Starting /dee2/code/volunteer_pipeline.sh SRR7170841 current disk space = 3087339888640 free memory = 1582423364 SRR7170841 SRAfilesize 69f1aff216746497f3153527d1a44c50 SRR7170841.sra SRR7170841.sra file validated SRR7170841 is paired end SRR7170841 is conventional basespace SRR7170841 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170841_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3565 34.0 33.0 34.0 32.0 34.0 2 33.0675 34.0 33.0 34.0 32.0 34.0 3 33.1695 34.0 33.0 34.0 32.0 34.0 4 33.18225 34.0 33.0 34.0 32.0 34.0 5 33.1235 34.0 33.0 34.0 32.0 34.0 6 36.62425 38.0 37.0 38.0 34.0 38.0 7 37.138 38.0 38.0 38.0 36.0 38.0 8 37.27075 38.0 38.0 38.0 37.0 38.0 9 37.286 38.0 38.0 38.0 37.0 38.0 10-14 37.323899999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.267 38.0 38.0 38.0 36.4 38.0 20-24 37.21225 38.0 38.0 38.0 36.6 38.0 25-29 37.181799999999996 38.0 38.0 38.0 36.0 38.0 30-34 37.10145 38.0 38.0 38.0 36.0 38.0 35-39 37.04514999999999 38.0 38.0 38.0 36.0 38.0 40-44 36.942750000000004 38.0 38.0 38.0 35.8 38.0 45-49 36.93300000000001 38.0 38.0 38.0 35.8 38.0 50-54 36.7465 38.0 38.0 38.0 35.0 38.0 55-59 36.635149999999996 38.0 38.0 38.0 34.4 38.0 60-64 36.6503 38.0 38.0 38.0 34.2 38.0 65-69 36.53935 38.0 38.0 38.0 34.0 38.0 70-74 36.45725 38.0 38.0 38.0 33.8 38.0 75-79 36.32965 38.0 37.0 38.0 33.8 38.0 80-84 36.0302 38.0 37.0 38.0 33.0 38.0 85-89 36.1056 38.0 37.0 38.0 33.0 38.0 90-94 35.8261 38.0 37.0 38.0 31.4 38.0 95-99 35.6235 38.0 36.4 38.0 31.0 38.0 100-104 35.5108 38.0 36.0 38.0 29.8 38.0 105-109 35.18724999999999 38.0 36.0 38.0 28.6 38.0 110-114 34.97154999999999 38.0 35.4 38.0 28.2 38.0 115-119 34.6656 38.0 34.4 38.0 26.2 38.0 120-124 34.2413 38.0 33.6 38.0 24.6 38.0 125-129 33.44565 38.0 32.8 38.0 18.8 38.0 130-134 32.9425 38.0 32.2 38.0 16.8 38.0 135-139 32.274350000000005 37.0 30.8 38.0 14.0 38.0 140-144 31.3444 36.4 29.4 38.0 12.8 38.0 145-149 29.708949999999998 36.0 28.0 38.0 3.8 38.0 150-151 23.636375 29.5 13.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 2.0 11 2.0 12 1.0 13 1.0 14 2.0 15 1.0 16 6.0 17 1.0 18 1.0 19 5.0 20 3.0 21 6.0 22 9.0 23 14.0 24 21.0 25 24.0 26 18.0 27 45.0 28 39.0 29 79.0 30 77.0 31 91.0 32 134.0 33 187.0 34 308.0 35 489.0 36 1075.0 37 1356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.24069797279959 17.705927636643572 7.595586348473185 28.457788042083653 2 20.1 19.05 36.675000000000004 24.175 3 16.775000000000002 29.65 28.825 24.75 4 20.25 34.599999999999994 25.1 20.05 5 19.825 37.7 25.324999999999996 17.150000000000002 6 17.724999999999998 35.85 26.275 20.150000000000002 7 13.975000000000001 22.25 43.875 19.900000000000002 8 17.925 23.875 30.3 27.900000000000002 9 17.150000000000002 24.45 31.724999999999998 26.674999999999997 10-14 20.46 28.744999999999997 26.255 24.54 15-19 19.895 28.54 27.905 23.66 20-24 19.965 28.935 28.03 23.07 25-29 20.48 28.044999999999998 28.095 23.380000000000003 30-34 20.585 28.165000000000003 28.225 23.025000000000002 35-39 20.064999999999998 28.76 27.474999999999998 23.7 40-44 20.59 28.915000000000003 27.650000000000002 22.845 45-49 20.625 28.58 27.72 23.075000000000003 50-54 20.330000000000002 28.77 27.725 23.175 55-59 20.32 28.365000000000002 27.725 23.59 60-64 20.5 28.134999999999998 27.605 23.76 65-69 20.205000000000002 28.655 