Starting /dee2/code/volunteer_pipeline.sh SRR7170835 current disk space = 3088761929728 free memory = 1570231692 SRR7170835 SRAfilesize c0320d78d1d49a72129b9fb56e117f49 SRR7170835.sra SRR7170835.sra file validated SRR7170835 is paired end SRR7170835 is conventional basespace SRR7170835 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170835_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82825 34.0 33.0 34.0 32.0 34.0 2 33.1345 34.0 33.0 34.0 32.0 34.0 3 33.065 34.0 33.0 34.0 31.0 34.0 4 33.19825 34.0 33.0 34.0 32.0 34.0 5 33.21125 34.0 33.0 34.0 32.0 34.0 6 36.584 38.0 37.0 38.0 34.0 38.0 7 37.0345 38.0 38.0 38.0 35.0 38.0 8 37.23075 38.0 38.0 38.0 36.0 38.0 9 37.3385 38.0 38.0 38.0 37.0 38.0 10-14 37.324200000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.239599999999996 38.0 38.0 38.0 36.4 38.0 20-24 37.232949999999995 38.0 38.0 38.0 36.2 38.0 25-29 37.21685 38.0 38.0 38.0 36.0 38.0 30-34 37.0886 38.0 38.0 38.0 35.8 38.0 35-39 36.9763 38.0 38.0 38.0 35.8 38.0 40-44 36.8658 38.0 38.0 38.0 35.4 38.0 45-49 36.81365 38.0 38.0 38.0 35.2 38.0 50-54 36.4628 38.0 38.0 38.0 34.0 38.0 55-59 36.46295 38.0 37.8 38.0 33.8 38.0 60-64 36.41015 38.0 37.8 38.0 33.8 38.0 65-69 36.2836 38.0 37.2 38.0 33.2 38.0 70-74 36.32855 38.0 37.4 38.0 33.6 38.0 75-79 36.0133 38.0 37.0 38.0 32.8 38.0 80-84 35.976150000000004 38.0 37.0 38.0 32.6 38.0 85-89 35.559400000000004 38.0 36.8 38.0 29.4 38.0 90-94 35.3803 38.0 36.0 38.0 29.0 38.0 95-99 35.1601 38.0 36.2 38.0 28.2 38.0 100-104 34.5921 38.0 35.2 38.0 25.6 38.0 105-109 34.36794999999999 38.0 34.2 38.0 24.6 38.0 110-114 34.123900000000006 38.0 33.8 38.0 23.6 38.0 115-119 33.675799999999995 38.0 33.0 38.0 21.6 38.0 120-124 32.8717 38.0 32.6 38.0 14.4 38.0 125-129 31.962799999999998 37.2 30.2 38.0 13.8 38.0 130-134 31.18705 36.8 28.2 38.0 13.0 38.0 135-139 30.083849999999995 36.0 27.6 38.0 12.2 38.0 140-144 29.707599999999996 36.0 27.4 38.0 5.6 38.0 145-149 27.85795 34.2 20.6 38.0 2.0 38.0 150-151 20.986874999999998 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 2.0 9 1.0 10 0.0 11 2.0 12 2.0 13 0.0 14 1.0 15 3.0 16 4.0 17 6.0 18 3.0 19 17.0 20 7.0 21 11.0 22 18.0 23 31.0 24 40.0 25 34.0 26 51.0 27 45.0 28 63.0 29 68.0 30 93.0 31 90.0 32 152.0 33 238.0 34 359.0 35 531.0 36 1139.0 37 988.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.66767983789261 17.401215805471125 10.486322188449847 28.44478216818642 2 21.0 20.65 35.199999999999996 23.150000000000002 3 16.30353117956424 28.900576008014024 31.02930127723516 23.766591535186578 4 20.275000000000002 33.074999999999996 25.224999999999998 21.425 5 20.4 37.275000000000006 25.025 17.299999999999997 6 18.85 35.475 25.275 20.4 7 14.2 24.4 42.3 19.1 8 17.299999999999997 25.3 29.95 27.450000000000003 9 17.775 24.275 31.775 26.174999999999997 10-14 19.695 29.385 26.840000000000003 24.08 15-19 19.62 29.015 28.08 23.285 20-24 19.02 29.854999999999997 27.57 23.555 25-29 19.1 29.985 27.815 23.1 30-34 19.259999999999998 29.445 28.455000000000002 22.84 35-39 19.650000000000002 29.744999999999997 27.275 23.330000000000002 40-44 19.62 29.765000000000004 27.29 23.325000000000003 45-49 19.994999999999997 28.794999999999998 27.529999999999998 23.68 50-54 19.814999999999998 28.845 28.27 23.07 