Starting /dee2/code/volunteer_pipeline.sh SRR7170840 current disk space = 3088335572992 free memory = 1534991828 SRR7170840 SRAfilesize e1d43a9cad95ea32c7b1a4684fcbcecf SRR7170840.sra SRR7170840.sra file validated SRR7170840 is paired end SRR7170840 is conventional basespace SRR7170840 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170840_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.79725 34.0 33.0 34.0 32.0 34.0 2 33.22225 34.0 33.0 34.0 32.0 34.0 3 33.20025 34.0 33.0 34.0 31.0 34.0 4 33.30925 34.0 33.0 34.0 33.0 34.0 5 33.31525 34.0 33.0 34.0 33.0 34.0 6 36.75575 38.0 37.0 38.0 35.0 38.0 7 37.144 38.0 38.0 38.0 36.0 38.0 8 37.26025 38.0 38.0 38.0 37.0 38.0 9 37.4275 38.0 38.0 38.0 37.0 38.0 10-14 37.4023 38.0 38.0 38.0 37.0 38.0 15-19 37.3245 38.0 38.0 38.0 36.8 38.0 20-24 37.282500000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.27735 38.0 38.0 38.0 36.6 38.0 30-34 37.14805 38.0 38.0 38.0 36.0 38.0 35-39 37.05165 38.0 38.0 38.0 35.8 38.0 40-44 36.9732 38.0 38.0 38.0 35.8 38.0 45-49 36.93595 38.0 38.0 38.0 35.4 38.0 50-54 36.6122 38.0 38.0 38.0 34.2 38.0 55-59 36.5459 38.0 38.0 38.0 34.0 38.0 60-64 36.58885 38.0 38.0 38.0 34.2 38.0 65-69 36.4619 38.0 38.0 38.0 34.0 38.0 70-74 36.49810000000001 38.0 37.8 38.0 34.0 38.0 75-79 36.318949999999994 38.0 37.0 38.0 33.8 38.0 80-84 36.1915 38.0 37.0 38.0 33.2 38.0 85-89 35.88365 38.0 37.0 38.0 31.8 38.0 90-94 35.65585 38.0 36.4 38.0 30.6 38.0 95-99 35.6112 38.0 36.4 38.0 29.8 38.0 100-104 34.9868 38.0 35.4 38.0 27.4 38.0 105-109 34.7957 38.0 35.2 38.0 26.2 38.0 110-114 34.545300000000005 38.0 34.2 38.0 25.6 38.0 115-119 34.174800000000005 38.0 33.6 38.0 23.4 38.0 120-124 33.26445 38.0 32.8 38.0 19.0 38.0 125-129 32.47885 38.0 31.8 38.0 14.0 38.0 130-134 31.70315 37.0 29.6 38.0 13.4 38.0 135-139 30.598000000000003 36.0 28.0 38.0 12.8 38.0 140-144 30.330450000000003 36.0 28.0 38.0 9.6 38.0 145-149 28.634149999999998 35.6 24.4 38.0 2.0 38.0 150-151 21.41075 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 2.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 5.0 18 6.0 19 10.0 20 12.0 21 8.0 22 8.0 23 29.0 24 35.0 25 27.0 26 41.0 27 42.0 28 60.0 29 65.0 30 78.0 31 113.0 32 150.0 33 204.0 34 300.0 35 568.0 36 1063.0 37 1170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.345773038842346 15.486164001015487 8.403148007108403 33.76491495303377 2 20.525 20.9 37.225 21.349999999999998 3 17.704426106526633 26.481620405101275 29.207301825456366 26.60665166291573 4 22.575 33.5 23.125 20.8 5 20.3 38.1 24.6 17.0 6 17.75 36.475 24.9 20.875 7 14.075 23.25 44.324999999999996 18.35 8 17.150000000000002 22.675 32.324999999999996 27.85 9 18.775 22.275 31.775 27.175 10-14 19.905 28.835 27.694999999999997 23.565 15-19 20.255000000000003 28.185 27.905 23.655 20-24 19.67 28.189999999999998 28.23 23.91 25-29 19.905 28.82 28.24 23.035 30-34 19.665 28.4 28.410000000000004 23.525 35-39 20.29 28.645 27.715 23.35 40-44 20.39 28.59 28.13 22.89 45-49 19.689999999999998 28.810000000000002 27.68 23.82 50-54 20.465 28.125 28.12 23.29 55-59 19.99 28.505000000000003 28.095 23.41 60-64 19.919999999999998 27.935 28.54 23.605 65-69 20.015 28.785 27.55 23.65 70-74 20.025000000000002 28.99 27.939999999999998 23.044999999999998 75-79 20.485 28.27 28.055000000000003 23.189999999999998 80-84 20.235 28.625 27.88 23.26 85-89 20.195 28.415000000000003 27.689999999999998 23.7 90-94 20.335 27.99 28.349999999999998 