Starting /dee2/code/volunteer_pipeline.sh SRR7170837 current disk space = 3088104148992 free memory = 1449775504 SRR7170837 SRAfilesize c2bc396148677d5c9bdc9899e4e4c827 SRR7170837.sra SRR7170837.sra file validated SRR7170837 is paired end SRR7170837 is conventional basespace SRR7170837 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170837_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.492 34.0 33.0 34.0 32.0 34.0 2 33.237 34.0 33.0 34.0 32.0 34.0 3 33.1805 34.0 33.0 34.0 32.0 34.0 4 33.203 34.0 33.0 34.0 31.0 34.0 5 33.369 34.0 33.0 34.0 33.0 34.0 6 36.82325 38.0 37.0 38.0 35.0 38.0 7 37.18225 38.0 38.0 38.0 36.0 38.0 8 37.2885 38.0 38.0 38.0 37.0 38.0 9 37.451 38.0 38.0 38.0 37.0 38.0 10-14 37.37535 38.0 38.0 38.0 37.0 38.0 15-19 37.3172 38.0 38.0 38.0 36.8 38.0 20-24 37.27065 38.0 38.0 38.0 36.8 38.0 25-29 37.3374 38.0 38.0 38.0 37.0 38.0 30-34 37.133300000000006 38.0 38.0 38.0 36.2 38.0 35-39 37.0681 38.0 38.0 38.0 36.0 38.0 40-44 37.047700000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.97775 38.0 38.0 38.0 35.6 38.0 50-54 36.7955 38.0 38.0 38.0 34.8 38.0 55-59 36.60775 38.0 38.0 38.0 34.2 38.0 60-64 36.464 38.0 38.0 38.0 34.0 38.0 65-69 36.533550000000005 38.0 38.0 38.0 34.0 38.0 70-74 36.4971 38.0 38.0 38.0 34.0 38.0 75-79 36.4401 38.0 38.0 38.0 34.0 38.0 80-84 36.115050000000004 38.0 37.0 38.0 33.2 38.0 85-89 36.12365 38.0 37.0 38.0 33.0 38.0 90-94 35.93105 38.0 37.0 38.0 32.2 38.0 95-99 35.7842 38.0 36.8 38.0 31.0 38.0 100-104 35.358999999999995 38.0 36.0 38.0 29.2 38.0 105-109 34.9277 38.0 35.8 38.0 27.6 38.0 110-114 34.17565 38.0 33.8 38.0 22.4 38.0 115-119 34.0466 38.0 33.8 38.0 23.2 38.0 120-124 33.74575 38.0 33.4 38.0 22.2 38.0 125-129 32.776050000000005 38.0 32.6 38.0 15.6 38.0 130-134 32.057100000000005 37.4 30.8 38.0 14.2 38.0 135-139 31.167849999999998 36.8 28.4 38.0 12.8 38.0 140-144 30.671550000000003 36.0 28.0 38.0 11.8 38.0 145-149 28.898900000000005 36.0 25.8 38.0 2.0 38.0 150-151 22.039125 27.0 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 4.0 18 4.0 19 12.0 20 11.0 21 14.0 22 19.0 23 24.0 24 23.0 25 26.0 26 40.0 27 43.0 28 50.0 29 57.0 30 69.0 31 105.0 32 125.0 33 196.0 34 284.0 35 530.0 36 1129.0 37 1229.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.61874197689345 17.637997432605907 10.012836970474968 29.730423620025675 2 22.025 20.525 34.35 23.1 3 17.059118236472944 29.183366733466933 30.135270541082164 23.622244488977955 4 20.974999999999998 33.875 24.6 20.549999999999997 5 20.575 38.95 22.55 17.925 6 18.925 37.625 23.925 19.525000000000002 7 14.399999999999999 23.974999999999998 42.675000000000004 18.95 8 17.825 23.474999999999998 30.95 27.750000000000004 9 17.625 23.599999999999998 31.924999999999997 26.85 10-14 20.645 29.220000000000002 26.625 23.51 15-19 20.075000000000003 28.355000000000004 28.349999999999998 23.22 20-24 20.07 29.17 26.905 23.855 25-29 19.84 28.875 27.794999999999998 23.49 30-34 20.215 28.515 27.96 23.31 35-39 20.46 29.470000000000002 26.93 23.14 40-44 20.115 28.955 27.05 23.880000000000003 45-49 20.075000000000003 28.685 27.735 23.505000000000003 50-54 20.345 28.365000000000002 27.92 23.369999999999997 55-59 20.349999999999998 28.685 27.339999999999996 23.625 60-64 20.095 28.67 27.925 23.31 65-69 20.765 28.035 28.044999999999998 23.155 70-74 20.294999999999998 28.73 27.505000000000003 23.47 75-79 20.285 28.939999999999998 27.185 23.59 80-84 20.52 28.225 27.205000000000002 24.05 85-89 20.05 28.494999999999997 27.575 23.880000000000003 90-94 