55-59 19.994999999999997 28.455000000000002 27.884999999999998 23.665 60-64 19.98 28.985 27.48 23.555 65-69 19.54 29.115000000000002 27.68 23.665 70-74 20.16 28.845 27.889999999999997 23.105 75-79 19.384999999999998 29.330000000000002 28.09 23.195 80-84 20.135 28.305000000000003 27.625 23.935000000000002 85-89 20.615 28.96 27.11 23.315 90-94 20.32 28.725 27.555000000000003 23.400000000000002 95-99 20.185 28.77 27.675 23.369999999999997 100-104 20.11 28.87 27.54 23.48 105-109 20.325 28.384999999999998 27.755000000000003 23.535 110-114 20.39 29.37 26.755000000000003 23.485 115-119 20.52 28.444999999999997 27.16 23.875 120-124 20.56102805140257 28.666433321666084 27.28636431821591 23.486174308715434 125-129 19.98 29.115000000000002 26.919999999999998 23.985 130-134 20.849999999999998 29.044999999999998 26.215 23.89 135-139 20.95104755237762 29.03645182259113 26.32131606580329 23.691184559227963 140-144 20.418062709406414 28.62929439415912 26.714007101065164 24.238635795369305 145-149 20.874174834966993 28.760752150430086 26.820364072814563 23.544708941788357 150-151 20.415051881485187 28.766095761970245 26.465808226028255 24.353044130516317 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 2.5 16 2.0 17 0.0 18 1.5 19 1.5 20 1.5 21 2.5 22 1.5 23 3.5 24 7.0 25 10.0 26 10.0 27 10.5 28 18.5 29 24.0 30 28.0 31 37.0 32 50.0 33 57.5 34 68.0 35 80.0 36 96.0 37 132.0 38 144.5 39 163.5 40 204.0 41 228.0 42 243.5 43 263.0 44 253.5 45 225.5 46 228.0 47 219.0 48 208.5 49 205.5 50 172.5 51 136.0 52 109.0 53 78.5 54 61.0 55 52.0 56 48.5 57 36.5 58 20.5 59 15.5 60 12.0 61 8.5 62 5.5 63 4.5 64 2.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.17500000000000002 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.005 140-144 0.015 145-149 0.02 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21499113699672 97.95 2 0.6330716637123323 1.25 3 0.10129146619397315 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02532286654849329 0.22499999999999998 >10 0.02532286654849329 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCAGAAATCTCGTAT 11 0.27499999999999997 TruSeq Adapter, Index 13 (97% over 38bp) GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 1.0375 0.0 0.0 0.0 0.0 94-95 1.2 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.6 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.1625 0.0 0.0 0.0 0.0 104-105 2.3499999999999996 0.0 0.0 0.0 0.0 106-107 2.7 0.0 0.0 0.0 0.0 108-109 3.1375 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.95 0.0 0.0 0.0 0.0 114-115 4.475 0.0 0.0 0.0 0.0 116-117 4.975 0.0 0.0 0.0 0.0 118-119 5.525 0.0 0.0 0.0 0.0 120-121 6.1 0.0 0.0 0.0 0.0 122-123 6.6875 0.0 0.0 0.0 0.0 124-125 7.300000000000001 0.0 0.0 0.0 0.0 126-127 7.925 0.0 0.0 0.0 0.0 128-129 8.7 0.0 0.0 0.0 0.0 130-131 9.3875 0.0 0.0 0.0 0.0 132-133 9.7375 0.0 0.0 0.0 0.0 134-135 10.2875 0.0 0.0 0.0 0.0 136-137 11.037500000000001 0.0 0.0 0.0 0.0 138-139 11.