23.325000000000003 95-99 20.185 27.884999999999998 28.455000000000002 23.474999999999998 100-104 21.21 28.43 27.63 22.73 105-109 20.44 28.785 27.139999999999997 23.635 110-114 21.16 28.155 27.655 23.03 115-119 20.665 28.285 27.675 23.375 120-124 20.515 28.675 27.839999999999996 22.97 125-129 20.79 28.945 27.015 23.25 130-134 21.34 28.665000000000003 27.16 22.835 135-139 20.29 28.560000000000002 27.26 23.89 140-144 21.044999999999998 28.7 26.665 23.59 145-149 21.21 28.939999999999998 26.645000000000003 23.205000000000002 150-151 21.5375 27.0625 27.85 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 2.0 25 5.0 26 6.0 27 9.5 28 14.0 29 16.0 30 21.0 31 31.5 32 38.5 33 41.0 34 60.5 35 79.0 36 98.0 37 120.5 38 142.5 39 175.5 40 206.5 41 235.5 42 257.0 43 254.5 44 259.0 45 262.0 46 247.5 47 240.0 48 219.5 49 188.5 50 164.5 51 125.0 52 98.5 53 87.5 54 72.0 55 65.5 56 46.5 57 33.0 58 27.0 59 20.0 60 12.0 61 4.5 62 3.0 63 1.5 64 0.5 65 0.0 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39622641509433 98.775 2 0.5786163522012578 1.15 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.5875 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.2625 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.325 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.25 0.0 0.0 0.0 0.0 124-125 4.8 0.0 0.0 0.0 0.0 126-127 5.262499999999999 0.0 0.0 0.0 0.0 128-129 5.6625 0.0 0.0 0.0 0.0 130-131 6.199999999999999 0.0 0.0 0.0 0.0 132-133 6.9125 0.0 0.0 0.0 0.0 134-135 7.4875 0.0 0.0 0.0 0.0 136-137 8.075 0.0 0.0 0.0 0.0 138-139 8.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTGATG 10 0.0068343505 144.975 7 >>END_MODULE SRR7170840 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170840_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90425 33.0 33.0 34.0 32.0 34.0 2 33.0595 34.0 33.0 34.0 32.0 34.0 3 33.02275 34.0 33.0 34.0 32.0 34.0 4 33.03625 34.0 33.0 34.0 32.0 34.0 5 33.02375 34.0 33.0 34.0 32.0 34.0 6 37.13075 38.0 38.0 38.0 37.0 38.0 7 37.22075 38.0 38.0 38.0 37.0 38.0 8 37.262 38.0 38.0 38.0 37.0 38.0 9 37.272 38.0 38.0 38.0 37.0 38.0 10-14 37.2238 38.0 38.0 38.0 37.0 38.0 15-19 37.17915000000001 38.0 38.0 38.0 36.8 38.0 20-24 37.1143 38.0 38.0 38.0 37.0 38.0 25-29 37.07485 38.0 38.0 38.0 36.0 38.0 30-34 37.03275000000001 38.0 38.0 38.0 36.0 38.0 35-39 37.023849999999996 38.0 38.0 38.0 36.2 38.0 40-44 37.00885 38.0 38.0 38.0 36.0 38.0 45-49 37.0074 38.0 38.0 38.0 36.0 38.0 50-54 36.9298 38.0 38.0 38.0 36.0 38.0 55-59 36.84475 38.0 38.0 38.0 35.8 38.0 60-64 36.82015 38.0 38.0 38.0 35.8 38.0 65-69 36.714 38.0 38.0 38.0 35.0 38.0 70-74 36.7112 38.0 38.0 38.0 35.0 38.0 75-79 36.6406 38.0 38.0 38.0 34.8 38.0 80-84 36.387699999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.3598 38.0 38.0 38.0 34.0 38.0 90-94 36.151650000000004 38.0 37.6 38.0 33.4 38.0 95-99 36.063849999999995 38.0 37.2 38.0 33.2 38.0 100-104 35.95440000000001 38.0 37.0 38.0 33.0 38.0 105-109 35.79495000000001 38.0 37.0 38.0 32.0 38.0 110-114 35.5943 38.0 37.0 38.0 30.6 38.0 115-119 35.15725 38.0 36.2 38.0 28.4 38.0 120-124 34.682 38.0 35.6 38.0 26.6 38.0 125-129 34.1526 38.0 34.0 38.0 23.8 38.0 130-134 33.62904999999999 38.0 33.4 38.0 21.4 38.0 135-139 32.839800000000004 38.0 33.0 38.0 15.4 38.0 140-144 31.785100000000007 38.0 31.8 38.0 12.8 38.0 145-149 30.433249999999997 36.4 29.0 38.0 5.8 38.0 150-151 24.613875 31.0 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 3.0 4 3.