Starting /dee2/code/volunteer_pipeline.sh SRR7170836 current disk space = 3088051310592 free memory = 1540222884 SRR7170836 SRAfilesize 21b5a85e4037d522608582ff52c9d640 SRR7170836.sra SRR7170836.sra file validated SRR7170836 is paired end SRR7170836 is conventional basespace SRR7170836 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170836_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.416 34.0 33.0 34.0 32.0 34.0 2 33.22375 34.0 33.0 34.0 32.0 34.0 3 33.1825 34.0 33.0 34.0 31.0 34.0 4 33.37175 34.0 33.0 34.0 33.0 34.0 5 33.3615 34.0 33.0 34.0 33.0 34.0 6 36.895 38.0 37.0 38.0 35.0 38.0 7 37.26975 38.0 38.0 38.0 36.0 38.0 8 37.437 38.0 38.0 38.0 37.0 38.0 9 37.42975 38.0 38.0 38.0 37.0 38.0 10-14 37.502700000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.406349999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.37805 38.0 38.0 38.0 37.0 38.0 25-29 37.338499999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.2692 38.0 38.0 38.0 37.0 38.0 35-39 37.24785000000001 38.0 38.0 38.0 36.4 38.0 40-44 37.185500000000005 38.0 38.0 38.0 36.4 38.0 45-49 36.9696 38.0 38.0 38.0 35.8 38.0 50-54 36.9417 38.0 38.0 38.0 35.8 38.0 55-59 36.873749999999994 38.0 38.0 38.0 35.2 38.0 60-64 36.72345 38.0 38.0 38.0 34.8 38.0 65-69 36.7784 38.0 38.0 38.0 35.4 38.0 70-74 36.69395000000001 38.0 38.0 38.0 34.8 38.0 75-79 36.4972 38.0 38.0 38.0 34.0 38.0 80-84 36.268449999999994 38.0 37.8 38.0 33.8 38.0 85-89 36.27255 38.0 37.8 38.0 33.8 38.0 90-94 36.04195 38.0 37.0 38.0 33.2 38.0 95-99 36.02785 38.0 37.0 38.0 32.8 38.0 100-104 35.7551 38.0 37.0 38.0 31.8 38.0 105-109 35.70955 38.0 37.0 38.0 31.0 38.0 110-114 35.3585 38.0 36.2 38.0 29.4 38.0 115-119 34.9907 38.0 36.0 38.0 28.0 38.0 120-124 34.628499999999995 38.0 35.0 38.0 26.2 38.0 125-129 34.103449999999995 38.0 33.6 38.0 23.6 38.0 130-134 33.652249999999995 38.0 33.0 38.0 21.8 38.0 135-139 32.87245 38.0 33.0 38.0 16.8 38.0 140-144 31.8941 37.8 31.4 38.0 13.0 38.0 145-149 30.602999999999998 36.8 29.6 38.0 6.0 38.0 150-151 24.014375 30.5 13.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 4.0 14 3.0 15 0.0 16 1.0 17 3.0 18 7.0 19 10.0 20 10.0 21 4.0 22 13.0 23 18.0 24 10.0 25 30.0 26 29.0 27 29.0 28 40.0 29 42.0 30 58.0 31 73.0 32 108.0 33 166.0 34 208.0 35 394.0 36 960.0 37 1778.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.38144329896907 17.525773195876287 9.510309278350515 28.582474226804123 2 22.325 20.075000000000003 34.449999999999996 23.150000000000002 3 17.0 28.525 30.575000000000003 23.9 4 21.2 33.300000000000004 25.35 20.150000000000002 5 21.2 36.8 23.925 18.075 6 18.375 36.625 25.05 19.950000000000003 7 13.675 23.175 44.1 19.05 8 18.125 23.9 30.125 27.85 9 17.575 23.65 32.45 26.325 10-14 20.44 29.39 26.13 24.04 15-19 19.28 29.049999999999997 28.265 23.405 20-24 19.445 29.330000000000002 27.875 23.35 25-29 19.439999999999998 29.54 27.395000000000003 23.625 30-34 19.735 28.735 27.994999999999997 23.535 35-39 20.19 28.77 27.575 23.465 40-44 19.665 29.23 27.72 23.385 45-49 20.51 28.485 27.71 23.294999999999998 50-54 20.69 28.435 27.72 23.155 55-59 20.169999999999998 28.89 27.279999999999998 23.66 60-64 20.265 29.145 27.22 