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCGAT 10 0.006832588 144.9875 5 TTTTTTT 40 0.005345034 55.058544 1 >>END_MODULE SRR7170835 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170835_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.859 33.0 33.0 34.0 32.0 34.0 2 32.97125 33.0 33.0 34.0 32.0 34.0 3 32.9595 34.0 33.0 34.0 32.0 34.0 4 32.95475 34.0 33.0 34.0 32.0 34.0 5 32.86825 33.0 33.0 34.0 32.0 34.0 6 37.07 38.0 38.0 38.0 37.0 38.0 7 37.125 38.0 38.0 38.0 37.0 38.0 8 37.11225 38.0 38.0 38.0 37.0 38.0 9 37.09125 38.0 38.0 38.0 37.0 38.0 10-14 37.1163 38.0 38.0 38.0 37.0 38.0 15-19 37.082 38.0 38.0 38.0 37.0 38.0 20-24 37.0527 38.0 38.0 38.0 36.6 38.0 25-29 37.01375 38.0 38.0 38.0 36.4 38.0 30-34 36.9362 38.0 38.0 38.0 36.0 38.0 35-39 36.8777 38.0 38.0 38.0 35.8 38.0 40-44 36.9249 38.0 38.0 38.0 36.0 38.0 45-49 36.891600000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.8231 38.0 38.0 38.0 36.0 38.0 55-59 36.7934 38.0 38.0 38.0 35.8 38.0 60-64 36.7196 38.0 38.0 38.0 35.2 38.0 65-69 36.61065 38.0 38.0 38.0 35.0 38.0 70-74 36.566250000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.53280000000001 38.0 38.0 38.0 34.6 38.0 80-84 36.2625 38.0 38.0 38.0 34.0 38.0 85-89 36.133300000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.056850000000004 38.0 38.0 38.0 33.4 38.0 95-99 35.968450000000004 38.0 37.4 38.0 33.0 38.0 100-104 35.826100000000004 38.0 37.0 38.0 32.6 38.0 105-109 35.622299999999996 38.0 37.0 38.0 31.6 38.0 110-114 35.45815 38.0 36.8 38.0 30.6 38.0 115-119 35.00975 38.0 36.0 38.0 28.0 38.0 120-124 34.558299999999996 38.0 35.4 38.0 25.4 38.0 125-129 34.084950000000006 38.0 34.4 38.0 23.8 38.0 130-134 33.36135 38.0 33.2 38.0 19.6 38.0 135-139 32.67695 38.0 33.0 38.0 14.4 38.0 140-144 31.50475 37.8 31.0 38.0 12.6 38.0 145-149 30.08825 36.0 28.0 38.0 3.8 38.0 150-151 24.449875 31.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 2.0 5 4.0 6 1.0 7 0.0 8 2.0 9 0.0 10 2.0 11 1.0 12 2.0 13 2.0 14 2.0 15 2.0 16 4.0 17 1.0 18 4.0 19 13.0 20 14.0 21 14.0 22 11.0 23 17.0 24 17.0 25 23.0 26 33.0 27 31.0 28 34.0 29 41.0 30 60.0 31 82.0 32 85.0 33 134.0 34 193.0 35 365.0 36 843.0 37 1947.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.68667166791698 19.879969992498125 11.952988247061766 21.48037009252313 2 26.85671417854464 23.605901475368842 32.13303325831458 17.404351087771943 3 21.53576788394197 28.039019509754876 33.71685842921461 16.708354177088545 4 22.98649324662331 35.14257128564282 22.236118059029515 19.634817408704354 5 23.13656828414207 37.09354677338669 22.761380690345174 17.008504252126063 6 20.810405202601302 37.34367183591796 23.56178089044522 18.284142071035518 7 19.70985492746373 19.809904952476238 40.12006003001501 20.36018009004502 8 21.410705352676338 24.912456228114056 26.663331665832917 27.01350675337669 9 21.38569284642321 25.012506253126567 29.264632316158078 24.337168584292147 10-14 23.734240544326596 28.357014208525115 26.776065639383628 21.132679607764658 15-19 23.225096312603192 28.968829739330566 27.693000450292693 20.113073497773552 20-24 23.250925833249923 27.800020018016212 28.325492943649284 20.623561205084577 25-29 22.76776776776777 28.833833833833832 27.822822822822822 20.575575575575574 30-34 22.37013311980783 28.150335301771594 28.315483935541984 21.164047642878593 35-39 23.12812812812813 28.133133133133132 28.298298298298295 20.44044044044044 40-44 23.09078170353318 28.140326293664298 27.87508757882094 20.89380442398158 45-49 23.05189930433912 27.83143986787448 28.0416395575797 21.075021270206694 50-54 