27.560000000000002 23.580000000000002 70-74 20.47 28.689999999999998 27.665 23.175 75-79 19.869999999999997 28.73 28.299999999999997 23.1 80-84 20.424999999999997 27.57 28.02 23.985 85-89 20.495 27.700000000000003 27.99 23.815 90-94 20.990000000000002 27.500000000000004 28.37 23.14 95-99 20.905 28.599999999999998 27.0 23.494999999999997 100-104 21.060000000000002 28.485 27.63 22.825 105-109 20.59 28.64 27.455000000000002 23.315 110-114 20.635 28.51 27.200000000000003 23.655 115-119 21.035 28.625 27.139999999999997 23.200000000000003 120-124 21.12 28.235 27.16 23.485 125-129 21.04 27.93 27.284999999999997 23.745 130-134 21.305 28.294999999999998 26.97 23.43 135-139 21.23 28.38 26.93 23.46 140-144 20.695 28.27 26.939999999999998 24.095 145-149 21.085 28.360000000000003 26.840000000000003 23.715 150-151 21.1625 28.625 26.437500000000004 23.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 3.5 25 5.0 26 6.5 27 7.5 28 12.0 29 19.0 30 26.5 31 31.5 32 37.0 33 45.5 34 61.0 35 74.0 36 86.5 37 116.0 38 143.5 39 147.5 40 176.5 41 208.0 42 232.5 43 256.5 44 272.0 45 273.0 46 251.0 47 239.5 48 229.0 49 208.0 50 176.0 51 143.0 52 117.0 53 103.0 54 79.0 55 56.0 56 47.5 57 33.0 58 18.0 59 11.5 60 9.0 61 9.5 62 6.0 63 3.5 64 2.5 65 1.5 66 1.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47089947089947 98.7 2 0.4283194759385236 0.8500000000000001 3 0.0 0.0 4 0.05039052658100278 0.2 5 0.05039052658100278 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit GCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.95 0.0 0.0 0.0 0.0 108-109 2.2125 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.5375 0.0 0.0 0.0 0.0 116-117 3.9749999999999996 0.0 0.0 0.0 0.0 118-119 4.325 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.699999999999999 0.0 0.0 0.0 0.0 126-127 6.300000000000001 0.0 0.0 0.0 0.0 128-129 6.8625 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.0875 0.0 0.0 0.0 0.0 134-135 8.725 0.0 0.0 0.0 0.0 136-137 9.287500000000001 0.0 0.0 0.0 0.0 138-139 10.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACACC 10 0.006832588 144.9875 4 >>END_MODULE SRR7170841 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170841_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.664 33.0 33.0 34.0 32.0 34.0 2 32.80875 33.0 33.0 34.0 32.0 34.0 3 32.85925 33.0 33.0 34.0 32.0 34.0 4 32.85825 33.0 33.0 34.0 32.0 34.0 5 32.86625 33.0 33.0 34.0 32.0 34.0 6 37.068 38.0 38.0 38.0 36.0 38.0 7 37.102 38.0 38.0 38.0 36.0 38.0 8 36.87175 38.0 38.0 38.0 36.0 38.0 9 36.81575 38.0 38.0 38.0 35.0 38.0 10-14 36.9741 38.0 38.0 38.0 36.0 38.0 15-19 37.0673 38.0 38.0 38.0 36.0 38.0 20-24 37.0064 38.0 38.0 38.0 36.0 38.0 25-29 36.8862 38.0 38.0 38.0 35.8 38.0 30-34 36.859750000000005 38.0 38.0 38.0 35.8 38.0 35-39 36.88215 38.0 38.0 38.0 36.0 38.0 40-44 36.8829 38.0 38.0 38.0 36.0 38.0 45-49 36.8313 38.0 38.0 38.0 35.8 38.0 50-54 36.822750000000006 38.0 38.0 38.0 35.4 38.0 55-59 36.7724 38.0 38.0 38.0 35.2 38.0 60-64 36.70345 38.0 38.0 38.0 35.0 38.0 65-69 36.613 38.0 38.0 38.0 34.4 38.0 70-74 36.601350000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.5481 38.0 38.0 38.0 34.0 38.0 80-84 36.40930000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.276700000000005 38.0 37.8 38.0 33.8 38.0 90-94 36.1102 38.0 37.6 38.0 33.2 38.0 95-99 35.984950000000005 