23.369999999999997 65-69 19.945 28.975 28.04 23.04 70-74 20.21 28.215 27.85 23.724999999999998 75-79 20.255000000000003 29.34 27.095000000000002 23.31 80-84 19.875 29.160000000000004 27.345000000000002 23.62 85-89 20.185 27.875 28.060000000000002 23.880000000000003 90-94 20.25 28.74 27.29 23.72 95-99 20.23 28.749999999999996 27.169999999999998 23.849999999999998 100-104 20.805 28.99 27.175 23.03 105-109 20.325 28.810000000000002 26.87 23.995 110-114 20.925 28.71 27.065 23.3 115-119 20.95 28.725 27.155 23.169999999999998 120-124 21.055 29.185 26.005 23.755000000000003 125-129 20.990000000000002 28.865000000000002 26.665 23.48 130-134 21.395 28.455000000000002 26.07 24.08 135-139 21.36 29.095 26.0 23.544999999999998 140-144 22.02 27.839999999999996 25.72 24.42 145-149 21.23 28.645 26.115 24.01 150-151 21.337500000000002 28.799999999999997 25.525 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 2.5 24 6.0 25 6.5 26 5.0 27 8.5 28 15.5 29 19.5 30 21.0 31 24.5 32 37.0 33 57.5 34 72.0 35 81.0 36 96.0 37 118.5 38 143.0 39 167.0 40 172.5 41 201.0 42 240.0 43 255.5 44 266.5 45 260.0 46 265.0 47 248.5 48 215.5 49 196.0 50 160.5 51 145.0 52 126.5 53 91.0 54 71.5 55 50.5 56 38.0 57 33.0 58 23.0 59 15.5 60 9.5 61 6.0 62 5.0 63 3.5 64 2.0 65 2.0 66 1.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.5035246727089627 1.0 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.025176233635448138 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.0499999999999998 0.0 0.0 0.0 0.0 96-97 1.3875000000000002 0.0 0.0 0.0 0.0 98-99 1.6375000000000002 0.0 0.0 0.0 0.0 100-101 1.8875 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.4375 0.0 0.0 0.0 0.0 106-107 2.8125 0.0 0.0 0.0 0.0 108-109 3.45 0.0 0.0 0.0 0.0 110-111 4.0125 0.0 0.0 0.0 0.0 112-113 4.4375 0.0 0.0 0.0 0.0 114-115 4.8375 0.0 0.0 0.0 0.0 116-117 5.35 0.0 0.0 0.0 0.0 118-119 5.975 0.0 0.0 0.0 0.0 120-121 6.375 0.0 0.0 0.0 0.0 122-123 6.8125 0.0 0.0 0.0 0.0 124-125 7.4125 0.0 0.0 0.0 0.0 126-127 8.3875 0.0 0.0 0.0 0.0 128-129 9.2 0.0 0.0 0.0 0.0 130-131 9.825 0.0 0.0 0.0 0.0 132-133 10.6125 0.0 0.0 0.0 0.0 134-135 11.4125 0.0 0.0 0.0 0.0 136-137 12.024999999999999 0.0 0.0 0.0 0.0 138-139 12.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGGTC 10 0.006830828 145.0 7 GCAAACT 10 0.006830828 145.0 2 CACCAAG 10 0.006830828 145.0 4 >>END_MODULE SRR7170836 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170836_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95225 33.0 33.0 34.0 32.0 34.0 2 33.03275 34.0 33.0 34.0 32.0 34.0 3 33.0895 34.0 33.0 34.0 33.0 34.0 4 33.035 34.0 33.0 34.0 33.0 34.0 5 32.95625 34.0 33.0 34.0 33.0 34.0 6 37.162 38.0 38.0 38.0 37.0 38.0 7 37.29325 38.0 38.0 38.0 37.0 38.0 8 37.181 38.0 38.0 38.0 37.0 38.0 9 37.2285 38.0 38.0 38.0 37.0 38.0 10-14 37.275400000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.24805 38.0 38.0 38.0 37.0 38.0 20-24 37.1454 38.0 38.0 38.0 37.0 38.0 25-29 37.1063 38.0 38.0 38.0 37.0 38.0 30-34 37.0918 38.0 38.0 38.0 37.0 38.0 35-39 37.053399999999996 38.0 38.0 38.0 37.0 38.0 40-44 37.042899999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.05925 38.0 38.0 38.0 37.0 38.0 