Starting /dee2/code/volunteer_pipeline.sh SRR7170838 current disk space = 3088188637184 free memory = 1436738568 SRR7170838 SRAfilesize 5b31b419d09356e26690b4c6f4084379 SRR7170838.sra SRR7170838.sra file validated SRR7170838 is paired end SRR7170838 is conventional basespace SRR7170838 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170838_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.701 34.0 33.0 34.0 32.0 34.0 2 33.33075 34.0 33.0 34.0 33.0 34.0 3 33.275 34.0 33.0 34.0 33.0 34.0 4 33.36525 34.0 33.0 34.0 33.0 34.0 5 33.2745 34.0 33.0 34.0 33.0 34.0 6 36.91575 38.0 37.0 38.0 35.0 38.0 7 37.26425 38.0 38.0 38.0 36.0 38.0 8 37.4455 38.0 38.0 38.0 37.0 38.0 9 37.56125 38.0 38.0 38.0 37.0 38.0 10-14 37.5269 38.0 38.0 38.0 37.6 38.0 15-19 37.43685 38.0 38.0 38.0 37.0 38.0 20-24 37.394850000000005 38.0 38.0 38.0 37.0 38.0 25-29 37.3384 38.0 38.0 38.0 37.0 38.0 30-34 37.35995 38.0 38.0 38.0 37.0 38.0 35-39 37.281099999999995 38.0 38.0 38.0 36.8 38.0 40-44 37.2328 38.0 38.0 38.0 36.8 38.0 45-49 37.14335 38.0 38.0 38.0 36.0 38.0 50-54 37.05749999999999 38.0 38.0 38.0 36.0 38.0 55-59 37.03035 38.0 38.0 38.0 36.0 38.0 60-64 36.99294999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.84325 38.0 38.0 38.0 35.0 38.0 70-74 36.82185 38.0 38.0 38.0 35.0 38.0 75-79 36.6299 38.0 38.0 38.0 34.8 38.0 80-84 36.54055 38.0 38.0 38.0 34.0 38.0 85-89 36.56015 38.0 38.0 38.0 34.0 38.0 90-94 36.389300000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.302699999999994 38.0 37.8 38.0 34.0 38.0 100-104 36.0121 38.0 37.0 38.0 33.0 38.0 105-109 35.854499999999994 38.0 37.0 38.0 32.2 38.0 110-114 35.688449999999996 38.0 36.4 38.0 31.0 38.0 115-119 35.41685 38.0 36.0 38.0 30.2 38.0 120-124 35.1005 38.0 36.0 38.0 28.0 38.0 125-129 34.950100000000006 38.0 35.4 38.0 27.4 38.0 130-134 34.3455 38.0 34.6 38.0 24.4 38.0 135-139 34.1823 38.0 33.8 38.0 24.0 38.0 140-144 33.774350000000005 38.0 33.4 38.0 23.4 38.0 145-149 32.68175 38.0 33.0 38.0 15.4 38.0 150-151 27.809375 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 6.0 19 9.0 20 4.0 21 3.0 22 9.0 23 12.0 24 11.0 25 10.0 26 9.0 27 20.0 28 29.0 29 48.0 30 62.0 31 64.0 32 85.0 33 128.0 34 184.0 35 361.0 36 804.0 37 2135.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.61860940695296 13.957055214723926 9.994887525562373 35.42944785276074 2 18.775 17.75 39.2 24.275 3 16.975 24.4 29.525000000000002 29.099999999999998 4 21.6 31.4 24.825 22.175 5 21.325 36.7 23.9 18.075 6 17.175 38.45 25.324999999999996 19.05 7 13.900000000000002 23.9 44.474999999999994 17.724999999999998 8 17.025000000000002 24.875 31.8 26.3 9 16.45 24.7 33.1 25.75 10-14 18.834999999999997 30.514999999999997 26.91 23.74 15-19 19.744999999999997 29.720000000000002 27.705000000000002 22.830000000000002 20-24 19.345000000000002 29.599999999999998 27.61 23.445 25-29 19.235 29.145 28.144999999999996 23.474999999999998 30-34 19.545 29.805 27.485 23.165 35-39 19.71 29.69 27.87 22.73 40-44 19.61 29.715000000000003 27.245 23.43 45-49 19.985 28.945 28.660000000000004 22.41 50-54 19.314999999999998 29.799999999999997 27.11 23.775 55-59 19.845 29.69 27.61 22.855 60-64 19.835 29.095 27.779999999999998 23.29 65-69 19.705000000000002 29.494999999999997 27.650000000000002 23.150000000000002 