Starting /dee2/code/volunteer_pipeline.sh SRR7170839 current disk space = 3088037490688 free memory = 1496246524 SRR7170839 SRAfilesize a06adef5eed5320a02e6564409c541f8 SRR7170839.sra SRR7170839.sra file validated SRR7170839 is paired end SRR7170839 is conventional basespace SRR7170839 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170839_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.207 34.0 33.0 34.0 32.0 34.0 2 33.12475 34.0 33.0 34.0 32.0 34.0 3 33.09625 34.0 33.0 34.0 32.0 34.0 4 33.1225 34.0 33.0 34.0 31.0 34.0 5 33.24275 34.0 33.0 34.0 33.0 34.0 6 36.7395 38.0 37.0 38.0 34.0 38.0 7 37.106 38.0 38.0 38.0 36.0 38.0 8 37.2455 38.0 38.0 38.0 37.0 38.0 9 37.34775 38.0 38.0 38.0 37.0 38.0 10-14 37.3349 38.0 38.0 38.0 36.8 38.0 15-19 37.287800000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.1957 38.0 38.0 38.0 36.6 38.0 25-29 37.248900000000006 38.0 38.0 38.0 36.4 38.0 30-34 37.078050000000005 38.0 38.0 38.0 36.0 38.0 35-39 37.022800000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.982499999999995 38.0 38.0 38.0 35.8 38.0 45-49 36.8414 38.0 38.0 38.0 35.4 38.0 50-54 36.66185 38.0 38.0 38.0 34.8 38.0 55-59 36.533950000000004 38.0 38.0 38.0 34.0 38.0 60-64 36.4753 38.0 37.8 38.0 34.0 38.0 65-69 36.4351 38.0 38.0 38.0 34.0 38.0 70-74 36.342349999999996 38.0 37.6 38.0 33.8 38.0 75-79 36.1924 38.0 37.0 38.0 33.6 38.0 80-84 35.894 38.0 37.0 38.0 32.4 38.0 85-89 35.89300000000001 38.0 37.0 38.0 32.4 38.0 90-94 35.78605 38.0 37.0 38.0 32.0 38.0 95-99 35.5182 38.0 36.4 38.0 31.0 38.0 100-104 35.116150000000005 38.0 36.0 38.0 28.2 38.0 105-109 34.652 38.0 35.0 38.0 25.8 38.0 110-114 34.217 38.0 34.0 38.0 22.4 38.0 115-119 33.911950000000004 38.0 33.6 38.0 22.6 38.0 120-124 33.581050000000005 38.0 33.0 38.0 19.6 38.0 125-129 32.584900000000005 38.0 32.0 38.0 15.2 38.0 130-134 32.08945 37.0 30.6 38.0 14.0 38.0 135-139 31.18445 36.4 28.6 38.0 13.0 38.0 140-144 30.553999999999995 36.4 28.0 38.0 11.8 38.0 145-149 28.76755 35.4 24.8 38.0 2.0 38.0 150-151 22.605625 27.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 1.0 14 2.0 15 2.0 16 4.0 17 7.0 18 12.0 19 21.0 20 11.0 21 9.0 22 10.0 23 16.0 24 25.0 25 35.0 26 33.0 27 37.0 28 57.0 29 63.0 30 83.0 31 89.0 32 145.0 33 211.0 34 277.0 35 519.0 36 1115.0 37 1212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.10967741935484 15.174193548387096 10.658064516129032 37.05806451612903 2 19.825 19.45 37.075 23.65 3 18.254563640910227 25.93148287071768 29.08227056764191 26.731682920730183 4 22.05 32.775 23.7 21.475 5 21.099999999999998 35.65 25.275 17.974999999999998 6 16.325 37.0 25.2 21.475 7 13.325000000000001 23.150000000000002 44.4 19.125 8 16.8 23.599999999999998 31.125000000000004 28.475 9 18.0 22.975 31.525 27.500000000000004 10-14 20.055 29.86 26.040000000000003 24.044999999999998 15-19 19.040000000000003 28.89 28.04 24.03 20-24 19.77 28.475 28.075 23.68 25-29 19.875 29.020000000000003 27.485 23.62 30-34 20.005 28.99 27.250000000000004 23.755000000000003 35-39 19.935 28.685 27.815 23.565 40-44 19.915 29.45 27.63 23.005 45-49 19.765 29.104999999999997 28.17 22.96 50-54 19.78 29.104999999999997 27.435 23.68 55-59 19.994999999999997 28.825 27.61 23.57 60-64 20.28 29.215000000000003 27.125 23.380000000000003 65-69 20.380000000000003 29.409999999999997 26.919999999999998 23.29 70-74 20.5 29.54 26.63 23.330000000000002 75-79 20.215 28.7 27.3 23.785 80-84 20.595 28.494999999999997 27.334999999999997 23.575 85-89 19.615 28.77 27.37 24.245 90-94 20.64 28.73 26.945000000000004 23.685000000000002 95-99 20.985 29.13 