Starting /dee2/code/volunteer_pipeline.sh SRR7170842 current disk space = 3087765143552 free memory = 1396159872 SRR7170842 SRAfilesize 63b386c79e26c288a0174414fcda1c72 SRR7170842.sra SRR7170842.sra file validated SRR7170842 is paired end SRR7170842 is conventional basespace SRR7170842 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170842_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5995 34.0 33.0 34.0 32.0 34.0 2 33.1175 34.0 33.0 34.0 32.0 34.0 3 33.19725 34.0 33.0 34.0 32.0 34.0 4 33.1995 34.0 33.0 34.0 32.0 34.0 5 33.1415 34.0 33.0 34.0 32.0 34.0 6 36.64975 38.0 37.0 38.0 34.0 38.0 7 37.016 38.0 38.0 38.0 36.0 38.0 8 37.2105 38.0 38.0 38.0 36.0 38.0 9 37.18375 38.0 38.0 38.0 36.0 38.0 10-14 37.2628 38.0 38.0 38.0 36.4 38.0 15-19 37.197900000000004 38.0 38.0 38.0 36.0 38.0 20-24 37.08485 38.0 38.0 38.0 35.8 38.0 25-29 37.08265 38.0 38.0 38.0 36.0 38.0 30-34 37.04505 38.0 38.0 38.0 36.0 38.0 35-39 36.9336 38.0 38.0 38.0 35.6 38.0 40-44 36.87050000000001 38.0 38.0 38.0 35.2 38.0 45-49 36.839999999999996 38.0 38.0 38.0 35.0 38.0 50-54 36.676249999999996 38.0 38.0 38.0 34.2 38.0 55-59 36.623000000000005 38.0 38.0 38.0 34.2 38.0 60-64 36.62245 38.0 38.0 38.0 34.0 38.0 65-69 36.49135 38.0 38.0 38.0 34.0 38.0 70-74 36.4207 38.0 37.6 38.0 33.8 38.0 75-79 36.2368 38.0 37.0 38.0 33.4 38.0 80-84 35.91115 38.0 37.0 38.0 31.8 38.0 85-89 35.96775 38.0 37.0 38.0 32.2 38.0 90-94 35.68065 38.0 36.6 38.0 31.0 38.0 95-99 35.49125 38.0 36.2 38.0 29.6 38.0 100-104 35.3358 38.0 36.0 38.0 29.0 38.0 105-109 35.01635 38.0 35.6 38.0 28.0 38.0 110-114 34.78895 38.0 35.2 38.0 27.4 38.0 115-119 34.415350000000004 38.0 34.2 38.0 24.8 38.0 120-124 33.949749999999995 38.0 33.0 38.0 23.4 38.0 125-129 33.27695 38.0 32.6 38.0 19.8 38.0 130-134 32.7031 37.6 31.8 38.0 16.2 38.0 135-139 32.0148 37.0 30.4 38.0 14.0 38.0 140-144 30.84515 36.0 28.2 38.0 12.8 38.0 145-149 29.1504 36.0 26.8 38.0 3.8 38.0 150-151 23.269125000000003 29.0 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 1.0 12 0.0 13 1.0 14 2.0 15 3.0 16 2.0 17 3.0 18 7.0 19 7.0 20 8.0 21 8.0 22 12.0 23 15.0 24 22.0 25 27.0 26 38.0 27 40.0 28 47.0 29 64.0 30 75.0 31 97.0 32 119.0 33 214.0 34 302.0 35 545.0 36 1130.0 37 1208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.7420341575325 16.97680346673464 9.406066785623247 29.875095590109613 2 22.325 19.625 34.949999999999996 23.1 3 16.5 27.325 29.575000000000003 26.6 4 21.575 33.550000000000004 24.7 20.175 5 21.46073036518259 35.81790895447724 23.761880940470235 18.959479739869938 6 18.075 35.9 26.1 19.925 7 14.025000000000002 23.025000000000002 43.7 19.25 8 18.575 23.150000000000002 31.374999999999996 26.900000000000002 9 17.825 24.05 32.35 25.775 10-14 20.23 29.7 26.740000000000002 23.330000000000002 15-19 20.1 29.04 27.689999999999998 23.169999999999998 20-24 19.900000000000002 28.994999999999997 27.925 23.18 25-29 19.735 28.810000000000002 27.644999999999996 23.810000000000002 30-34 19.175 28.875 28.294999999999998 23.655 35-39 20.215 28.444999999999997 27.705000000000002 23.635 40-44 19.965 28.595 28.07 23.369999999999997 45-49 19.54 28.965000000000003 27.565 23.93 50-54 19.97 28.599999999999998 27.815 23.615 55-59 19.97 27.694999999999997 28.49 23.845 60-64 20.06 28.499999999999996 27.455000000000002 23.985 65-69 20.0 29.439999999999998 27.534999999999997 23.025000000000002 70-74 20.615 28.76 27.310000000000002 23.315 75-79 19.564999999999998 29.49 27.284999999999997 23.66 