70-74 19.865 29.53 27.994999999999997 22.61 75-79 20.03 29.494999999999997 27.400000000000002 23.075000000000003 80-84 19.759999999999998 29.630000000000003 27.07 23.54 85-89 20.845 29.404999999999998 26.88 22.869999999999997 90-94 20.105 29.265 27.905 22.725 95-99 20.65 29.310000000000002 27.075 22.965 100-104 20.305 28.235 27.650000000000002 23.810000000000002 105-109 20.544999999999998 28.794999999999998 27.355 23.305 110-114 20.635 28.53 27.18 23.655 115-119 20.325 29.154999999999998 27.200000000000003 23.32 120-124 20.14 29.15 27.015 23.695 125-129 20.82 28.975 26.39 23.815 130-134 21.16 28.975 26.165 23.7 135-139 21.23 28.689999999999998 26.479999999999997 23.599999999999998 140-144 21.325 28.605000000000004 26.415 23.655 145-149 21.75 28.105000000000004 25.715 24.43 150-151 20.775 28.3625 26.6125 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.5 22 3.5 23 5.0 24 5.5 25 5.5 26 13.0 27 19.5 28 23.5 29 25.0 30 32.5 31 40.0 32 54.0 33 65.5 34 80.5 35 98.0 36 118.5 37 140.0 38 148.5 39 175.5 40 189.5 41 198.0 42 231.0 43 256.5 44 248.0 45 238.0 46 241.5 47 228.0 48 210.0 49 182.0 50 146.0 51 128.5 52 103.5 53 77.0 54 66.5 55 55.5 56 40.0 57 26.5 58 20.0 59 20.5 60 16.5 61 8.5 62 4.5 63 2.0 64 1.0 65 1.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01290812452544 97.8 2 0.8099215388509239 1.6 3 0.12655024044545685 0.375 4 0.02531004808909137 0.1 5 0.02531004808909137 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.9625 0.0 0.0 0.0 0.0 90-91 1.2375 0.0 0.0 0.0 0.0 92-93 1.4375 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 1.975 0.0 0.0 0.0 0.0 98-99 2.325 0.0 0.0 0.0 0.0 100-101 2.5125 0.0 0.0 0.0 0.0 102-103 2.8125 0.0 0.0 0.0 0.0 104-105 3.1625 0.0 0.0 0.0 0.0 106-107 3.4125 0.0 0.0 0.0 0.0 108-109 3.9875000000000003 0.0 0.0 0.0 0.0 110-111 4.574999999999999 0.0 0.0 0.0 0.0 112-113 5.15 0.0 0.0 0.0 0.0 114-115 5.625 0.0 0.0 0.0 0.0 116-117 6.1875 0.0 0.0 0.0 0.0 118-119 6.7125 0.0 0.0 0.0 0.0 120-121 7.4 0.0 0.0 0.0 0.0 122-123 8.1 0.0 0.0 0.0 0.0 124-125 8.55 0.0 0.0 0.0 0.0 126-127 9.337499999999999 0.0 0.0 0.0 0.0 128-129 10.1125 0.0 0.0 0.0 0.0 130-131 10.8875 0.0 0.0 0.0 0.0 132-133 11.55 0.0 0.0 0.0 0.0 134-135 12.3 0.0 0.0 0.0 0.0 136-137 13.162500000000001 0.0 0.0 0.0 0.0 138-139 14.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGGCA 10 0.006836113 144.9625 2 CACGTCT 40 0.007666461 18.120312 140-144 >>END_MODULE SRR7170838 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170838_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05025 33.0 33.0 34.0 33.0 34.0 2 33.17875 34.0 33.0 34.0 33.0 34.0 3 33.19675 34.0 33.0 34.0 33.0 34.0 4 33.12975 34.0 33.0 34.0 33.0 34.0 5 33.18325 34.0 33.0 34.0 33.0 34.0 6 37.27475 38.0 38.0 38.0 37.0 38.0 7 37.31825 38.0 38.0 38.0 37.0 38.0 8 37.414 38.0 38.0 38.0 37.0 38.0 9 37.33925 38.0 38.0 38.0 37.0 38.0 10-14 37.32105 38.0 38.0 38.0 37.0 38.0 15-19 37.31445 38.0 38.0 38.0 37.0 38.0 20-24 37.25625 38.0 38.0 38.0 37.0 38.0 25-29 37.25855 38.0 38.0 38.0 37.0 38.0 30-34 37.231449999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.21665 38.0 38.0 38.0 37.0 38.0 40-44 37.228300000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.20960000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.24550000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.13445 