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 4.0 15 2.0 16 3.0 17 9.0 18 1.0 19 8.0 20 8.0 21 11.0 22 17.0 23 18.0 24 15.0 25 28.0 26 25.0 27 26.0 28 43.0 29 60.0 30 65.0 31 75.0 32 86.0 33 125.0 34 188.0 35 337.0 36 878.0 37 1955.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.35 19.1 10.925 25.624999999999996 2 25.0 25.7 31.424999999999997 17.875 3 21.025 28.349999999999998 32.25 18.375 4 22.425 36.225 22.575 18.775 5 22.55 38.625 21.275 17.549999999999997 6 19.13456728364182 38.669334667333665 23.911955977988995 18.284142071035518 7 17.404351087771943 18.779694923730933 42.5856464116029 21.230307576894223 8 20.025000000000002 24.525 28.95 26.5 9 21.275 24.099999999999998 29.775000000000002 24.85 10-14 22.9830440654229 28.990146551292952 26.45926074125944 21.567548642024708 15-19 22.58516332349557 28.542844279925966 28.087639437746986 20.784352958831473 20-24 22.376188094047023 28.97448724362181 27.483741870935468 21.1655827913957 25-29 22.40120060030015 28.134067033516757 28.629314657328663 20.83541770885443 30-34 22.49624812406203 28.179089544772385 28.159079539769884 21.1655827913957 35-39 22.671335667833915 28.884442221110557 27.958979489744873 20.485242621310658 40-44 22.63631815907954 27.768884442221108 28.3791895947974 21.21560780390195 45-49 22.706353176588294 27.863931965982992 28.489244622311155 20.94047023511756 50-54 22.761380690345174 28.469234617308654 28.094047023511752 20.675337668834416 55-59 22.756378189094548 28.279139569784896 27.943971985993 21.020510255127565 60-64 23.081540770385192 27.39369684842421 28.339169584792394 21.1855927963982 65-69 23.08654327163582 27.983991995997997 27.673836918459227 21.25562781390695 70-74 22.236118059029515 28.444222111055527 28.204102051025515 21.115557778889446 75-79 22.546273136568285 28.08904452226113 28.199099549774886 21.1655827913957 80-84 23.02151075537769 27.66383191595798 27.938969484742373 21.375687843921963 85-89 22.79639819909955 27.87393696848424 28.469234617308654 20.860430215107552 90-94 23.056528264132066 27.953976988494244 28.424212106053027 20.56528264132066 95-99 23.10655327663832 28.029014507253624 28.3791895947974 20.485242621310658 100-104 23.246623311655828 28.349174587293646 27.363681840920464 21.040520260130066 105-109 23.276638319159577 28.469234617308654 28.299149574787393 19.954977488744372 110-114 23.25662831415708 28.094047023511752 27.888944472236116 20.76038019009505 115-119 23.551775887943972 27.723861930965484 27.878939469734863 20.845422711355678 120-124 23.89194597298649 28.47423711855928 27.593796898449224 20.040020010005 125-129 24.25712856428214 27.888944472236116 27.70385192596298 20.150075037518757 130-134 24.357178589294648 27.57878939469735 27.938969484742373 20.125062531265634 135-139 24.702351175587793 27.838919459729865 27.1935967983992 20.265132566283143 140-144 24.832416208104053 28.494247123561784 26.348174087043525 20.325162581290645 145-149 25.667833916958475 27.848924462231118 26.538269134567283 19.94497248624312 150-151 25.587793896948476 27.276138069034516 27.01350675337669 20.12256128064032 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.5 22 3.0 23 3.0 24 3.0 25 4.0 26 6.5 27 9.0 28 8.0 29 9.0 30 16.0 31 25.0 32 33.5 33 39.0 34 44.0 35 63.0 36 91.5 37 119.0 38 142.0 39 174.0 40 212.0 41 229.5 42 250.5 43 268.5 44 281.5 45 276.0 46 264.0 47 255.0 48 224.0 49 201.0 50 163.0 51 121.0 52 105.5 53 94.5 54 77.0 55 55.5 56 38.5 57 23.5 58 14.0 59 15.0 60 13.0 61 6.5 62 4.5 63 3.5 64 2.5 65 1.