80-84 19.580000000000002 28.835 28.050000000000004 23.535 85-89 20.86 28.985 26.93 23.225 90-94 20.005 29.154999999999998 27.33 23.51 95-99 20.18 29.035 27.615000000000002 23.169999999999998 100-104 20.11 29.365000000000002 26.935 23.59 105-109 20.465 29.42 27.224999999999998 22.89 110-114 20.68 28.77 26.790000000000003 23.76 115-119 20.29 29.325000000000003 26.534999999999997 23.849999999999998 120-124 21.245 28.52 26.424999999999997 23.810000000000002 125-129 20.955 28.08 26.779999999999998 24.185000000000002 130-134 21.125 28.59 26.71 23.575 135-139 21.21 27.994999999999997 26.905 23.89 140-144 21.305 27.965 26.25 24.48 145-149 21.555 28.57 25.855 24.02 150-151 21.45 28.050000000000004 26.3 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.0 22 2.0 23 4.5 24 4.0 25 3.0 26 5.0 27 7.5 28 8.5 29 14.0 30 21.0 31 26.0 32 34.5 33 50.5 34 70.0 35 86.5 36 101.0 37 133.5 38 167.5 39 177.0 40 196.0 41 222.0 42 240.0 43 253.0 44 266.5 45 269.0 46 236.5 47 216.0 48 212.0 49 191.5 50 157.0 51 129.0 52 104.5 53 78.5 54 75.0 55 70.0 56 49.5 57 29.5 58 20.0 59 18.0 60 16.0 61 11.5 62 6.0 63 4.0 64 2.5 65 1.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26749179085628 98.25 2 0.6062136903258398 1.2 3 0.07577671129072998 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025258903763576663 0.15 7 0.025258903763576663 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCT 7 0.17500000000000002 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGGCTATGATCTCGTAT 6 0.15 TruSeq Adapter, Index 7 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6375 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.2375 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.5375 0.0 0.0 0.0 0.0 106-107 2.9875 0.0 0.0 0.0 0.0 108-109 3.2874999999999996 0.0 0.0 0.0 0.0 110-111 3.65 0.0 0.0 0.0 0.0 112-113 4.1625 0.0 0.0 0.0 0.0 114-115 4.6625 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.75 0.0 0.0 0.0 0.0 120-121 6.225 0.0 0.0 0.0 0.0 122-123 6.762499999999999 0.0 0.0 0.0 0.0 124-125 7.3375 0.0 0.0 0.0 0.0 126-127 7.9875 0.0 0.0 0.0 0.0 128-129 8.6125 0.0 0.0 0.0 0.0 130-131 9.25 0.0 0.0 0.0 0.0 132-133 9.775 0.0 0.0 0.0 0.0 134-135 10.4 0.0 0.0 0.0 0.0 136-137 11.1125 0.0 0.0 0.0 0.0 138-139 11.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATACCT 10 0.006830828 145.0 7 ATACCTC 10 0.006830828 145.0 8 GCCCGAT 10 0.006830828 145.0 1 CCGATTC 10 0.006830828 145.0 3 CGATTCA 10 0.006830828 145.0 4 >>END_MODULE SRR7170842 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170842_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6535 33.0 33.0 34.0 32.0 34.0 2 32.75325 33.0 33.0 34.0 32.0 34.0 3 32.683 33.0 33.0 34.0 32.0 34.0 4 32.8225 33.0 33.0 34.0 32.0 34.0 5 32.8275 33.0 33.0 34.0 32.0 34.0 6 36.9825 38.0 38.0 38.0 36.0 38.0 7 36.991 38.0 38.0 38.0 36.0 38.0 8 36.87475 38.0 38.0 38.0 36.0 38.0 9 36.7785 38.0 38.0 38.0 36.0 38.0 10-14 36.9216 38.0 38.0 38.0 36.0 38.0 15-19 36.95415 38.0 38.0 38.0 36.0 38.0 20-24 36.86435 38.0 38.0 38.0 36.0 38.0 25-29 36.7729 38.0 38.0 38.0 35.6 38.0 30-34 36.7295 38.0 38.0 38.0 35.4 38.0 35-39 36.7211 38.0 38.0 38.0 35.4 38.0 40-44 36.697950000000006 38.0 38.0 38.0 35.4 38.0 45-49 36.7254 38.0 38.0 38.0 35.4 38.0 50-54 36.6481 38.0 38.0 38.0 35.2 38.0 55-59 36.61765 38.0 38.0 38.0 34.8 38.0 60-64 36.49095 38.0 38.0 38.0 34.8 38.0 65-69 36.4082 38.0 38.0 38.0 34.0 38.0 70-74 36.4014 38.0 38.0 38.0 34.0 38.0 75-79 36.356399999999994 38.0 38.0 38.0 