38.0 38.0 38.0 37.0 38.0 60-64 37.06865 38.0 38.0 38.0 36.6 38.0 65-69 37.00744999999999 38.0 38.0 38.0 36.2 38.0 70-74 36.98895 38.0 38.0 38.0 36.0 38.0 75-79 36.84609999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.72795 38.0 38.0 38.0 35.6 38.0 85-89 36.684400000000004 38.0 38.0 38.0 35.4 38.0 90-94 36.643049999999995 38.0 38.0 38.0 35.2 38.0 95-99 36.55329999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.390750000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.303399999999996 38.0 38.0 38.0 34.0 38.0 110-114 35.96875 38.0 37.8 38.0 33.0 38.0 115-119 35.83705 38.0 37.2 38.0 32.6 38.0 120-124 35.383 38.0 36.4 38.0 30.0 38.0 125-129 35.11055 38.0 36.0 38.0 28.8 38.0 130-134 34.89084999999999 38.0 36.0 38.0 28.6 38.0 135-139 34.157349999999994 38.0 34.6 38.0 23.8 38.0 140-144 33.844899999999996 38.0 33.2 38.0 23.4 38.0 145-149 32.998450000000005 38.0 33.0 38.0 14.8 38.0 150-151 27.625875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 0.0 5 0.0 6 1.0 7 2.0 8 1.0 9 1.0 10 2.0 11 1.0 12 0.0 13 1.0 14 4.0 15 5.0 16 1.0 17 3.0 18 5.0 19 7.0 20 7.0 21 5.0 22 9.0 23 12.0 24 11.0 25 13.0 26 16.0 27 32.0 28 23.0 29 31.0 30 46.0 31 46.0 32 73.0 33 89.0 34 135.0 35 258.0 36 589.0 37 2565.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.95 21.45 11.600000000000001 24.0 2 26.25 24.775 34.5 14.475 3 21.099999999999998 28.325 31.65 18.925 4 24.275 34.65 23.025000000000002 18.05 5 24.3 35.625 23.150000000000002 16.925 6 19.854963740935233 38.434608652163035 23.055763940985248 18.65466366591648 7 18.629657414353588 20.455113778444613 41.76044011002751 19.154788697174293 8 22.25 23.775 28.15 25.825 9 21.780445111277817 24.23105776444111 29.9074768692173 24.081020255063766 10-14 23.6368184092046 28.81940970485243 26.3831915957979 21.160580290145074 15-19 23.03151575787894 28.059029514757377 28.644322161080538 20.265132566283143 20-24 23.026513256628313 28.67433716858429 27.808904452226113 20.490245122561284 25-29 23.27629340538377 28.334834384068845 27.9495646952867 20.439307515260683 30-34 22.252238731302214 28.780829456200912 27.98539196558107 20.981539846915805 35-39 23.645369490168612 27.888127282733777 28.128283384199733 20.338219842897885 40-44 22.68314651721377 28.352682145716575 28.47277822257806 20.491393114491594 45-49 23.35134594215951 27.81947363154208 28.95026518562994 19.87891524066847 50-54 22.894881673087507 27.878120778506027 28.568569570220642 20.65842797818582 55-59 23.63154207945562 27.729410587411184 28.404883418392874 20.234163914740318 60-64 22.86486216040426 27.56291589533196 28.74868664632011 20.823535297943664 65-69 23.19507679991995 27.97818582078351 28.263371191274327 20.563366188022215 70-74 23.496146531878694 27.985186668001198 28.270443399059154 20.248223401060955 75-79 23.114647450332786 27.943752189360954 28.55427113046089 20.38732922984537 80-84 23.272454340755566 27.850888166124594 28.416312234175635 20.46034525894421 85-89 23.2863004102872 28.57500250175122 27.54428099669769 20.594416091263884 90-94 23.596236612951657 28.150335301771594 28.025222700430387 20.228205384846362 95-99 24.202833258246983 27.346448415678033 28.407668819142014 20.043049506932974 100-104 