22.55755755755756 28.18818818818819 28.43843843843844 20.815815815815817 55-59 23.20588529676709 27.865078570713642 28.08027224502052 20.84876388749875 60-64 22.951804214003303 27.07572193583905 29.097642760622595 20.87483108953506 65-69 23.773773773773772 27.85785785785786 28.133133133133132 20.235235235235237 70-74 23.33066373010311 27.620382420662732 28.266092701972166 20.78286114726199 75-79 23.712269109475898 27.656805326125045 27.977173749812284 20.653751814586773 80-84 23.655106840814693 27.523394885652802 27.47335234949707 21.348145924035432 85-89 23.2047240154131 28.339088224991244 27.54841615373067 20.907771605864987 90-94 23.642460337320454 28.45202942795656 27.526149842350232 20.379360392372753 95-99 23.722280622716124 27.907093157130703 27.962156479951943 20.408469740201234 100-104 23.867674290576048 28.271858265352083 27.791401831740153 20.069065612331716 105-109 23.913913913913916 27.522522522522525 28.063063063063066 20.5005005005005 110-114 24.429315178213855 28.098718462154586 27.778334000800964 19.693632358830595 115-119 24.200410430952502 28.569998498423345 27.23359527503879 19.995995795585365 120-124 24.95995995995996 28.28828828828829 27.52752752752753 19.224224224224223 125-129 24.986235547324693 27.558936883727913 27.35372140747785 20.10110616146954 130-134 25.752190237797244 28.130162703379224 26.97371714643304 19.14392991239049 135-139 25.305305305305303 28.323323323323322 27.067067067067068 19.304304304304303 140-144 25.88011417697431 27.45755921678602 27.607792077720468 19.054534528519206 145-149 25.885885885885884 28.23823823823824 26.946946946946948 18.92892892892893 150-151 26.5015015015015 26.43893893893894 28.178178178178175 18.88138138138138 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 3.0 23 2.5 24 3.0 25 3.5 26 5.0 27 9.5 28 11.0 29 13.5 30 18.5 31 18.5 32 26.0 33 41.0 34 53.5 35 70.0 36 75.0 37 105.0 38 149.0 39 160.5 40 190.5 41 228.0 42 260.5 43 275.5 44 260.0 45 263.5 46 254.5 47 235.0 48 235.0 49 205.5 50 169.5 51 139.5 52 106.5 53 92.0 54 79.5 55 59.5 56 43.5 57 35.5 58 26.0 59 18.0 60 14.5 61 10.0 62 7.5 63 6.5 64 2.0 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.05 4 0.05 5 0.05 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.06 15-19 0.065 20-24 0.09 25-29 0.1 30-34 0.09 35-39 0.1 40-44 0.09 45-49 0.095 50-54 0.1 55-59 0.09 60-64 0.095 65-69 0.1 70-74 0.11 75-79 0.11499999999999999 80-84 0.08499999999999999 85-89 0.08499999999999999 90-94 0.095 95-99 0.11499999999999999 100-104 0.095 105-109 0.1 110-114 0.12 115-119 0.105 120-124 0.1 125-129 0.105 130-134 0.125 135-139 0.1 140-144 0.155 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.10986775178027 97.425 2 0.6358087487283826 1.25 3 0.0762970498474059 0.22499999999999998 4 0.050864699898270596 0.2 5 0.050864699898270596 0.25 6 0.025432349949135298 0.15 7 0.0 0.0 8 0.025432349949135298 0.2 9 0.0 0.0 >10 0.025432349949135298 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 12 0.3 Illumina Single End PCR Primer 1 (96% over 32bp) AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7875 0.0 0.0 0.0 0.0 92-93 0.9125000000000001 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.3625 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.1375 0.0 0.0 