50-54 37.009499999999996 38.0 38.0 38.0 36.6 38.0 55-59 36.9584 38.0 38.0 38.0 36.0 38.0 60-64 36.8934 38.0 38.0 38.0 36.0 38.0 65-69 36.88615 38.0 38.0 38.0 36.0 38.0 70-74 36.7835 38.0 38.0 38.0 35.8 38.0 75-79 36.62925 38.0 38.0 38.0 35.0 38.0 80-84 36.531949999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.49375 38.0 38.0 38.0 34.6 38.0 90-94 36.32105 38.0 38.0 38.0 34.0 38.0 95-99 36.27265 38.0 38.0 38.0 34.0 38.0 100-104 36.0135 38.0 38.0 38.0 33.6 38.0 105-109 35.79395 38.0 37.4 38.0 32.6 38.0 110-114 35.727850000000004 38.0 37.0 38.0 32.2 38.0 115-119 35.39490000000001 38.0 37.0 38.0 30.6 38.0 120-124 35.127950000000006 38.0 36.4 38.0 29.0 38.0 125-129 34.7555 38.0 36.0 38.0 27.4 38.0 130-134 34.04445 38.0 34.2 38.0 23.4 38.0 135-139 33.49915 38.0 33.0 38.0 20.8 38.0 140-144 32.83345 38.0 33.0 38.0 14.0 38.0 145-149 31.811500000000002 38.0 33.0 38.0 8.2 38.0 150-151 26.449875 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 4.0 4 2.0 5 1.0 6 3.0 7 0.0 8 1.0 9 3.0 10 1.0 11 1.0 12 1.0 13 3.0 14 1.0 15 6.0 16 5.0 17 4.0 18 6.0 19 6.0 20 12.0 21 15.0 22 15.0 23 12.0 24 18.0 25 19.0 26 29.0 27 29.0 28 36.0 29 38.0 30 47.0 31 63.0 32 66.0 33 102.0 34 137.0 35 257.0 36 613.0 37 2441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.05 19.15 12.075 21.725 2 26.858573216520647 22.453066332916144 32.89111389236546 17.797246558197745 3 21.501877346683354 25.406758448060074 34.31789737171464 18.773466833541928 4 24.262131065532767 33.2416208104052 23.011505752876438 19.484742371185593 5 23.62953692115144 36.64580725907384 22.27784730913642 17.4468085106383 6 21.8 35.4 22.775000000000002 20.025000000000002 7 19.35 19.900000000000002 40.1 20.65 8 20.474999999999998 23.375 28.675 27.474999999999998 9 22.675 24.675 28.299999999999997 24.349999999999998 10-14 23.33116655832792 28.191409570478527 26.48632431621581 21.99109955497775 15-19 22.792279227922794 27.61776177617762 28.202820282028203 21.387138713871387 20-24 22.926878063419025 27.89336801040312 28.06842052615785 21.111333400020005 25-29 22.718854797537414 27.949346814154865 28.580009009459932 20.75178937884779 30-34 22.59629814907454 27.55377688844422 28.634317158579293 21.21560780390195 35-39 23.093082578902617 27.294553093582753 28.755064272495375 20.857300055019255 40-44 23.087315486614962 27.195396547410557 28.836627470602956 20.88066049537153 45-49 23.12656328164082 27.368684342171086 28.38919459729865 21.115557778889446 50-54 23.185433445050272 27.51738282227002 28.502826271822318 20.794357460857384 55-59 22.87300555194318 27.884759665883056 28.059820937328066 21.182413844845698 60-64 22.975743935983996 27.97199299824956 28.22205551387847 20.830207551887973 65-69 23.3631771119892 27.839743910368632 27.75471414995248 21.042364827689692 70-74 23.23313159605862 28.329915470414647 27.80473165607963 20.63222127744711 75-79 22.600650162540635 28.00200050012503 27.97199299824956 21.42535633908477 80-84 23.128094833191618 28.049817436102636 28.29990496673836 20.52218276396739 85-89 23.69855478321748 28.494274141121167 27.104065609841477 20.703105465819874 90-94 23.284656931386277 28.220644128825768 27.855571114222844 