26.875 23.01 100-104 20.580000000000002 28.765 27.37 23.285 105-109 20.585 28.82 27.084999999999997 23.51 110-114 20.685000000000002 28.845 27.27 23.200000000000003 115-119 21.115000000000002 28.860000000000003 26.735 23.29 120-124 21.035 28.544999999999998 26.619999999999997 23.799999999999997 125-129 21.265 28.74 25.915 24.08 130-134 21.265 28.555000000000003 26.32 23.86 135-139 21.224999999999998 28.660000000000004 26.640000000000004 23.474999999999998 140-144 20.935000000000002 28.110000000000003 26.75 24.205 145-149 20.405 28.294999999999998 27.125 24.175 150-151 20.9375 28.025 26.9625 24.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.0 22 1.0 23 1.0 24 2.5 25 3.5 26 8.5 27 13.0 28 12.5 29 20.0 30 30.0 31 37.5 32 41.5 33 51.0 34 68.5 35 78.0 36 98.0 37 115.5 38 134.5 39 174.5 40 198.5 41 214.5 42 226.5 43 240.0 44 244.5 45 235.5 46 231.0 47 231.0 48 223.5 49 205.0 50 188.0 51 151.0 52 122.5 53 102.0 54 75.0 55 60.0 56 47.5 57 33.0 58 22.5 59 18.5 60 13.5 61 7.5 62 4.5 63 4.0 64 2.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.125 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.90696492119979 97.275 2 0.9405185561769192 1.8499999999999999 3 0.10167768174885612 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02541942043721403 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.02541942043721403 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 16 0.4 TruSeq Adapter, Index 7 (97% over 35bp) CTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.8250000000000002 0.0 0.0 0.0 0.0 100-101 2.1624999999999996 0.0 0.0 0.0 0.0 102-103 2.5375 0.0 0.0 0.0 0.0 104-105 2.7625 0.0 0.0 0.0 0.0 106-107 3.1125 0.0 0.0 0.0 0.0 108-109 3.5625 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.5375 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.6 0.0 0.0 0.0 0.0 118-119 6.15 0.0 0.0 0.0 0.0 120-121 6.675 0.0 0.0 0.0 0.0 122-123 7.175 0.0 0.0 0.0 0.0 124-125 7.7125 0.0 0.0 0.0 0.0 126-127 8.212499999999999 0.0 0.0 0.0 0.0 128-129 9.075 0.0 0.0 0.0 0.0 130-131 9.7125 0.0 0.0 0.0 0.0 132-133 10.325 0.0 0.0 0.0 0.0 134-135 10.9625 0.0 0.0 0.0 0.0 136-137 11.525 0.0 0.0 0.0 0.0 138-139 12.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170839 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170839_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99575 33.0 33.0 34.0 32.0 34.0 2 33.015 33.0 33.0 34.0 32.0 34.0 3 33.049 34.0 33.0 34.0 32.0 34.0 4 33.0955 34.0 33.0 34.0 32.0 34.0 5 33.0655 34.0 33.0 34.0 32.0 34.0 6 37.26225 38.0 38.0 38.0 37.0 38.0 7 37.31925 38.0 38.0 38.0 37.0 38.0 8 37.25975 38.0 38.0 38.0 37.0 38.0 9 37.212 38.0 38.0 38.0 37.0 38.0 10-14 37.2491 38.0 38.0 38.0 37.0 38.0 15-19 37.2747 38.0 38.0 38.0 37.0 38.0 20-24 37.2008 38.0 38.0 38.0 37.0 38.0 25-29 37.12005 38.0 38.0 38.0 36.6 38.0 30-34 37.1323 38.0 38.0 38.0 36.6 38.0 35-39 37.17355 38.0 38.0 38.0 36.8 38.0 40-44 37.1654 38.0 38.0 38.0 36.8 38.0 45-49 37.1062 38.0 38.0 38.0 36.2 38.0 50-54 37.07465 38.0 38.0 38.0 36.2 38.0 55-59 37.044 38.0 38.0 38.0 36.0 38.0 60-64 36.9809 38.0 38.0 38.0 36.0 38.0 65-69 36.9363 38.0 38.0 38.0 36.0 38.0 70-74 36.757600000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.67385 38.0 38.0 38.0 35.2 38.0 80-84 36.4977 38.0 38.0 38.0 34.8 38.0 85-89 36.39935 38.0 38.0 38.0 34.0 38.0 90-94 36.304500000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.029250000000005 38.0 37.8 38.0 33.2 38.0 100-104 36.01485 38.0 37.6 38.0 33.2 38.0 105-109 35.841699999999996 38.0 37.0 38.0 32.8 38.0 110-114 35.6348 38.0 37.0 38.0 31.2 38.0 115-119 35.34905 