0.0 0.0 110-111 3.525 0.0 0.0 0.0 0.0 112-113 3.9375 0.0 0.0 0.0 0.0 114-115 4.425000000000001 0.0 0.0 0.0 0.0 116-117 4.9625 0.0 0.0 0.0 0.0 118-119 5.5625 0.0 0.0 0.0 0.0 120-121 6.1375 0.0 0.0 0.0 0.0 122-123 6.7375 0.0 0.0 0.0 0.0 124-125 7.325 0.0 0.0 0.0 0.0 126-127 7.949999999999999 0.0 0.0 0.0 0.0 128-129 8.7125 0.0 0.0 0.0 0.0 130-131 9.3625 0.0 0.0 0.0 0.0 132-133 9.8375 0.0 0.0 0.0 0.0 134-135 10.350000000000001 0.0 0.0 0.0 0.0 136-137 11.087499999999999 0.0 0.0 0.0 0.0 138-139 11.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601742 spots for SRR7170835.sra Written 601742 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra Read 601725 spots for SRR7170835.sra Written 601725 spots for SRR7170835.sra SRR ids: ['SRR7170835.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kzt5m7_0 SRR7170835.sra spots: 12034517 blocks: [[1, 601725], [601726, 1203450], [1203451, 1805175], [1805176, 2406900], [2406901, 3008625], [3008626, 3610350], [3610351, 4212075], [4212076, 4813800], [4813801, 5415525], [5415526, 6017250], [6017251, 6618975], [6618976, 7220700], [7220701, 7822425], [7822426, 8424150], [8424151, 9025875], [9025876, 9627600], [9627601, 10229325], [10229326, 10831050], [10831051, 11432775], [11432776, 12034517]] SRR7170835 file size 4056402 SRR7170835 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170835 SRR7170835_1.fastq SRR7170835_2.fastq Input file: SRR7170835_1.fastq Paired file: SRR7170835_2.fastq trimmed: SRR7170835-trimmed-pair1.fastq, SRR7170835-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 17:59:44 2025 >> started Thu Feb 13 17:59:57 2025 >> done (13.316s) 12034517 read pairs processed; of these: 20578 ( 0.17%) short read pairs filtered out after trimming by size control 60465 ( 0.50%) empty read pairs filtered out after trimming by size control 11953474 (99.33%) read pairs available; of these: 8648401 (72.35%) trimmed read pairs available after processing 3305073 (27.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 18 0.00% 21 12 0.00% 22 16 0.00% 23 17 0.00% 24 13 0.00% 25 15 0.00% 26 28 0.00% 27 20 0.00% 28 23 0.00% 29 22 0.00% 30 33 0.00% 31 109 0.00% 32 17 0.00% 33 28 0.00% 34 30 0.00% 35 31 0.00% 36 21 0.00% 37 43 0.00% 38 46 0.00% 39 49 0.00% 40 58 0.00% 41 50 0.00% 42 53 0.00% 43 70 0.00% 44 72 0.00% 45 75 0.00% 46 103 0.00% 47 115 0.00% 48 121 0.00% 49 130 0.00% 50 172 0.00% 51 211 0.00% 52 220 0.00% 53 231 0.00% 54 237 0.00% 55 274 0.00% 56 284 0.00% 57 352 0.00% 58 404 0.00% 59 480 0.00% 60 579 0.00% 61 658 0.01% 62 750 0.01% 63 833 0.01% 64 908 0.01% 65 973 0.01% 66 983 0.01% 67 1105 0.01% 68 1310 0.01% 69 1531 0.01% 70 1752 0.01% 71 2202 0.02% 72 2664 0.02% 73 3068 0.03% 74 3271 0.03% 75 3797 0.03% 76 5511 0.05% 77 5610 0.05% 78 4593 0.04% 79 4810 0.04% 80 5215 0.04% 81 6245 0.05% 82 7232 0.06% 83 8557 0.07% 84 9979 0.08% 85 10215 0.09% 86 10382 0.09% 87 10860 0.09% 88 11067 0.09% 89 11929 0.10% 90 12796 0.11% 91 14439 0.12% 92 16387 0.14% 93 17862 0.15% 94 18986 0.16% 95 19942 0.17% 96 20121 0.17% 97 20250 0.17% 98 20298 0.17% 99 21079 0.18% 100 22444 0.19% 101 24065 0.20% 102 26785 0.22% 103 28837 0.24% 104 30649 0.26% 105 32122 0.27% 106 32190 0.27% 107 32045 0.27% 108 31787 0.27% 109 32365 0.27% 110 33848 