20.63912782556511 95-99 23.391169558477923 27.45137256862843 28.191409570478527 20.96604830241512 100-104 23.85596399099775 27.7569392348087 27.71692923230808 20.67016754188547 105-109 24.27228168450535 27.363208962688805 27.978393518055416 20.386115834750427 110-114 24.04360654098115 27.124068610291545 28.294244136620495 20.538080712106815 115-119 24.8062015503876 28.217054263565895 27.16679169792448 19.809952488122033 120-124 24.63492698539708 27.4004800960192 27.690538107621528 20.27405481096219 125-129 24.79743923176953 28.16845053516055 27.043112933880163 19.990997299189754 130-134 24.73747374737474 27.482748274827486 27.437743774377438 20.342034203420344 135-139 25.367610283084925 27.858357507252173 27.053115934780436 19.720916274882462 140-144 25.298794819222888 27.999199879981994 27.33910086512977 19.36290443566535 145-149 25.646411602900727 27.176794198549636 27.121780445111277 20.05501375343836 150-151 25.978247280910118 27.25340667583448 27.028378547318415 19.73996749593699 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.5 17 1.5 18 0.5 19 0.5 20 1.0 21 0.5 22 1.0 23 1.5 24 1.0 25 2.5 26 6.0 27 5.5 28 3.5 29 8.0 30 18.5 31 26.5 32 28.0 33 37.5 34 53.5 35 64.0 36 79.5 37 98.0 38 122.5 39 172.5 40 194.0 41 197.5 42 229.0 43 261.5 44 275.0 45 280.0 46 271.5 47 264.0 48 251.5 49 205.5 50 172.0 51 153.0 52 126.0 53 95.0 54 73.0 55 53.5 56 39.5 57 34.0 58 27.0 59 21.5 60 14.0 61 9.0 62 5.5 63 2.5 64 2.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.125 4 0.05 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.01 20-24 0.03 25-29 0.105 30-34 0.05 35-39 0.034999999999999996 40-44 0.075 45-49 0.05 50-54 0.045 55-59 0.034999999999999996 60-64 0.025 65-69 0.034999999999999996 70-74 0.034999999999999996 75-79 0.025 80-84 0.034999999999999996 85-89 0.015 90-94 0.02 95-99 0.005 100-104 0.025 105-109 0.03 110-114 0.015 115-119 0.025 120-124 0.02 125-129 0.03 130-134 0.01 135-139 0.03 140-144 0.015 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29346454706031 98.375 2 0.6056018168054504 1.2 3 0.0757002271006813 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025233409033560434 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 33bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.32499999999999996 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.6625000000000001 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.9 0.0 0.0 0.0 0.0 94-95 1.0499999999999998 0.0 0.0 0.0 0.0 96-97 1.3624999999999998 0.0 0.0 0.0 0.0 98-99 1.6124999999999998 0.0 0.0 0.0 0.0 100-101 1.8625 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.45 0.0 0.0 0.0 0.0 106-107 2.85 0.0 0.0 0.0 0.0 108-109 3.5125 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.4375 0.0 0.0 0.0 0.0 114-115 4.8125 0.0 0.0 0.0 0.0 116-117 5.324999999999999 0.0 0.0 0.0 0.0 118-119 5.9375 0.0 0.0 0.0 0.0 120-121 6.3125 0.0 0.0 0.0 0.0 122-123 6.725 0.0 0.0 0.0 0.0 124-125 7.3375 0.0 0.0 0.0 0.0 126-127 8.2375 0.0 0.0 0.0 0.0 128-129 9.087499999999999 0.0 0.0 0.0 0.0 130-131 9.7875 0.0 0.0 0.0 0.0 132-133 10.6 0.0 0.0 0.0 0.0 134-135 11.4125 0.0 0.0 0.0 0.0 136-137 12.0 0.0 0.0 0.0 0.0 138-139 12.725000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTAT 10 0.006830828 145.0 5 GGCATGC 10 0.006830828 145.0 7 AAAAAAA 30 0.0014437955 24.166668 120-124 >>END_MODULE Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714294 spots for SRR7170836.sra Written 714294 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra Read 714288 spots for SRR7170836.sra Written 714288 spots for SRR7170836.sra SRR ids: ['SRR7170836.