23.83883883883884 27.692692692692695 27.807807807807805 20.66066066066066 105-109 24.590820361379446 27.68907352720356 28.049451924520746 19.670654186896243 110-114 24.113936724068882 28.65438526231478 27.543051661994394 19.688626351621945 115-119 24.570627409744127 28.050673476540982 28.06569525812428 19.31300385559061 120-124 24.957444678081504 27.58586162010614 27.630920196255133 19.825773505557223 125-129 24.99874805949221 27.577745505533578 27.93830437177625 19.485202063197956 130-134 25.69468782856857 27.737445551494517 27.482100836128776 19.085765783808142 135-139 25.93260227329628 28.451254318762203 27.024185068349105 18.59195833959241 140-144 26.074986234169295 28.282524903639185 26.92095910296841 18.721529759223106 145-149 26.623279098873592 27.734668335419272 26.918648310387983 18.72340425531915 150-151 26.189283925888834 27.779168753129696 27.40360540811217 18.627941912869304 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.0 23 3.5 24 4.0 25 3.0 26 6.0 27 7.0 28 6.0 29 12.5 30 19.5 31 24.5 32 33.0 33 43.5 34 59.0 35 89.5 36 104.5 37 120.5 38 140.0 39 150.5 40 194.0 41 225.0 42 243.0 43 265.0 44 277.0 45 271.5 46 258.0 47 246.5 48 226.5 49 195.5 50 156.5 51 122.5 52 107.5 53 94.5 54 71.0 55 59.5 56 51.5 57 37.5 58 19.5 59 12.5 60 11.0 61 6.0 62 4.5 63 4.5 64 2.0 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.0 9 0.025 10-14 0.05 15-19 0.05 20-24 0.05 25-29 0.06999999999999999 30-34 0.055 35-39 0.065 40-44 0.08 45-49 0.06999999999999999 50-54 0.065 55-59 0.06999999999999999 60-64 0.065 65-69 0.065 70-74 0.09 75-79 0.08499999999999999 80-84 0.075 85-89 0.06999999999999999 90-94 0.09 95-99 0.11499999999999999 100-104 0.1 105-109 0.105 110-114 0.12 115-119 0.145 120-124 0.13 125-129 0.155 130-134 0.135 135-139 0.145 140-144 0.11499999999999999 145-149 0.125 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29292929292929 98.3 2 0.5050505050505051 1.0 3 0.15151515151515152 0.44999999999999996 4 0.0 0.0 5 0.050505050505050504 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGCTATAGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.32499999999999996 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.9625 0.0 0.0 0.0 0.0 90-91 1.2375 0.0 0.0 0.0 0.0 92-93 1.4375 0.0 0.0 0.0 0.0 94-95 1.6875 0.0 0.0 0.0 0.0 96-97 2.0 0.0 0.0 0.0 0.0 98-99 2.3499999999999996 0.0 0.0 0.0 0.0 100-101 2.5125 0.0 0.0 0.0 0.0 102-103 2.8125 0.0 0.0 0.0 0.0 104-105 3.175 0.0 0.0 0.0 0.0 106-107 3.4375 0.0 0.0 0.0 0.0 108-109 4.0125 0.0 0.0 0.0 0.0 110-111 4.65 0.0 0.0 0.0 0.0 112-113 5.225 0.0 0.0 0.0 0.0 114-115 5.6875 0.0 0.0 0.0 0.0 116-117 6.2375 0.0 0.0 0.0 0.0 118-119 6.7875 0.0 0.0 0.0 0.0 120-121 7.449999999999999 0.0 0.0 0.0 0.0 122-123 8.2 0.0 0.0 0.0 0.0 124-125 8.7 0.0 0.0 0.0 0.0 126-127 9.5125 0.0 0.0 0.0 0.0 128-129 10.2625 0.0 0.0 0.0 0.0 130-131 10.9875 0.0 0.0 0.0 0.0 132-133 11.65 0.0 0.0 0.0 0.0 134-135 12.4 0.0 0.0 0.0 0.0 136-137 13.25 0.0 0.0 0.0 0.0 138-139 14.225000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAATC 10 0.006830828 145.0 2 GAGCAAT 10 0.006830828 145.0 9 TCGTGTA 40 0.0076550315 18.125 140-144 >>END_MODULE Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725368 spots for SRR7170838.sra Written 725368 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra Read 725357 spots for SRR7170838.sra Written 725357 spots for SRR7170838.sra SRR ids: ['SRR7170838.