34.0 38.0 80-84 36.1098 38.0 38.0 38.0 33.8 38.0 85-89 35.9353 38.0 37.6 38.0 33.2 38.0 90-94 35.76055 38.0 37.0 38.0 31.8 38.0 95-99 35.63270000000001 38.0 37.0 38.0 31.4 38.0 100-104 35.4142 38.0 36.8 38.0 29.8 38.0 105-109 35.231849999999994 38.0 36.2 38.0 29.2 38.0 110-114 34.8901 38.0 35.8 38.0 27.4 38.0 115-119 34.599450000000004 38.0 35.6 38.0 26.2 38.0 120-124 34.32625 38.0 35.0 38.0 24.4 38.0 125-129 33.917649999999995 38.0 34.0 38.0 22.6 38.0 130-134 33.29365 38.0 33.4 38.0 18.6 38.0 135-139 32.93765 38.0 33.0 38.0 17.0 38.0 140-144 31.79095 38.0 31.4 38.0 12.8 38.0 145-149 30.384300000000003 36.4 29.2 38.0 4.2 38.0 150-151 24.178874999999998 31.0 13.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 3.0 5 2.0 6 4.0 7 2.0 8 0.0 9 1.0 10 3.0 11 2.0 12 3.0 13 4.0 14 9.0 15 6.0 16 5.0 17 5.0 18 11.0 19 9.0 20 8.0 21 9.0 22 13.0 23 17.0 24 22.0 25 30.0 26 24.0 27 35.0 28 40.0 29 43.0 30 54.0 31 69.0 32 102.0 33 135.0 34 237.0 35 359.0 36 905.0 37 1817.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.725 21.099999999999998 11.25 21.925 2 26.650000000000002 24.3 30.925000000000004 18.125 3 21.076345431789736 28.260325406758447 31.739674593241553 18.923654568210264 4 24.474999999999998 35.099999999999994 22.45 17.974999999999998 5 24.23028785982478 37.27158948685857 20.650813516896118 17.847309136420524 6 20.825 37.925 22.825 18.425 7 19.475 20.075000000000003 38.800000000000004 21.65 8 20.925 25.1 27.675 26.3 9 21.099999999999998 25.775 29.2 23.925 10-14 23.47 28.38 26.529999999999998 21.62 15-19 23.61 28.804999999999996 27.67 19.915 20-24 22.759999999999998 28.16 28.38 20.7 25-29 22.615 28.02 28.845 20.52 30-34 22.365 28.475 28.165000000000003 20.995 35-39 23.21 28.044999999999998 28.605000000000004 20.14 40-44 22.814999999999998 28.165000000000003 28.449999999999996 20.57 45-49 23.18 28.165000000000003 27.905 20.75 50-54 23.294999999999998 28.084999999999997 27.83 20.79 55-59 22.57 28.095 28.360000000000003 20.974999999999998 60-64 23.175 27.77 28.794999999999998 20.26 65-69 22.95 27.644999999999996 28.58 20.825 70-74 23.79 27.950000000000003 27.735 20.525 75-79 23.03 27.675 28.410000000000004 20.885 80-84 23.695 27.905 27.68 20.72 85-89 23.36 27.92 28.005000000000003 20.715 90-94 23.665 28.000000000000004 27.994999999999997 20.34 95-99 23.330000000000002 28.315 27.71 20.645 100-104 24.185000000000002 27.525 27.794999999999998 20.495 105-109 23.685000000000002 27.694999999999997 28.720000000000002 19.900000000000002 110-114 24.605 27.994999999999997 27.77 19.63 115-119 24.935 28.26 27.400000000000002 19.405 120-124 24.41 28.24 27.865000000000002 19.485 125-129 24.77 27.765 27.18 20.285 130-134 25.290000000000003 27.615000000000002 27.639999999999997 19.455 135-139 25.669999999999998 27.415 27.279999999999998 19.634999999999998 140-144 25.21 27.165 27.605 20.02 145-149 25.44 27.63 27.315 19.615 150-151 26.125 27.962500000000002 26.7125 19.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 3.0 25 2.0 26 3.5 27 6.0 28 7.0 29 11.0 30 16.5 31 23.0 32 33.5 33 45.5 34 52.5 35 65.0 36 83.5 37 122.5 38 157.0 39 174.5 40 197.5 41 222.0 42 248.0 43 261.5 44 277.0 45 280.0 46 251.5 47 234.0 48 228.0 49 192.5 50 153.0 51 134.0 52 110.0 53 97.5 54 80.0 55 50.5 56 42.5 57 37.0 58 23.0 59 21.5 60 19.0 61 10.0 62 7.0 63 3.0 64 2.5 65 2.0 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.125 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06019812039624 97.5 2 