38.0 36.4 38.0 29.0 38.0 120-124 35.0433 38.0 36.0 38.0 28.4 38.0 125-129 34.416250000000005 38.0 34.8 38.0 24.4 38.0 130-134 33.93095000000001 38.0 33.6 38.0 23.2 38.0 135-139 33.474 38.0 33.0 38.0 20.6 38.0 140-144 32.540049999999994 38.0 33.0 38.0 14.2 38.0 145-149 31.476999999999997 38.0 32.2 38.0 8.2 38.0 150-151 25.334 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 2.0 13 1.0 14 3.0 15 2.0 16 1.0 17 5.0 18 5.0 19 5.0 20 16.0 21 8.0 22 15.0 23 11.0 24 17.0 25 21.0 26 28.0 27 29.0 28 35.0 29 42.0 30 62.0 31 69.0 32 80.0 33 118.0 34 188.0 35 295.0 36 754.0 37 2180.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 19.875 12.8 27.075 2 25.724999999999998 25.2 32.550000000000004 16.525000000000002 3 22.55 26.525 32.025 18.9 4 23.325000000000003 35.199999999999996 22.900000000000002 18.575 5 23.9 36.6 20.724999999999998 18.775 6 20.8 39.025 22.8 17.375 7 19.950000000000003 18.7 40.550000000000004 20.8 8 21.625 24.075 27.650000000000002 26.650000000000002 9 22.900000000000002 25.074999999999996 28.1 23.925 10-14 23.425 29.28 26.345000000000002 20.95 15-19 22.905 28.49 27.439999999999998 21.165 20-24 22.74 29.01 27.400000000000002 20.849999999999998 25-29 22.939999999999998 28.634999999999998 27.705000000000002 20.72 30-34 22.52 28.694999999999997 27.61 21.175 35-39 23.11 27.83 27.839999999999996 21.22 40-44 22.564999999999998 28.125 28.49 20.82 45-49 22.720000000000002 28.025 27.74 21.515 50-54 22.67 27.27 28.439999999999998 21.62 55-59 23.09 26.875 28.084999999999997 21.95 60-64 23.369999999999997 27.105 28.134999999999998 21.39 65-69 22.655 27.555000000000003 28.985 20.805 70-74 22.85 27.54 27.93 21.68 75-79 22.634999999999998 28.115000000000002 27.694999999999997 21.555 80-84 22.855 28.075 27.650000000000002 21.42 85-89 23.724999999999998 28.055000000000003 27.189999999999998 21.029999999999998 90-94 23.599999999999998 27.650000000000002 28.13 20.62 95-99 23.46 28.115000000000002 27.675 20.75 100-104 23.96 27.66 27.74 20.64 105-109 23.715 28.03 27.639999999999997 20.615 110-114 24.175 28.000000000000004 27.644999999999996 20.18 115-119 25.05 27.584999999999997 26.715 20.65 120-124 24.59 27.565 27.18 20.665 125-129 25.035 27.42 27.605 19.939999999999998 130-134 24.645 27.575 27.575 20.205000000000002 135-139 25.180000000000003 27.639999999999997 27.275 19.905 140-144 25.52 26.985 27.72 19.775000000000002 145-149 25.905 26.619999999999997 27.694999999999997 19.78 150-151 25.374999999999996 27.150000000000002 27.6625 19.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 3.5 27 4.0 28 9.0 29 11.0 30 14.5 31 23.5 32 30.5 33 41.0 34 54.5 35 65.0 36 94.0 37 114.5 38 123.0 39 154.0 40 186.0 41 217.5 42 241.5 43 255.0 44 272.5 45 279.5 46 253.5 47 238.5 48 228.0 49 198.0 50 167.5 51 135.0 52 128.0 53 126.0 54 95.5 55 65.5 56 48.5 57 33.0 58 22.0 59 18.0 60 14.0 61 6.0 62 4.5 63 6.5 64 3.5 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03430749682339 97.425 2 0.7623888182973316 1.5 3 0.12706480304955528 0.375 4 0.0 0.0 5 0.025412960609911054 0.125 6 0.0 0.0 7 0.025412960609911054 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.025412960609911054 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCTTCGCCTGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (96% over 32bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.8875 0.0 0.0 0.0 0.0 92-93 1.1375000000000002 0.0 0.0 0.0 0.0 94-95 1.3624999999999998 0.0 0.0 0.0 0.0 96-97 1.5625 0.0 0.0 0.0 0.0 98-99 1.85 0.0 0.0 0.0 0.0 100-101 2.2125000000000004 0.0 0.0 0.0 0.0 102-103 2.5875 0.0 0.0 0.0 0.0 104-105 