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8xij6zhp SRR7170836.sra spots: 14285766 blocks: [[1, 714288], [714289, 1428576], [1428577, 2142864], [2142865, 2857152], [2857153, 3571440], [3571441, 4285728], [4285729, 5000016], [5000017, 5714304], [5714305, 6428592], [6428593, 7142880], [7142881, 7857168], [7857169, 8571456], [8571457, 9285744], [9285745, 10000032], [10000033, 10714320], [10714321, 11428608], [11428609, 12142896], [12142897, 12857184], [12857185, 13571472], [13571473, 14285766]] SRR7170836 file size 4819276 SRR7170836 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170836 SRR7170836_1.fastq SRR7170836_2.fastq Input file: SRR7170836_1.fastq Paired file: SRR7170836_2.fastq trimmed: SRR7170836-trimmed-pair1.fastq, SRR7170836-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:27:30 2025 >> started Thu Feb 13 18:27:47 2025 >> done (17.092s) 14285766 read pairs processed; of these: 26326 ( 0.18%) short read pairs filtered out after trimming by size control 48795 ( 0.34%) empty read pairs filtered out after trimming by size control 14210645 (99.47%) read pairs available; of these: 9791056 (68.90%) trimmed read pairs available after processing 4419589 (31.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 11 0.00% 20 14 0.00% 21 19 0.00% 22 19 0.00% 23 16 0.00% 24 13 0.00% 25 28 0.00% 26 29 0.00% 27 30 0.00% 28 29 0.00% 29 28 0.00% 30 22 0.00% 31 22 0.00% 32 31 0.00% 33 39 0.00% 34 26 0.00% 35 37 0.00% 36 36 0.00% 37 45 0.00% 38 35 0.00% 39 48 0.00% 40 58 0.00% 41 77 0.00% 42 78 0.00% 43 77 0.00% 44 86 0.00% 45 92 0.00% 46 98 0.00% 47 125 0.00% 48 150 0.00% 49 148 0.00% 50 172 0.00% 51 238 0.00% 52 252 0.00% 53 256 0.00% 54 335 0.00% 55 343 0.00% 56 339 0.00% 57 403 0.00% 58 434 0.00% 59 559 0.00% 60 673 0.00% 61 781 0.01% 62 918 0.01% 63 949 0.01% 64 1050 0.01% 65 1143 0.01% 66 1183 0.01% 67 1288 0.01% 68 1427 0.01% 69 1715 0.01% 70 2024 0.01% 71 2558 0.02% 72 2873 0.02% 73 3253 0.02% 74 3567 0.03% 75 3790 0.03% 76 5291 0.04% 77 5580 0.04% 78 4725 0.03% 79 5022 0.04% 80 5628 0.04% 81 6919 0.05% 82 7876 0.06% 83 9265 0.07% 84 11307 0.08% 85 11083 0.08% 86 10731 0.08% 87 11460 0.08% 88 11721 0.08% 89 12603 0.09% 90 13671 0.10% 91 15136 0.11% 92 16863 0.12% 93 18663 0.13% 94 19808 0.14% 95 20897 0.15% 96 20875 0.15% 97 21111 0.15% 98 21285 0.15% 99 21948 0.15% 100 23758 0.17% 101 24955 0.18% 102 28151 0.20% 103 30683 0.22% 104 32345 0.23% 105 33404 0.24% 106 33923 0.24% 107 33697 0.24% 108 33873 0.24% 109 34385 0.24% 110 35377 0.25% 111 37977 0.27% 112 40280 0.28% 113 42970 0.30% 114 46018 0.32% 115 47556 0.33% 116 48526 0.34% 117 49165 0.35% 118 48590 0.34% 119 48932 0.34% 120 50510 0.36% 121 52077 0.37% 122 54966 0.39% 123 59348 0.42% 124 62880 0.44% 125 65563 