20.16 28.24 27.560000000000002 24.04 95-99 20.57 27.815 28.04 23.575 100-104 20.565 29.080000000000002 26.99 23.365 105-109 20.515 28.63 27.425 23.43 110-114 20.785 28.810000000000002 26.900000000000002 23.505000000000003 115-119 20.765 28.625 27.245 23.365 120-124 20.865000000000002 28.405 26.615 24.115000000000002 125-129 20.845 28.804999999999996 26.685 23.665 130-134 21.385 28.03 26.715 23.87 135-139 21.185000000000002 28.689999999999998 26.825 23.3 140-144 21.2 28.03 26.669999999999998 24.099999999999998 145-149 21.035 28.355000000000004 26.735 23.875 150-151 20.8625 28.3375 26.3625 24.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 2.0 19 1.0 20 0.5 21 1.0 22 2.5 23 4.0 24 3.0 25 4.0 26 6.5 27 10.5 28 14.5 29 15.5 30 22.0 31 30.0 32 41.5 33 52.5 34 58.5 35 80.5 36 96.5 37 117.0 38 141.0 39 161.5 40 177.5 41 199.0 42 216.5 43 235.0 44 258.5 45 264.5 46 254.5 47 252.0 48 243.0 49 203.0 50 175.0 51 142.5 52 107.5 53 92.0 54 80.0 55 66.0 56 52.5 57 36.5 58 25.5 59 19.0 60 13.5 61 6.5 62 3.5 63 2.5 64 1.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.2 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.65208545269583 96.975 2 1.119023397761953 2.1999999999999997 3 0.1525940996948118 0.44999999999999996 4 0.025432349949135298 0.1 5 0.025432349949135298 0.125 6 0.025432349949135298 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 35bp) GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.2875 0.0 0.0 0.0 0.0 98-99 1.4874999999999998 0.0 0.0 0.0 0.0 100-101 1.7125 0.0 0.0 0.0 0.0 102-103 2.05 0.0 0.0 0.0 0.0 104-105 2.425 0.0 0.0 0.0 0.0 106-107 2.875 0.0 0.0 0.0 0.0 108-109 3.2 0.0 0.0 0.0 0.0 110-111 3.6125 0.0 0.0 0.0 0.0 112-113 4.1875 0.0 0.0 0.0 0.0 114-115 4.6625 0.0 0.0 0.0 0.0 116-117 5.237500000000001 0.0 0.0 0.0 0.0 118-119 5.7125 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.4625 0.0 0.0 0.0 0.0 124-125 6.85 0.0 0.0 0.0 0.0 126-127 7.5375 0.0 0.0 0.0 0.0 128-129 8.0 0.0 0.0 0.0 0.0 130-131 8.7625 0.0 0.0 0.0 0.0 132-133 9.35 0.0 0.0 0.0 0.0 134-135 9.9125 0.0 0.0 0.0 0.0 136-137 10.55 0.0 0.0 0.0 0.0 138-139 11.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170837 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170837_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.984 33.0 33.0 34.0 32.0 34.0 2 33.01225 34.0 33.0 34.0 32.0 34.0 3 33.03375 34.0 33.0 34.0 32.0 34.0 4 33.02825 34.0 33.0 34.0 33.0 34.0 5 33.02 34.0 33.0 34.0 32.0 34.0 6 37.2295 38.0 38.0 38.0 37.0 38.0 7 37.348 38.0 38.0 38.0 37.0 38.0 8 37.19925 38.0 38.0 38.0 37.0 38.0 9 37.1825 38.0 38.0 38.0 37.0 38.0 10-14 37.2066 38.0 38.0 38.0 37.0 38.0 15-19 37.197 38.0 38.0 38.0 37.0 38.0 20-24 37.1325 38.0 38.0 38.0 37.0 38.0 25-29 37.1065 38.0 38.0 38.0 36.8 38.0 30-34 37.04675 38.0 38.0 38.0 36.4 38.0 35-39 37.037800000000004 38.0 38.0 38.0 36.2 38.0 40-44 37.0927 38.0 38.0 38.0 36.6 38.0 45-49 37.053450000000005 38.0 38.0 38.0 36.2 38.0 50-54 37.01685 38.0 38.0 38.0 36.0 38.0 55-59 36.945299999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.9011 38.0 38.0 38.0 36.0 38.0 65-69 36.854400000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.72645 38.0 38.0 38.0 35.2 38.0 75-79 36.6601 38.0 38.0 38.0 34.8 38.0 80-84 36.51944999999999 38.0 38.0 38.0 34.2 38.0 85-89 36.442899999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.27975 38.0 38.0 38.0 34.0 38.0 95-99 36.10315 38.0 37.4 38.0 33.2 38.0 100-104 35.9247 38.0 37.0 38.0 33.0 38.0 105-109 35.818000000000005 38.0 37.0 38.0 31.8 38.0 110-114 