2.8375 0.0 0.0 0.0 0.0 106-107 3.2375 0.0 0.0 0.0 0.0 108-109 3.6875 0.0 0.0 0.0 0.0 110-111 4.175000000000001 0.0 0.0 0.0 0.0 112-113 4.6875 0.0 0.0 0.0 0.0 114-115 5.15 0.0 0.0 0.0 0.0 116-117 5.7375 0.0 0.0 0.0 0.0 118-119 6.25 0.0 0.0 0.0 0.0 120-121 6.775 0.0 0.0 0.0 0.0 122-123 7.2875 0.0 0.0 0.0 0.0 124-125 7.862500000000001 0.0 0.0 0.0 0.0 126-127 8.3625 0.0 0.0 0.0 0.0 128-129 9.1875 0.0 0.0 0.0 0.0 130-131 9.8375 0.0 0.0 0.0 0.0 132-133 10.5125 0.0 0.0 0.0 0.0 134-135 11.1625 0.0 0.0 0.0 0.0 136-137 11.7125 0.0 0.0 0.0 0.0 138-139 12.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCT 10 0.006830828 145.0 6 ATGGCCT 10 0.006830828 145.0 7 CCTCTTG 10 0.006830828 145.0 8 GCAAACT 10 0.006830828 145.0 3 CTGCTAA 10 0.006830828 145.0 8 >>END_MODULE Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898831 spots for SRR7170839.sra Written 898831 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra Read 898818 spots for SRR7170839.sra Written 898818 spots for SRR7170839.sra SRR ids: ['SRR7170839.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v88dhg6i SRR7170839.sra spots: 17976373 blocks: [[1, 898818], [898819, 1797636], [1797637, 2696454], [2696455, 3595272], [3595273, 4494090], [4494091, 5392908], [5392909, 6291726], [6291727, 7190544], [7190545, 8089362], [8089363, 8988180], [8988181, 9886998], [9886999, 10785816], [10785817, 11684634], [11684635, 12583452], [12583453, 13482270], [13482271, 14381088], [14381089, 15279906], [15279907, 16178724], [16178725, 17077542], [17077543, 17976373]] SRR7170839 file size 6069902 SRR7170839 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170839 SRR7170839_1.fastq SRR7170839_2.fastq Input file: SRR7170839_1.fastq Paired file: SRR7170839_2.fastq trimmed: SRR7170839-trimmed-pair1.fastq, SRR7170839-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:29:21 2025 >> started Thu Feb 13 18:29:40 2025 >> done (19.608s) 17976373 read pairs processed; of these: 19016 ( 0.11%) short read pairs filtered out after trimming by size control 92056 ( 0.51%) empty read pairs filtered out after trimming by size control 17865301 (99.38%) read pairs available; of these: 12680630 (70.98%) trimmed read pairs available after processing 5184671 (29.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 12 0.00% 21 16 0.00% 22 15 0.00% 23 11 0.00% 24 14 0.00% 25 11 0.00% 26 17 0.00% 27 21 0.00% 28 27 0.00% 29 20 0.00% 30 16 0.00% 31 21 0.00% 32 19 0.00% 33 44 0.00% 34 31 0.00% 35 35 0.00% 36 33 0.00% 37 45 0.00% 38 73 0.00% 39 55 0.00% 40 61 0.00% 41 84 0.00% 42 85 0.00% 43 82 0.00% 44 96 0.00% 45 121 0.00% 46 138 0.00% 47 153 0.00% 48 185 0.00% 49 201 0.00% 50 249 0.00% 51 278 0.00% 52 306 0.00% 53 344 0.00% 54 352 0.00% 55 428 0.00% 56 489 0.00% 57 537 0.00% 58 603 0.00% 59 723 0.00% 60 853 0.00% 61 1020 0.01% 62 1096 0.01% 63 1171 0.01% 64 1243 0.01% 65 1338 0.01% 66 1445 0.01% 67 1640 0.01% 68 1961 0.01% 69 2243 0.01% 70 2527 0.01% 71 3018 0.02% 72 3561 0.02% 73 3926 0.02% 74 4439 0.02% 75 5109 0.03% 76 7984 0.04% 77 8363 0.05% 78 6642 0.04% 79 6769 0.04% 80 7378 0.04% 81 8420 0.05% 82 9807 0.05% 83 10783 0.06% 84 12486 0.07% 85 13127 0.07% 86 14005 0.08% 87 14784 0.08% 88 15805 0.09% 89 16789 0.09% 90 18200 0.10% 91 19887 0.11% 92 21394 0.12% 93 23557 0.13% 94 25105 0.14% 95 27023 0.15% 96 27759 0.16% 97 29006 0.16% 98 29497 0.17% 99 31143 0.17% 100 32690 0.18% 101 34461 0.19% 102 37389 0.21% 103 39499 0.22% 104 41419 0.23% 105 43477 0.24% 106 44827 0.25% 107 46069 0.26% 108 47260 0.26% 109 48507 0.27% 110 49493 0.28% 111 51710 0.29% 112 