0.46% 126 68208 0.48% 127 69055 0.49% 128 69613 0.49% 129 71605 0.50% 130 73351 0.52% 131 76418 0.54% 132 81366 0.57% 133 87231 0.61% 134 93767 0.66% 135 100228 0.71% 136 106280 0.75% 137 112666 0.79% 138 117979 0.83% 139 125240 0.88% 140 134683 0.95% 141 147219 1.04% 142 163131 1.15% 143 185462 1.31% 144 216820 1.53% 145 256304 1.80% 146 317310 2.23% 147 416712 2.93% 148 614614 4.33% 149 1124688 7.91% 150 3517625 24.75% 151 4419589 31.10% 14210645 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=20 prefix-density=0.43 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=36.04 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=29 prefix-density=0.60 prefix-fanout=1.9 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=80.59 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=8.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170836 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:28:39 Started mapping on | Feb 13 18:28:39 Finished on | Feb 13 18:30:49 Mapping speed, Million of reads per hour | 393.53 Number of input reads | 14210645 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 13355561 Uniquely mapped reads % | 93.98% Average mapped length | 286.81 Number of splices: Total | 12106441 Number of splices: Annotated (sjdb) | 11810751 Number of splices: GT/AG | 11858177 Number of splices: GC/AG | 192004 Number of splices: AT/AC | 8319 Number of splices: Non-canonical | 47941 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413056 % of reads mapped to multiple loci | 2.91% Number of reads mapped to too many loci | 58265 % of reads mapped to too many loci | 0.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.61% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 461004 461004 461004 N_multimapping 413056 413056 413056 N_noFeature 495072 13091373 625965 N_ambiguous 243878 1161 109771 UnstrandedReadsAssigned:12616611 PositiveStrandReadsAssigned:263027 NegativeStrandReadsAssigned:12619825 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170836 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170836-trimmed-pair1.fastq SRR7170836-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,210,645 reads, 12,626,002 reads pseudoaligned [quant] estimated average fragment length: 226.181 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,008 rounds 52401 SRR7170836.ke.tsv 34699 SRR7170836.se.tsv 87100 total ==> SRR7170836.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.82 758 31.8843 Potri.005G024800.1.v4.1 1035 809.819 287 26.7263 Potri.004G059700.1.v4.1 961 735.885 0 0 Potri.007G009000.2.v4.1 1416 1190.82 0 0 Potri.003G141000.2.v4.1 2943 2717.82 480.269 13.3263 Potri.016G087400.1.v4.1 270 94.2159 806 645.142 Potri.015G069301.1.v4.1 564 345.761 0 0 Potri.010G195200.1.v4.1 1773 1547.82 69 3.36181 Potri.012G127500.1.v4.1 977 751.853 374 37.5131 ==> SRR7170836.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 777 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 334 Potri.001G212900.v4.1 27 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 126 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170836 completed mapping pipeline successfully