35.651300000000006 38.0 37.0 38.0 31.2 38.0 115-119 35.29065 38.0 36.2 38.0 29.0 38.0 120-124 35.00445 38.0 35.8 38.0 28.0 38.0 125-129 34.4248 38.0 34.4 38.0 24.4 38.0 130-134 33.90335 38.0 33.4 38.0 22.8 38.0 135-139 33.37985 38.0 33.0 38.0 19.8 38.0 140-144 32.6702 38.0 33.0 38.0 14.4 38.0 145-149 31.477500000000003 38.0 31.6 38.0 8.4 38.0 150-151 25.478875000000002 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 0.0 5 1.0 6 1.0 7 0.0 8 1.0 9 2.0 10 1.0 11 2.0 12 3.0 13 1.0 14 3.0 15 4.0 16 3.0 17 4.0 18 2.0 19 8.0 20 7.0 21 8.0 22 18.0 23 11.0 24 13.0 25 24.0 26 29.0 27 23.0 28 33.0 29 38.0 30 53.0 31 79.0 32 79.0 33 115.0 34 180.0 35 358.0 36 754.0 37 2135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.6 21.125 12.1 23.175 2 26.174999999999997 23.75 31.75 18.325 3 20.75 27.700000000000003 31.924999999999997 19.625 4 24.425 35.25 22.2 18.125 5 24.125 36.199999999999996 21.099999999999998 18.575 6 20.175 37.65 21.925 20.25 7 19.575 19.5 39.775 21.15 8 20.0 25.5 27.150000000000002 27.35 9 22.425 24.425 27.500000000000004 25.650000000000002 10-14 22.93 28.63 26.674999999999997 21.765 15-19 23.285 28.01 27.815 20.89 20-24 22.805 28.065 27.735 21.395 25-29 22.78 28.4 27.99 20.830000000000002 30-34 22.29 28.32 28.22 21.17 35-39 22.35 27.400000000000002 28.84 21.41 40-44 23.31 27.49 28.310000000000002 20.89 45-49 22.585 27.97 28.205000000000002 21.240000000000002 50-54 22.835 27.860000000000003 28.16 21.145 55-59 23.76 27.189999999999998 27.675 21.375 60-64 23.044999999999998 27.750000000000004 27.73 21.475 65-69 23.400000000000002 27.315 28.04 21.245 70-74 23.52 27.029999999999998 28.025 21.425 75-79 23.23 27.779999999999998 27.36 21.63 80-84 23.47 28.015 27.525 20.990000000000002 85-89 23.48 28.17 27.235 21.115000000000002 90-94 23.815 28.065 27.46 20.66 95-99 23.599999999999998 27.644999999999996 27.57 21.185000000000002 100-104 23.855 27.97 26.955000000000002 21.22 105-109 23.494999999999997 28.105000000000004 28.294999999999998 20.105 110-114 24.525 28.345 27.150000000000002 19.98 115-119 24.695 28.185 26.924999999999997 20.195 120-124 25.235000000000003 27.0 27.57 20.195 125-129 25.185000000000002 27.355 27.185 20.275000000000002 130-134 25.019999999999996 27.625 27.365000000000002 19.99 135-139 25.45 27.6 26.51 20.44 140-144 25.669999999999998 27.860000000000003 27.150000000000002 19.32 145-149 26.195 27.54 26.484999999999996 19.78 150-151 25.2 28.3375 27.0125 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.5 22 2.0 23 1.5 24 3.0 25 5.0 26 4.0 27 4.5 28 8.0 29 11.0 30 13.5 31 17.0 32 19.0 33 22.0 34 42.0 35 59.0 36 72.0 37 99.0 38 126.0 39 157.0 40 188.0 41 213.5 42 262.5 43 278.0 44 254.5 45 264.5 46 277.5 47 257.0 48 227.0 49 220.5 50 190.5 51 141.0 52 120.0 53 102.0 54 93.0 55 81.5 56 55.5 57 37.5 58 24.5 59 15.0 60 10.5 61 6.5 62 3.0 63 2.5 64 2.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.81990764494613 96.3 2 0.6926629040533607 1.35 3 0.1539250897896357 0.44999999999999996 4 0.1539250897896357 0.6 5 0.0 0.0 6 0.07696254489481785 0.44999999999999996 7 0.02565418163160595 0.17500000000000002 8 0.02565418163160595 0.2 9 0.02565418163160595 0.22499999999999998 >10 0.02565418163160595 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 9 0.22499999999999998 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCT 7 0.17500000000000002 Illumina Single End PCR Primer 1 (96% over 33bp) GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 6 0.15 No Hit GAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGA 6 0.15 No Hit CATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCAT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.925 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.2374999999999998 0.0 0.0 0.0 0.0 96-97 1.3375 0.0 0.0 0.0 0.0 98-99 1.5375 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.0999999999999996 0.0 0.0 0.0 0.0 104-105 2.4625000000000004 0.0 0.0 0.0 0.0 106-107 2.9 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 4.1375 0.0 0.0 0.0 0.0 114-115 4.6125 0.0 0.0 0.0 0.0 116-117 5.1625 0.0 0.0 0.0 0.0 118-119 5.65 0.0 0.0 0.0 0.0 120-121 6.137499999999999 0.0 0.0 0.0 0.0 122-123 6.449999999999999 0.0 0.0 0.0 0.0 124-125 6.8625 0.0 0.0 0.0 0.0 126-127 7.525 0.0 0.0 0.0 0.0 128-129 7.9875 0.0 0.0 0.0 0.0 130-131 8.649999999999999 0.0 0.0 0.0 0.0 132-133 9.2375 0.0 0.0 0.0 0.0 134-135 9.8125 0.0 0.0 0.0 0.0 136-137 10.4 0.0 0.0 0.0 0.0 138-139 10.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680585 spots for SRR7170837.sra Written 680585 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra Read 680574 spots for SRR7170837.sra Written 680574 spots for SRR7170837.sra SRR ids: ['SRR7170837.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_edhweai6 SRR7170837.sra spots: 13611491 blocks: [[1, 680574], [680575, 1361148], [1361149, 2041722], [2041723, 2722296], [2722297, 3402870], [3402871, 4083444], [4083445, 4764018], [4764019, 5444592], [5444593, 6125166], [6125167, 6805740], [6805741, 7486314], [7486315, 8166888], [8166889, 8847462], [8847463, 9528036], [9528037, 10208610], [10208611, 10889184], [10889185, 11569758], [11569759, 12250332], [12250333, 12930906], [12930907, 13611491]] SRR7170837 file size 4590787 SRR7170837 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170837 SRR7170837_1.fastq SRR7170837_2.fastq Input file: SRR7170837_1.fastq Paired file: SRR7170837_2.fastq trimmed: SRR7170837-trimmed-pair1.fastq, SRR7170837-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:25:12 2025 >> started Thu Feb 13 18:25:33 2025 >> done (21.244s) 13611491 read pairs processed; of these: 18785 ( 0.14%) short read pairs filtered out after trimming by size control 55113 ( 0.40%) empty read pairs filtered out after trimming by size control 13537593 (99.46%) read pairs available; of these: 9480687 (70.03%) trimmed read pairs available after processing 4056906 (29.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 14 0.00% 21 7 0.00% 22 14 0.00% 23 7 0.00% 24 15 0.00% 25 10 0.00% 26 16 0.00% 27 18 0.00% 28 21 0.00% 29 15 0.00% 30 22 0.00% 31 21 0.00% 32 26 0.00% 33 25 0.00% 34 28 0.00% 35 37 0.00% 36 33 0.00% 37 33 0.00% 38 31 0.00% 39 40 0.00% 40 55 0.00% 41 63 0.00% 42 71 0.00% 43 74 0.00% 44 90 0.00% 45 70 0.00% 46 86 0.00% 47 102 0.00% 48 118 0.00% 49 127 0.00% 50 164 0.00% 51 203 0.00% 52 226 0.00% 53 258 0.00% 54 270 0.00% 55 248 0.00% 56 333 0.00% 57 362 0.00% 58 421 0.00% 59 501 0.00% 60 558 0.00% 61 638 0.00% 62 841 0.01% 63 883 0.01% 64 924 0.01% 65 1016 0.01% 66 1062 0.01% 67 1020 0.01% 68 1193 0.01% 69 1461 0.01% 70 1752 0.01% 71 2148 0.02% 72 2475 0.02% 73 2815 0.02% 74 3231 0.02% 75 3490 0.03% 76 5067 0.04% 77 4966 0.04% 78 4121 0.03% 79 4324 0.03% 80 4996 0.04% 81 6004 0.04% 82 7105 0.05% 83 7948 0.06% 84 9161 0.07% 85 9740 0.07% 86 10053 0.07% 87 10328 0.08% 88 10717 0.08% 89 11168 0.08% 90 12355 0.09% 91 13811 0.10% 92 15394 0.11% 93 17578 0.13% 94 18415 0.14% 95 19594 0.14% 96 19588 0.14% 97 19786 0.15% 98 19637 0.15% 99 20451 0.15% 100 21642 0.16% 101 23211 0.17% 