53903 0.30% 113 55987 0.31% 114 58396 0.33% 115 61828 0.35% 116 63027 0.35% 117 64381 0.36% 118 66385 0.37% 119 67185 0.38% 120 68733 0.38% 121 71431 0.40% 122 74315 0.42% 123 77484 0.43% 124 81130 0.45% 125 83884 0.47% 126 87650 0.49% 127 90293 0.51% 128 92350 0.52% 129 96131 0.54% 130 99521 0.56% 131 103809 0.58% 132 109014 0.61% 133 116172 0.65% 134 121716 0.68% 135 130012 0.73% 136 137856 0.77% 137 146928 0.82% 138 157305 0.88% 139 169011 0.95% 140 180627 1.01% 141 196065 1.10% 142 217462 1.22% 143 245043 1.37% 144 284956 1.60% 145 337744 1.89% 146 414813 2.32% 147 551132 3.08% 148 804379 4.50% 149 1459458 8.17% 150 4417935 24.73% 151 5184671 29.02% 17865301 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=31 prefix-density=0.77 prefix-fanout=1.0 sequence=GCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGCCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=72.26 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=7.6 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGAT criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=5.86 fanout-score-rank=17 prefix-density=1.40 prefix-fanout=1.6 sequence=ATGGCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=35 fanout-score=49.54 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=11.6 sequence=GGTGGTGGTCGTGTTACCATGCGCAGGACTGTGAAAAGTGCTCCCCAAAGCATATGGTATGGCCCAGACCGCCCAAAGTTCTTGGGTCCATTCTCTGAGCAAACCCCATCATACCTGACCGGTGAATTCCCTGGTGATTATGGATGGGACACTGCTGGTTTGTCTGCAGATCCTGAGACATTTG SRR7170839 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:30:20 Started mapping on | Feb 13 18:30:20 Finished on | Feb 13 18:31:58 Mapping speed, Million of reads per hour | 656.28 Number of input reads | 17865301 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 17122690 Uniquely mapped reads % | 95.84% Average mapped length | 286.22 Number of splices: Total | 15577687 Number of splices: Annotated (sjdb) | 15220117 Number of splices: GT/AG | 15267456 Number of splices: GC/AG | 253328 Number of splices: AT/AC | 11427 Number of splices: Non-canonical | 45476 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 486390 % of reads mapped to multiple loci | 2.72% Number of reads mapped to too many loci | 23852 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 270705 270705 270705 N_multimapping 486390 486390 486390 N_noFeature 595703 16799957 754139 N_ambiguous 319293 1332 154030 UnstrandedReadsAssigned:16207694 PositiveStrandReadsAssigned:321401 NegativeStrandReadsAssigned:16214521 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170839 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170839-trimmed-pair1.fastq SRR7170839-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,865,301 reads, 16,271,299 reads pseudoaligned [quant] estimated average fragment length: 221.662 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR7170839.ke.tsv 34699 SRR7170839.se.tsv 87100 total ==> SRR7170839.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.34 351 10.383 Potri.005G024800.1.v4.1 1035 814.338 312 20.3701 Potri.004G059700.1.v4.1 961 740.352 7 0.502694 Potri.007G009000.2.v4.1 1416 1195.34 0 0 Potri.003G141000.2.v4.1 2943 2722.34 288 5.62463 Potri.016G087400.1.v4.1 270 95.034 1003.63 561.488 Potri.015G069301.1.v4.1 564 348.054 0 0 Potri.010G195200.1.v4.1 1773 1552.34 12 0.410997 Potri.012G127500.1.v4.1 977 756.347 415 29.1723 ==> SRR7170839.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 569 Potri.001G212900.v4.1 645 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170839 completed mapping pipeline successfully