38.0 37.0 38.0 33.0 38.0 100-104 35.79685 38.0 37.0 38.0 31.8 38.0 105-109 35.59375 38.0 37.0 38.0 31.0 38.0 110-114 35.4134 38.0 36.2 38.0 29.8 38.0 115-119 34.9787 38.0 35.8 38.0 27.6 38.0 120-124 34.71295 38.0 35.0 38.0 26.8 38.0 125-129 34.30505000000001 38.0 34.8 38.0 24.0 38.0 130-134 33.8127 38.0 33.8 38.0 22.2 38.0 135-139 33.42099999999999 38.0 33.0 38.0 21.4 38.0 140-144 32.35505 38.0 32.4 38.0 13.4 38.0 145-149 30.828300000000002 37.2 30.0 38.0 8.0 38.0 150-151 24.56025 32.0 14.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 1.0 5 2.0 6 0.0 7 0.0 8 2.0 9 1.0 10 3.0 11 0.0 12 1.0 13 4.0 14 1.0 15 4.0 16 4.0 17 3.0 18 7.0 19 4.0 20 9.0 21 9.0 22 9.0 23 15.0 24 24.0 25 18.0 26 27.0 27 41.0 28 46.0 29 36.0 30 49.0 31 77.0 32 97.0 33 162.0 34 230.0 35 358.0 36 827.0 37 1923.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.9 19.0 11.0 23.1 2 25.75 24.349999999999998 32.1 17.8 3 20.65 27.200000000000003 33.800000000000004 18.35 4 24.65 34.4 22.75 18.2 5 22.2 38.574999999999996 21.95 17.275 6 19.950000000000003 38.324999999999996 22.8 18.925 7 18.2 20.325 40.65 20.825 8 20.549999999999997 24.75 28.4 26.3 9 22.025 24.775 28.799999999999997 24.4 10-14 23.315 28.37 26.200000000000003 22.115000000000002 15-19 22.46 28.53 27.935 21.075 20-24 22.725 29.185 27.139999999999997 20.95 25-29 22.67 28.494999999999997 28.134999999999998 20.7 30-34 22.745 27.775 28.205000000000002 21.275 35-39 22.56 28.38 28.015 21.044999999999998 40-44 22.875 27.68 28.215 21.23 45-49 22.43 27.71 28.410000000000004 21.45 50-54 22.43 28.065 28.144999999999996 21.36 55-59 23.06 28.249999999999996 27.605 21.085 60-64 22.615 27.655 28.389999999999997 21.34 65-69 22.720000000000002 27.62 28.199999999999996 21.46 70-74 22.62 28.025 28.389999999999997 20.965 75-79 22.89 27.955000000000002 27.99 21.165 80-84 22.935 28.110000000000003 28.015 20.94 85-89 23.189999999999998 27.785 27.894999999999996 21.13 90-94 23.150000000000002 27.815 28.13 20.905 95-99 23.305 27.755000000000003 27.82 21.12 100-104 23.724999999999998 27.779999999999998 27.565 20.93 105-109 23.505000000000003 27.76 27.644999999999996 21.09 110-114 23.485 28.12 27.815 20.580000000000002 115-119 23.745 27.785 28.125 20.345 120-124 24.32 26.88 28.04 20.76 125-129 24.295 28.17 27.189999999999998 20.345 130-134 24.665 27.93 27.355 20.05 135-139 24.85 27.560000000000002 27.339999999999996 20.25 140-144 25.0 27.939999999999998 27.155 19.905 145-149 25.0 28.21 26.545 20.244999999999997 150-151 27.212500000000002 27.737499999999997 26.474999999999998 18.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 2.0 23 3.5 24 4.0 25 4.0 26 4.0 27 6.5 28 9.5 29 10.5 30 13.0 31 17.5 32 31.0 33 44.5 34 49.0 35 63.5 36 91.5 37 108.5 38 130.0 39 169.0 40 211.5 41 237.0 42 245.5 43 250.0 44 253.0 45 267.5 46 269.0 47 249.5 48 235.0 49 200.0 50 161.5 51 140.5 52 123.0 53 98.0 54 73.0 55 62.5 56 46.0 57 29.0 58 20.0 59 20.0 60 14.5 61 8.5 62 5.0 63 4.5 64 5.0 65 1.5 66 1.0 67 1.