.0 150-151 25.029125 31.5 15.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 3.0 5 3.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 3.0 16 8.0 17 4.0 18 7.0 19 3.0 20 11.0 21 7.0 22 6.0 23 17.0 24 14.0 25 18.0 26 27.0 27 35.0 28 35.0 29 36.0 30 54.0 31 54.0 32 88.0 33 113.0 34 180.0 35 361.0 36 820.0 37 2087.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.25 19.125 13.825000000000001 27.800000000000004 2 26.875 23.625 32.45 17.05 3 20.75 26.674999999999997 33.35 19.225 4 24.55 34.575 22.225 18.65 5 24.925 35.625 22.05 17.4 6 19.829957489372344 37.934483620905226 22.605651412853213 19.629907476869217 7 19.954988747186796 19.204801200300075 40.610152538134535 20.230057514378593 8 21.305326331582897 22.88072018004501 28.60715178794699 27.206801700425103 9 22.35 24.125 28.349999999999998 25.174999999999997 10-14 23.510877719429857 28.557139284821204 26.616654163540886 21.315328832208053 15-19 23.05537491871342 27.472362563153418 28.212695713070886 21.259566805062278 20-24 22.912184138103576 28.19614711033275 28.20115086314736 20.690517888416313 25-29 23.457593194896173 27.550662997247937 28.00100075056292 20.99074305729297 30-34 22.77207905929447 27.9459594696022 28.116087065298974 21.165874405804352 35-39 23.587690768076058 27.660745559169374 27.965974480860645 20.785589191893923 40-44 22.727045283962973 27.62071553665249 28.326244683512634 21.325994495871903 45-49 23.26861489191353 27.321857485988794 28.247598078462772 21.16192954363491 50-54 22.972229171878908 27.37553164873655 28.661496122091567 20.99074305729297 55-59 23.43140198138697 26.868808165716 28.479935955168617 21.21985389772841 60-64 22.797097823367526 27.46059544658494 28.74655991993996 20.99574681010758 65-69 22.61696272204153 27.060295221416062 28.706529897423067 21.61621215911934 70-74 23.284792073262274 27.458339588650354 28.364109493069105 20.892758845018268 75-79 23.18971125456638 27.08802482109793 28.529249862383026 21.19301406195266 80-84 23.387540655491616 27.715786840130097 27.74080560420315 21.155866900175134 85-89 23.327495621716288 26.880160120090068 28.796597448086064 20.99574681010758 90-94 23.22357886309047 27.6371096877502 28.642914331465175 20.496397117694155 95-99 23.23474953710654 27.468348095881503 28.409147775609267 20.887754591402693 100-104 23.909127301841473 27.542033626901517 27.867293835068054 20.68154523618895 105-109 23.65892714171337 27.26681345076061 28.6128903122498 20.461369095276222 110-114 23.7563807426684 27.519767791011912 28.80592533279952 19.917926133520165 115-119 24.11549817344743 27.848671370665066 28.173947855677326 19.86188260021018 120-124 24.45945945945946 27.54254254254254 27.45745745745746 20.54054054054054 125-129 24.50082570184657 27.90371816043637 27.718560776660162 19.8768953610569 130-134 24.882394154739266 27.519767791011912 28.000200180162143 19.59763787408668 135-139 25.57173597557924 26.787769604163543 27.67352249412 19.966971926137216 140-144 25.45418147239878 27.471097542665536 27.756368550122616 19.31835243481307 145-149 25.960768614891915 27.702161729383505 26.691353082465973 19.645716573258607 150-151 25.606705028771582 27.583187390542907 26.957718288716535 19.85238929196898 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 2.0 23 2.5 24 2.5 25 4.0 26 4.0 27 5.5 28 10.5 29 13.0 30 16.0 31 21.0 32 28.0 33 43.0 34 47.0 35 50.5 36 76.5 37 111.0 38 138.5 39 159.5 40 188.5 41 218.0 42 238.0 43 257.5 44 266.5 45 254.0 46 243.5 47 250.0 48 238.0 49 211.0 50 183.0 51 145.5 52 127.5 53 105.5 54 75.0 55 67.0 56 58.5 57 41.5 58 28.0 59 19.5 60 14.0 61 9.5 62 4.5 63 2.0 64 3.5 65 2.0 66 1.0 67 2.