0.28% 111 35213 0.29% 112 38117 0.32% 113 40609 0.34% 114 43576 0.36% 115 45200 0.38% 116 45925 0.38% 117 46138 0.39% 118 45856 0.38% 119 45790 0.38% 120 47203 0.39% 121 49250 0.41% 122 51500 0.43% 123 55291 0.46% 124 59455 0.50% 125 62178 0.52% 126 64054 0.54% 127 64946 0.54% 128 65651 0.55% 129 67023 0.56% 130 68679 0.57% 131 71907 0.60% 132 76527 0.64% 133 82048 0.69% 134 88187 0.74% 135 95482 0.80% 136 100147 0.84% 137 105709 0.88% 138 111311 0.93% 139 117617 0.98% 140 124674 1.04% 141 134726 1.13% 142 150241 1.26% 143 171110 1.43% 144 198942 1.66% 145 235212 1.97% 146 291492 2.44% 147 382196 3.20% 148 552479 4.62% 149 983263 8.23% 150 2881263 24.10% 151 3305073 27.65% 11953474 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.19 sequence-density-rank=15 fanout-score=13.84 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=2.3 sequence=TGCTTGCTTCTAATCTTAA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=28 prefix-density=0.33 prefix-fanout=2.4 sequence=AATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=34.48 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTTGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAA SRR7170835 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:00:38 Started mapping on | Feb 13 18:00:39 Finished on | Feb 13 18:01:56 Mapping speed, Million of reads per hour | 558.86 Number of input reads | 11953474 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 11275838 Uniquely mapped reads % | 94.33% Average mapped length | 285.18 Number of splices: Total | 10399117 Number of splices: Annotated (sjdb) | 10127333 Number of splices: GT/AG | 10196466 Number of splices: GC/AG | 150249 Number of splices: AT/AC | 7744 Number of splices: Non-canonical | 44658 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353214 % of reads mapped to multiple loci | 2.95% Number of reads mapped to too many loci | 21560 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 340597 340597 340597 N_multimapping 353214 353214 353214 N_noFeature 436854 11018362 539009 N_ambiguous 249555 929 93691 UnstrandedReadsAssigned:10589429 PositiveStrandReadsAssigned:256547 NegativeStrandReadsAssigned:10643138 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=137 echo kmer=133 SRR7170835 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170835-trimmed-pair1.fastq SRR7170835-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,953,474 reads, 10,624,521 reads pseudoaligned [quant] estimated average fragment length: 220.287 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR7170835.ke.tsv 34699 SRR7170835.se.tsv 87100 total ==> SRR7170835.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1798.71 1034 41.4044 Potri.005G024800.1.v4.1 1035 815.713 341 30.1096 Potri.004G059700.1.v4.1 961 741.76 4 0.388405 Potri.007G009000.2.v4.1 1416 1196.71 0 0 Potri.003G141000.2.v4.1 2943 2723.71 478.65 12.6574 Potri.016G087400.1.v4.1 270 96.7174 991.716 738.535 Potri.015G069301.1.v4.1 564 349.891 0 0 Potri.010G195200.1.v4.1 1773 1553.71 361 16.735 Potri.012G127500.1.v4.1 977 757.723 622 59.1246 ==> SRR7170835.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 234 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170835 completed mapping pipeline successfully