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4452849218356 98.6 2 0.37821482602118006 0.75 3 0.12607160867372666 0.375 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 1.0499999999999998 0.0 0.0 0.0 0.0 98-99 1.1875 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6125 0.0 0.0 0.0 0.0 106-107 1.8875000000000002 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.5875 0.0 0.0 0.0 0.0 112-113 3.0375 0.0 0.0 0.0 0.0 114-115 3.425 0.0 0.0 0.0 0.0 116-117 3.8625 0.0 0.0 0.0 0.0 118-119 4.300000000000001 0.0 0.0 0.0 0.0 120-121 4.725 0.0 0.0 0.0 0.0 122-123 5.15 0.0 0.0 0.0 0.0 124-125 5.6875 0.0 0.0 0.0 0.0 126-127 6.2875 0.0 0.0 0.0 0.0 128-129 6.85 0.0 0.0 0.0 0.0 130-131 7.5375 0.0 0.0 0.0 0.0 132-133 8.0875 0.0 0.0 0.0 0.0 134-135 8.7 0.0 0.0 0.0 0.0 136-137 9.287500000000001 0.0 0.0 0.0 0.0 138-139 10.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAAGC 10 0.006830828 145.0 2 >>END_MODULE Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998127 spots for SRR7170841.sra Written 998127 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra Read 998121 spots for SRR7170841.sra Written 998121 spots for SRR7170841.sra SRR ids: ['SRR7170841.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tq2xpxto SRR7170841.sra spots: 19962426 blocks: [[1, 998121], [998122, 1996242], [1996243, 2994363], [2994364, 3992484], [3992485, 4990605], [4990606, 5988726], [5988727, 6986847], [6986848, 7984968], [7984969, 8983089], [8983090, 9981210], [9981211, 10979331], [10979332, 11977452], [11977453, 12975573], [12975574, 13973694], [13973695, 14971815], [14971816, 15969936], [15969937, 16968057], [16968058, 17966178], [17966179, 18964299], [18964300, 19962426]] SRR7170841 file size 6742910 SRR7170841 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170841 SRR7170841_1.fastq SRR7170841_2.fastq Input file: SRR7170841_1.fastq Paired file: SRR7170841_2.fastq trimmed: SRR7170841-trimmed-pair1.fastq, SRR7170841-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:11:24 2025 >> started Thu Feb 13 19:11:52 2025 >> done (28.312s) 19962426 read pairs processed; of these: 34311 ( 0.17%) short read pairs filtered out after trimming by size control 40591 ( 0.20%) empty read pairs filtered out after trimming by size control 19887524 (99.62%) read pairs available; of these: 13926059 (70.02%) trimmed read pairs available after processing 5961465 (29.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 19 0.00% 20 25 0.00% 21 23 0.00% 22 26 0.00% 23 29 0.00% 24 31 0.00% 25 44 0.00% 26 40 0.00% 27 43 0.00% 28 41 0.00% 29 48 0.00% 30 37 0.00% 31 41 0.00% 32 39 0.00% 33 35 0.00% 34 39 0.00% 35 44 0.00% 36 57 0.00% 37 55 0.00% 38 57 0.00% 39 61 0.00% 40 79 0.00% 41 100 0.00% 42 78 0.00% 43 107 0.00% 44 90 0.00% 45 111 0.00% 46 107 0.00% 47 131 0.00% 48 162 0.00% 49 184 0.00% 50 214 0.00% 51 258 0.00% 52 265 0.00% 53 282 0.00% 54 301 0.00% 55 334 0.00% 56 352 0.00% 57 400 0.00% 58 512 0.00% 59 576 0.00% 60 634 0.00% 61 818 0.00% 62 893 0.00% 63 988 0.00% 64 1018 0.01% 65 1131 0.01% 66 1212 0.01% 67 1296 0.01% 68 1464 0.01% 69 1741 0.01% 70 1996 0.01% 71 2387 0.01% 72 2851 0.01% 73 3184 0.02% 74 3559 0.02% 75 3999 0.02% 76 4935 0.02% 77 5281 0.03% 78 5012 0.03% 79 5460 0.03% 80 6000 0.03% 81 7059 0.04% 82 8217 0.04% 83 9710 0.05% 84 11554 0.06% 85 11701 0.06% 86 12326 0.06% 87 13391 0.07% 88 13707 0.07% 89 14311 0.07% 90 15873 0.08% 91 17431 0.09% 92 19226 0.10% 93 21732 0.11% 94 22668 0.11% 95 24292 0.12% 96 24414 0.12% 97 25137 0.13% 98 25387 0.13% 99 26373 0.13% 100 28558 0.14% 101 30700 0.15% 102 34225 0.17% 103 36701 0.18% 104 38889 0.20% 105 41232 0.21% 106 41881 0.21% 107 