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.025 9 0.0 10-14 0.025 15-19 0.045 20-24 0.075 25-29 0.075 30-34 0.075 35-39 0.075 40-44 0.075 45-49 0.08 50-54 0.075 55-59 0.06999999999999999 60-64 0.075 65-69 0.075 70-74 0.08499999999999999 75-79 0.08499999999999999 80-84 0.075 85-89 0.075 90-94 0.08 95-99 0.08499999999999999 100-104 0.08 105-109 0.08 110-114 0.09 115-119 0.08499999999999999 120-124 0.1 125-129 0.08499999999999999 130-134 0.09 135-139 0.08499999999999999 140-144 0.095 145-149 0.08 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26804644119132 98.32499999999999 2 0.5552751135790005 1.0999999999999999 3 0.12619888944977284 0.375 4 0.05047955577990913 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.925 0.0 0.0 0.0 0.0 94-95 1.05 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.55 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.4625 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.5250000000000004 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.2625 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.35 0.0 0.0 0.0 0.0 120-121 5.9125 0.0 0.0 0.0 0.0 122-123 6.5875 0.0 0.0 0.0 0.0 124-125 7.5125 0.0 0.0 0.0 0.0 126-127 8.2625 0.0 0.0 0.0 0.0 128-129 8.7375 0.0 0.0 0.0 0.0 130-131 9.375 0.0 0.0 0.0 0.0 132-133 10.15 0.0 0.0 0.0 0.0 134-135 10.8875 0.0 0.0 0.0 0.0 136-137 11.7875 0.0 0.0 0.0 0.0 138-139 12.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCTT 10 0.006830828 145.0 145 >>END_MODULE Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590643 spots for SRR7170834.sra Written 590643 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra Read 590632 spots for SRR7170834.sra Written 590632 spots for SRR7170834.sra SRR ids: ['SRR7170834.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_09293pip SRR7170834.sra spots: 11812651 blocks: [[1, 590632], [590633, 1181264], [1181265, 1771896], [1771897, 2362528], [2362529, 2953160], [2953161, 3543792], [3543793, 4134424], [4134425, 4725056], [4725057, 5315688], [5315689, 5906320], [5906321, 6496952], [6496953, 7087584], [7087585, 7678216], [7678217, 8268848], [8268849, 8859480], [8859481, 9450112], [9450113, 10040744], [10040745, 10631376], [10631377, 11222008], [11222009, 11812651]] SRR7170834 file size 3981219 SRR7170834 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170834 SRR7170834_1.fastq SRR7170834_2.fastq Input file: SRR7170834_1.fastq Paired file: SRR7170834_2.fastq trimmed: SRR7170834-trimmed-pair1.fastq, SRR7170834-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:17:36 2025 >> started Thu Feb 13 18:17:50 2025 >> done (14.681s) 11812651 read pairs processed; of these: 9733 ( 0.08%) short read pairs filtered out after trimming by size control 25183 ( 0.21%) empty read pairs filtered out after trimming by size control 11777735 (99.70%) read pairs available; of these: 8320639 (70.65%) trimmed read pairs available after processing 3457096 (29.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 7 0.00% 21 1 0.00% 22 5 0.00% 23 1 0.00% 24 10 0.00% 25 6 0.00% 26 7 0.00% 27 14 0.00% 28 12 0.00% 29 14 0.00% 30 9 0.00% 31 49 0.00% 32 13 0.00% 33 18 0.00% 34 20 0.00% 35 13 0.00% 36 18 0.00% 37 24 0.00% 38 40 0.00% 39 27 0.00% 40 35 0.00% 41 41 0.00% 42 35 0.00% 43 36 0.00% 44 45 0.00% 45 46 0.00% 46 58 0.00% 47 79 0.00% 48 89 0.00% 49 111 0.00% 50 107 0.00% 51 137 0.00% 52 138 0.00% 53 169 0.00% 54 188 0.00% 55 180 0.00% 56 192 0.00% 57 233 0.00% 58 305 0.00% 59 338 0.00% 60 424 0.00% 61 496 0.00% 62 520 0.00% 63 568 0.00% 64 595 0.01% 65 686 0.01% 66 738 0.01% 67 925 0.01% 68 1025 0.01% 69 1148 0.01% 70 1347 0.01% 71 1520 0.01% 72 1868 0.02% 73 2147 0.02% 74 2335 0.02% 75 2573 0.02% 76 3496 0.03% 77 3493 0.03% 78 3377 0.03% 79 3521 0.03% 80 4026 0.03% 81 4805 0.04% 82 5295 0.04% 83 6121 0.05% 84 7409 0.06% 85 7650 0.06% 86 8113 0.07% 87 8764 0.07% 88 9085 0.08% 89 9809 0.08% 90 10371 0.09% 91 11571 0.10% 92 12646 0.11% 93 14008 0.12% 