102 26601 0.20% 103 28125 0.21% 104 29978 0.22% 105 31484 0.23% 106 31480 0.23% 107 31469 0.23% 108 31919 0.24% 109 32271 0.24% 110 33203 0.25% 111 35316 0.26% 112 37580 0.28% 113 40588 0.30% 114 43644 0.32% 115 45281 0.33% 116 46154 0.34% 117 46231 0.34% 118 46175 0.34% 119 46503 0.34% 120 47277 0.35% 121 49585 0.37% 122 52185 0.39% 123 56214 0.42% 124 59775 0.44% 125 62373 0.46% 126 64819 0.48% 127 66233 0.49% 128 67005 0.49% 129 68844 0.51% 130 70156 0.52% 131 72960 0.54% 132 77504 0.57% 133 83797 0.62% 134 89989 0.66% 135 97027 0.72% 136 103468 0.76% 137 109484 0.81% 138 116293 0.86% 139 124413 0.92% 140 131239 0.97% 141 143819 1.06% 142 159524 1.18% 143 181713 1.34% 144 213707 1.58% 145 253684 1.87% 146 312401 2.31% 147 413216 3.05% 148 604483 4.47% 149 1097077 8.10% 150 3409457 25.19% 151 4056906 29.97% 13537593 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=18 prefix-density=0.67 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=23 fanout-score=16.96 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=5.6 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGTG criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=20 prefix-density=0.89 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.23 sequence-density-rank=20 fanout-score=14.51 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=5.4 sequence=AGCAATGGCAGCA SRR7170837 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:26:17 Started mapping on | Feb 13 18:26:18 Finished on | Feb 13 18:27:36 Mapping speed, Million of reads per hour | 624.81 Number of input reads | 13537593 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 12923795 Uniquely mapped reads % | 95.47% Average mapped length | 287.00 Number of splices: Total | 12673280 Number of splices: Annotated (sjdb) | 12399359 Number of splices: GT/AG | 12441518 Number of splices: GC/AG | 181631 Number of splices: AT/AC | 8248 Number of splices: Non-canonical | 41883 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313683 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 21367 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 314873 314873 314873 N_multimapping 313683 313683 313683 N_noFeature 396927 12608187 519000 N_ambiguous 286223 810 92172 UnstrandedReadsAssigned:12240645 PositiveStrandReadsAssigned:314798 NegativeStrandReadsAssigned:12312623 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170837 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170837-trimmed-pair1.fastq SRR7170837-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,537,593 reads, 12,246,507 reads pseudoaligned [quant] estimated average fragment length: 225.451 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7170837.ke.tsv 34699 SRR7170837.se.tsv 87100 total ==> SRR7170837.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.55 494 16.4139 Potri.005G024800.1.v4.1 1035 810.549 319 23.4536 Potri.004G059700.1.v4.1 961 736.572 18 1.45631 Potri.007G009000.2.v4.1 1416 1191.55 0 0 Potri.003G141000.2.v4.1 2943 2718.55 550.745 12.0729 Potri.016G087400.1.v4.1 270 93.4321 843 537.687 Potri.015G069301.1.v4.1 564 344.679 0 0 Potri.010G195200.1.v4.1 1773 1548.55 55 2.11658 Potri.012G127500.1.v4.1 977 752.572 163 12.9074 ==> SRR7170837.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 412 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 366 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 177 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR7170837 completed mapping pipeline successfully