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.025 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.045 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.05 140-144 0.05 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.3780241935483871 0.75 3 0.17641129032258063 0.525 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 3.1125 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.875 0.0 0.0 0.0 0.0 122-123 4.375 0.0 0.0 0.0 0.0 124-125 4.9125 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.7875 0.0 0.0 0.0 0.0 130-131 6.324999999999999 0.0 0.0 0.0 0.0 132-133 7.0875 0.0 0.0 0.0 0.0 134-135 7.725 0.0 0.0 0.0 0.0 136-137 8.325 0.0 0.0 0.0 0.0 138-139 8.912500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGTAT 10 0.006830828 145.0 4 CTGTTGT 10 0.006830828 145.0 6 >>END_MODULE Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762167 spots for SRR7170840.sra Written 762167 spots for SRR7170840.sra Read 762171 spots for SRR7170840.sra Written 762171 spots for SRR7170840.sra SRR ids: ['SRR7170840.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c9z5wr28 SRR7170840.sra spots: 15243344 blocks: [[1, 762167], [762168, 1524334], [1524335, 2286501], [2286502, 3048668], [3048669, 3810835], [3810836, 4573002], [4573003, 5335169], [5335170, 6097336], [6097337, 6859503], [6859504, 7621670], [7621671, 8383837], [8383838, 9146004], [9146005, 9908171], [9908172, 10670338], [10670339, 11432505], [11432506, 12194672], [12194673, 12956839], [12956840, 13719006], [13719007, 14481173], [14481174, 15243344]] SRR7170840 file size 5143768 SRR7170840 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170840 SRR7170840_1.fastq SRR7170840_2.fastq Input file: SRR7170840_1.fastq Paired file: SRR7170840_2.fastq trimmed: SRR7170840-trimmed-pair1.fastq, SRR7170840-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:17:10 2025 >> started Thu Feb 13 18:17:26 2025 >> done (16.194s) 15243344 read pairs processed; of these: 14741 ( 0.10%) short read pairs filtered out after trimming by size control 15481 ( 0.10%) empty read pairs filtered out after trimming by size control 15213122 (99.80%) read pairs available; of these: 10544323 (69.31%) trimmed read pairs available after processing 4668799 (30.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 15 0.00% 21 10 0.00% 22 12 0.00% 23 16 0.00% 24 5 0.00% 25 14 0.00% 26 16 0.00% 27 18 0.00% 28 12 0.00% 29 22 0.00% 30 14 0.00% 31 36 0.00% 32 20 0.00% 33 17 0.00% 34 20 0.00% 35 21 0.00% 36 19 0.00% 37 26 0.00% 38 29 0.00% 39 32 0.00% 40 32 0.00% 41 37 0.00% 42 28 0.00% 43 52 0.00% 44 38 0.00% 45 49 0.00% 46 62 0.00% 47 83 0.00% 48 76 0.00% 49 82 0.00% 50 104 0.00% 51 107 0.00% 52 118 0.00% 53 147 0.00% 54 149 0.00% 55 163 0.00% 56 180 0.00% 57 186 0.00% 58 228 0.00% 59 253 0.00% 60 320 0.00% 61 372 0.00% 62 418 0.00% 63 433 0.00% 64 538 0.00% 65 593 0.00% 66 630 0.00% 67 768 0.01% 68 768 0.01% 69 938 0.01% 70 1079 0.01% 71 1189 0.01% 72 1462 0.01% 73 1618 0.01% 74 1748 0.01% 75 2004 0.01% 76 2297 0.02% 77 2397 0.02% 78 2532 0.02% 79 2866 0.02% 80 3282 0.02% 81 3705 0.02% 82 4295 0.03% 83 5118 0.03% 84 6197 0.04% 85 6248 0.04% 86 6613 0.04% 87 7141 0.05% 88 7532 0.05% 89 7819 0.05% 90 8701 0.06% 91 9603 0.06% 92 10397 0.07% 93 11732 0.08% 94 12460 0.08% 95 13343 0.09% 96 14101 0.09% 97 14985 0.10% 98 15730 0.10% 99 16578 0.11% 100 18075 