94 14961 0.13% 95 15755 0.13% 96 16713 0.14% 97 17697 0.15% 98 17929 0.15% 99 18868 0.16% 100 19743 0.17% 101 21116 0.18% 102 22740 0.19% 103 24343 0.21% 104 25584 0.22% 105 26675 0.23% 106 27948 0.24% 107 28579 0.24% 108 29313 0.25% 109 30661 0.26% 110 31151 0.26% 111 32741 0.28% 112 34955 0.30% 113 35446 0.30% 114 37567 0.32% 115 39277 0.33% 116 40406 0.34% 117 41749 0.35% 118 43167 0.37% 119 44021 0.37% 120 44934 0.38% 121 46475 0.39% 122 48114 0.41% 123 51014 0.43% 124 53087 0.45% 125 54826 0.47% 126 56971 0.48% 127 59557 0.51% 128 61258 0.52% 129 64063 0.54% 130 66437 0.56% 131 68366 0.58% 132 72386 0.61% 133 76201 0.65% 134 79766 0.68% 135 85691 0.73% 136 91129 0.77% 137 95940 0.81% 138 102628 0.87% 139 110067 0.93% 140 117206 1.00% 141 127308 1.08% 142 141134 1.20% 143 160229 1.36% 144 183608 1.56% 145 218223 1.85% 146 273490 2.32% 147 363215 3.08% 148 534252 4.54% 149 974409 8.27% 150 2944196 25.00% 151 3457096 29.35% 11777735 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.12 fanout-score-rank=31 prefix-density=0.59 prefix-fanout=1.1 sequence=TGCACTTGACGCGTGTTGTCGAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=43 fanout-score=25.53 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.1 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=39 prefix-density=0.43 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=34 fanout-score=74.07 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=12.3 sequence=GGTGGTGGTCGTGTTACCATGCGCAGGACTGTGAAAAGTGCTCCCCAAAGCATATGGTATGGCCCAGACCGCCCAAAGTTCTTGGGTCCATTCTCTGAGCAAACCCCATCATACCTGACCGGTGAATTCCCTGGTGATTATGGATGGGACACTGCTGGTTTGTCTGCAGATCCTGAGACATTTG SRR7170834 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:18:36 Started mapping on | Feb 13 18:18:36 Finished on | Feb 13 18:20:03 Mapping speed, Million of reads per hour | 487.35 Number of input reads | 11777735 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 11050780 Uniquely mapped reads % | 93.83% Average mapped length | 286.86 Number of splices: Total | 9331541 Number of splices: Annotated (sjdb) | 9125057 Number of splices: GT/AG | 9147407 Number of splices: GC/AG | 144304 Number of splices: AT/AC | 7499 Number of splices: Non-canonical | 32331 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308083 % of reads mapped to multiple loci | 2.62% Number of reads mapped to too many loci | 53986 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 425953 425953 425953 N_multimapping 308083 308083 308083 N_noFeature 408630 10808408 513284 N_ambiguous 218266 1244 79776 UnstrandedReadsAssigned:10423884 PositiveStrandReadsAssigned:241128 NegativeStrandReadsAssigned:10457720 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170834 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170834-trimmed-pair1.fastq SRR7170834-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,777,735 reads, 10,502,558 reads pseudoaligned [quant] estimated average fragment length: 219.12 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR7170834.ke.tsv 34699 SRR7170834.se.tsv 87100 total ==> SRR7170834.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.88 302 13.9843 Potri.005G024800.1.v4.1 1035 816.88 89 9.08052 Potri.004G059700.1.v4.1 961 742.894 17 1.90722 Potri.007G009000.2.v4.1 1416 1197.88 1 0.069577 Potri.003G141000.2.v4.1 2943 2724.88 346.266 10.5911 Potri.016G087400.1.v4.1 270 93.4814 617 550.096 Potri.015G069301.1.v4.1 564 349.393 0 0 Potri.010G195200.1.v4.1 1773 1554.88 71 3.80575 Potri.012G127500.1.v4.1 977 758.885 168 18.4507 ==> SRR7170834.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 447 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 376 Potri.001G212900.v4.1 32 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170834 completed mapping pipeline successfully