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__egar1r6 SRR7170838.sra spots: 14507151 blocks: [[1, 725357], [725358, 1450714], [1450715, 2176071], [2176072, 2901428], [2901429, 3626785], [3626786, 4352142], [4352143, 5077499], [5077500, 5802856], [5802857, 6528213], [6528214, 7253570], [7253571, 7978927], [7978928, 8704284], [8704285, 9429641], [9429642, 10154998], [10154999, 10880355], [10880356, 11605712], [11605713, 12331069], [12331070, 13056426], [13056427, 13781783], [13781784, 14507151]] SRR7170838 file size 4894297 SRR7170838 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170838 SRR7170838_1.fastq SRR7170838_2.fastq Input file: SRR7170838_1.fastq Paired file: SRR7170838_2.fastq trimmed: SRR7170838-trimmed-pair1.fastq, SRR7170838-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:22:12 2025 >> started Thu Feb 13 18:22:27 2025 >> done (14.975s) 14507151 read pairs processed; of these: 15681 ( 0.11%) short read pairs filtered out after trimming by size control 59825 ( 0.41%) empty read pairs filtered out after trimming by size control 14431645 (99.48%) read pairs available; of these: 9569560 (66.31%) trimmed read pairs available after processing 4862085 (33.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 14 0.00% 20 13 0.00% 21 9 0.00% 22 13 0.00% 23 17 0.00% 24 20 0.00% 25 12 0.00% 26 22 0.00% 27 27 0.00% 28 24 0.00% 29 16 0.00% 30 37 0.00% 31 27 0.00% 32 40 0.00% 33 27 0.00% 34 31 0.00% 35 25 0.00% 36 50 0.00% 37 52 0.00% 38 60 0.00% 39 73 0.00% 40 57 0.00% 41 50 0.00% 42 69 0.00% 43 84 0.00% 44 71 0.00% 45 85 0.00% 46 96 0.00% 47 132 0.00% 48 151 0.00% 49 187 0.00% 50 189 0.00% 51 257 0.00% 52 220 0.00% 53 257 0.00% 54 299 0.00% 55 311 0.00% 56 354 0.00% 57 433 0.00% 58 495 0.00% 59 564 0.00% 60 674 0.00% 61 809 0.01% 62 980 0.01% 63 958 0.01% 64 1156 0.01% 65 1172 0.01% 66 1358 0.01% 67 1551 0.01% 68 1665 0.01% 69 1908 0.01% 70 2256 0.02% 71 2574 0.02% 72 3021 0.02% 73 3539 0.02% 74 3829 0.03% 75 4397 0.03% 76 6490 0.04% 77 6362 0.04% 78 5636 0.04% 79 6037 0.04% 80 6997 0.05% 81 7849 0.05% 82 8931 0.06% 83 10070 0.07% 84 11673 0.08% 85 12663 0.09% 86 12869 0.09% 87 13827 0.10% 88 14247 0.10% 89 15543 0.11% 90 16596 0.11% 91 18064 0.13% 92 19555 0.14% 93 21261 0.15% 94 22665 0.16% 95 24168 0.17% 96 25277 0.18% 97 26057 0.18% 98 26917 0.19% 99 28084 0.19% 100 29642 0.21% 101 30431 0.21% 102 32881 0.23% 103 34422 0.24% 104 36577 0.25% 105 37937 0.26% 106 39413 0.27% 107 40230 0.28% 108 41271 0.29% 109 42187 0.29% 110 43121 0.30% 111 44997 0.31% 112 46027 0.32% 113 47979 0.33% 114 49539 0.34% 115 52030 0.36% 116 53632 0.37% 117 54769 0.38% 118 56081 0.39% 119 56457 0.39% 120 58452 0.41% 121 59154 0.41% 122 60959 0.42% 123 63502 0.44% 124 65218 0.45% 125 67425 0.47% 126 69430 0.48% 127 71088 0.49% 128 72412 0.50% 129 74702 0.52% 130 76948 0.53% 131 78294 0.54% 132 81661 0.57% 133 84708 0.59% 134 88378 0.61% 135 93582 0.65% 136 97381 0.67% 137 103110 0.71% 138 108471 0.75% 139 116116 0.80% 140 124188 0.86% 141 134326 0.93% 142 148044 1.03% 143 165947 1.15% 144 191621 1.33% 145 225338 1.56% 146 283522 1.96% 147 374657 2.60% 