0.12% 101 18844 0.12% 102 20398 0.13% 103 22144 0.15% 104 23638 0.16% 105 24803 0.16% 106 25878 0.17% 107 26699 0.18% 108 27831 0.18% 109 29145 0.19% 110 30548 0.20% 111 32266 0.21% 112 34076 0.22% 113 36036 0.24% 114 38373 0.25% 115 40228 0.26% 116 41768 0.27% 117 43082 0.28% 118 45037 0.30% 119 45958 0.30% 120 48066 0.32% 121 50133 0.33% 122 52311 0.34% 123 56127 0.37% 124 59019 0.39% 125 61520 0.40% 126 65687 0.43% 127 67611 0.44% 128 70099 0.46% 129 74172 0.49% 130 77450 0.51% 131 81615 0.54% 132 86815 0.57% 133 92316 0.61% 134 98524 0.65% 135 105687 0.69% 136 112299 0.74% 137 120458 0.79% 138 128775 0.85% 139 138366 0.91% 140 150772 0.99% 141 163800 1.08% 142 184302 1.21% 143 210168 1.38% 144 243482 1.60% 145 291357 1.92% 146 363750 2.39% 147 484397 3.18% 148 711043 4.67% 149 1298353 8.53% 150 3957904 26.02% 151 4668799 30.69% 15213122 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.52 fanout-score-rank=11 prefix-density=0.59 prefix-fanout=2.4 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=591.54 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=19.7 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.91 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=53.15 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=8.6 sequence=AAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7170840 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:18:10 Started mapping on | Feb 13 18:18:10 Finished on | Feb 13 18:19:42 Mapping speed, Million of reads per hour | 595.30 Number of input reads | 15213122 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14415010 Uniquely mapped reads % | 94.75% Average mapped length | 289.18 Number of splices: Total | 13671273 Number of splices: Annotated (sjdb) | 13328891 Number of splices: GT/AG | 13407402 Number of splices: GC/AG | 210695 Number of splices: AT/AC | 8108 Number of splices: Non-canonical | 45068 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404047 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 16575 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.43% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 405223 405223 405223 N_multimapping 404047 404047 404047 N_noFeature 602577 14186617 713207 N_ambiguous 217837 853 99509 UnstrandedReadsAssigned:13594596 PositiveStrandReadsAssigned:227540 NegativeStrandReadsAssigned:13602294 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=143 echo kmer=139 SRR7170840 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170840-trimmed-pair1.fastq SRR7170840-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,213,122 reads, 13,642,336 reads pseudoaligned [quant] estimated average fragment length: 233.072 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR7170840.ke.tsv 34699 SRR7170840.se.tsv 87100 total ==> SRR7170840.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.93 470 20.1235 Potri.005G024800.1.v4.1 1035 802.928 78 7.42827 Potri.004G059700.1.v4.1 961 729.022 3 0.314666 Potri.007G009000.2.v4.1 1416 1183.93 0 0 Potri.003G141000.2.v4.1 2943 2710.93 502.8 14.1823 Potri.016G087400.1.v4.1 270 87.7492 846 737.219 Potri.015G069301.1.v4.1 564 338.844 0 0 Potri.010G195200.1.v4.1 1773 1540.93 23 1.14134 Potri.012G127500.1.v4.1 977 744.978 103 10.5721 ==> SRR7170840.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1163 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170840 completed mapping pipeline successfully