42650 0.21% 108 42745 0.21% 109 43493 0.22% 110 45453 0.23% 111 48636 0.24% 112 52012 0.26% 113 55352 0.28% 114 59269 0.30% 115 62014 0.31% 116 63556 0.32% 117 64871 0.33% 118 65170 0.33% 119 66217 0.33% 120 68620 0.35% 121 72033 0.36% 122 75774 0.38% 123 81823 0.41% 124 86824 0.44% 125 91571 0.46% 126 95386 0.48% 127 97564 0.49% 128 99196 0.50% 129 102917 0.52% 130 105421 0.53% 131 111436 0.56% 132 118794 0.60% 133 127503 0.64% 134 136677 0.69% 135 147986 0.74% 136 157157 0.79% 137 167163 0.84% 138 179879 0.90% 139 191525 0.96% 140 204848 1.03% 141 226050 1.14% 142 253342 1.27% 143 288140 1.45% 144 332521 1.67% 145 394840 1.99% 146 492432 2.48% 147 645692 3.25% 148 933329 4.69% 149 1606457 8.08% 150 4883663 24.56% 151 5961465 29.98% 19887524 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=12 prefix-density=0.60 prefix-fanout=2.2 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=41.52 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.85 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=47.15 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=6.5 sequence=ATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATT SRR7170841 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:12:34 Started mapping on | Feb 13 19:12:34 Finished on | Feb 13 19:14:41 Mapping speed, Million of reads per hour | 563.74 Number of input reads | 19887524 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 18745817 Uniquely mapped reads % | 94.26% Average mapped length | 287.47 Number of splices: Total | 17485266 Number of splices: Annotated (sjdb) | 17052256 Number of splices: GT/AG | 17145469 Number of splices: GC/AG | 264603 Number of splices: AT/AC | 10640 Number of splices: Non-canonical | 64554 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535049 % of reads mapped to multiple loci | 2.69% Number of reads mapped to too many loci | 61625 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 635996 635996 635996 N_multimapping 535049 535049 535049 N_noFeature 771502 18370635 956044 N_ambiguous 328645 1590 136896 UnstrandedReadsAssigned:17645670 PositiveStrandReadsAssigned:373592 NegativeStrandReadsAssigned:17652877 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=142 echo kmer=137 SRR7170841 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170841-trimmed-pair1.fastq SRR7170841-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,887,524 reads, 17,615,851 reads pseudoaligned [quant] estimated average fragment length: 229.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,272 rounds 52401 SRR7170841.ke.tsv 34699 SRR7170841.se.tsv 87100 total ==> SRR7170841.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1789.95 731 20.99 Potri.005G024800.1.v4.1 1035 806.948 336 21.4008 Potri.004G059700.1.v4.1 961 733.031 6 0.420692 Potri.007G009000.2.v4.1 1416 1187.95 0 0 Potri.003G141000.2.v4.1 2943 2714.95 958.747 18.15 Potri.016G087400.1.v4.1 270 91.2274 1351 761.141 Potri.015G069301.1.v4.1 564 342.393 0 0 Potri.010G195200.1.v4.1 1773 1544.95 54 1.79645 Potri.012G127500.1.v4.1 977 748.98 221 15.1655 ==> SRR7170841.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1175 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 316 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7170841 completed mapping pipeline successfully