148 548859 3.80% 149 1003420 6.95% 150 3504358 24.28% 151 4862085 33.69% 14431645 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=32 prefix-density=0.46 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=71.58 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.5 sequence=TAATAATAAACACCGTGATTCACTGAATCTACAGCAAGCTTTATATTATACATAACCTTTTGTAGTGGGTTTTGGATGTATTATTATGAAAACCTAGTAGATATAACCGAGTAGATATATAAGTATACAACATTCCAATTTCAGCTACCGTGGACTGAAGAGAGACGAAATGACTGGGATCCAGACTCCTAGTTGGGAAGCCACACAACATGATCCTGAGGAAGGAAATGGCAGACTGGTACGGTTCCTGGCTTAACATTGAGCACCTGGAAAGCCAAATGCTTTGGGTTCCATGCAGATGTATCTGTGTGGCACACTGCTACAGCTTTAGCATTTGTTCCATCAGCACCCTCCAATGGAACCGCGTAAGCCCTCGTGGTTTGTGTTGCATGGCAGTAAAAGACGGCGTATGCATAGTTCTGCTTGTGGCACACTACAGATTTGTCTCCTGCCATCTTCTTTACTCCGGTCTTAATTGTATACTTTTGCATCTGGGTGCTTTCCACTTCTG criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=26 prefix-density=0.60 prefix-fanout=2.2 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=43.34 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=8.4 sequence=CAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7170838 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:23:08 Started mapping on | Feb 13 18:23:08 Finished on | Feb 13 18:24:48 Mapping speed, Million of reads per hour | 519.54 Number of input reads | 14431645 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 13405635 Uniquely mapped reads % | 92.89% Average mapped length | 285.99 Number of splices: Total | 10846070 Number of splices: Annotated (sjdb) | 10565418 Number of splices: GT/AG | 10627091 Number of splices: GC/AG | 166492 Number of splices: AT/AC | 7162 Number of splices: Non-canonical | 45325 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.03% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418774 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 13986 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 618817 618817 618817 N_multimapping 418774 418774 418774 N_noFeature 497444 13087733 646904 N_ambiguous 258610 1182 89543 UnstrandedReadsAssigned:12649581 PositiveStrandReadsAssigned:316720 NegativeStrandReadsAssigned:12669188 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=141 echo kmer=137 SRR7170838 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170838-trimmed-pair1.fastq SRR7170838-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,431,645 reads, 12,800,454 reads pseudoaligned [quant] estimated average fragment length: 212.582 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52401 SRR7170838.ke.tsv 34699 SRR7170838.se.tsv 87100 total ==> SRR7170838.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1806.42 497 18.8437 Potri.005G024800.1.v4.1 1035 823.418 324 26.9496 Potri.004G059700.1.v4.1 961 749.427 1 0.0913899 Potri.007G009000.2.v4.1 1416 1204.42 0 0 Potri.003G141000.2.v4.1 2943 2731.42 645 16.1733 Potri.016G087400.1.v4.1 270 96.9202 994 702.424 Potri.015G069301.1.v4.1 564 355.871 0 0 Potri.010G195200.1.v4.1 1773 1561.42 53 2.32479 Potri.012G127500.1.v4.1 977 765.423 114 10.2007 ==> SRR7170838.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 518 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 361 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR7170838 completed mapping pipeline successfully