0.7366014732029463 1.4500000000000002 3 0.10160020320040639 0.3 4 0.025400050800101596 0.1 5 0.0 0.0 6 0.025400050800101596 0.15 7 0.0 0.0 8 0.025400050800101596 0.2 9 0.0 0.0 >10 0.025400050800101596 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 12 0.3 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 8 0.2 Illumina Single End PCR Primer 1 (96% over 32bp) AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4875 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.4875 0.0 0.0 0.0 0.0 106-107 2.95 0.0 0.0 0.0 0.0 108-109 3.2625 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 4.1 0.0 0.0 0.0 0.0 114-115 4.637499999999999 0.0 0.0 0.0 0.0 116-117 5.25 0.0 0.0 0.0 0.0 118-119 5.7625 0.0 0.0 0.0 0.0 120-121 6.25 0.0 0.0 0.0 0.0 122-123 6.875 0.0 0.0 0.0 0.0 124-125 7.4625 0.0 0.0 0.0 0.0 126-127 8.1125 0.0 0.0 0.0 0.0 128-129 8.7875 0.0 0.0 0.0 0.0 130-131 9.4 0.0 0.0 0.0 0.0 132-133 9.9 0.0 0.0 0.0 0.0 134-135 10.525 0.0 0.0 0.0 0.0 136-137 11.25 0.0 0.0 0.0 0.0 138-139 12.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTTG 10 0.006830828 145.0 9 GGGATAT 10 0.006830828 145.0 3 >>END_MODULE Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865979 spots for SRR7170842.sra Written 865979 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra Read 865968 spots for SRR7170842.sra Written 865968 spots for SRR7170842.sra SRR ids: ['SRR7170842.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zne_tr56 SRR7170842.sra spots: 17319371 blocks: [[1, 865968], [865969, 1731936], [1731937, 2597904], [2597905, 3463872], [3463873, 4329840], [4329841, 5195808], [5195809, 6061776], [6061777, 6927744], [6927745, 7793712], [7793713, 8659680], [8659681, 9525648], [9525649, 10391616], [10391617, 11257584], [11257585, 12123552], [12123553, 12989520], [12989521, 13855488], [13855489, 14721456], [14721457, 15587424], [15587425, 16453392], [16453393, 17319371]] SRR7170842 file size 5847266 SRR7170842 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170842 SRR7170842_1.fastq SRR7170842_2.fastq Input file: SRR7170842_1.fastq Paired file: SRR7170842_2.fastq trimmed: SRR7170842-trimmed-pair1.fastq, SRR7170842-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:44:12 2025 >> started Thu Feb 13 18:44:37 2025 >> done (24.822s) 17319371 read pairs processed; of these: 35048 ( 0.20%) short read pairs filtered out after trimming by size control 50982 ( 0.29%) empty read pairs filtered out after trimming by size control 17233341 (99.50%) read pairs available; of these: 12409753 (72.01%) trimmed read pairs available after processing 4823588 (27.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 6 0.00% 20 17 0.00% 21 15 0.00% 22 21 0.00% 23 19 0.00% 24 18 0.00% 25 23 0.00% 26 22 0.00% 27 31 0.00% 28 33 0.00% 29 31 0.00% 30 40 0.00% 31 34 0.00% 32 35 0.00% 33 30 0.00% 34 25 0.00% 35 31 0.00% 36 32 0.00% 37 37 0.00% 38 51 0.00% 39 39 0.00% 40 67 0.00% 41 66 0.00% 42 72 0.00% 43 69 0.00% 44 97 0.00% 45 103 0.00% 46 90 0.00% 47 132 0.00% 48 136 0.00% 49 189 0.00% 50 197 0.00% 51 258 0.00% 52 260 0.00% 53 305 0.00% 54 305 0.00% 55 320 0.00% 56 418 0.00% 57 450 0.00% 58 528 0.00% 59 589 0.00% 60 696 0.00% 61 850 0.00% 62 928 0.01% 63 975 0.01% 64 1132 0.01% 65 1219 0.01% 66 1199 0.01% 67 1380 0.01% 68 1573 0.01% 69 1860 0.01% 70 2222 0.01% 71 2496 0.01% 72 3144 0.02% 73 3596 0.02% 74 4024 0.02% 75 4753 0.03% 76 7760 0.05% 77 6631 0.04% 78 5375 0.03% 79 5792 0.03% 80 6597 0.04% 81 7716 0.04% 82 8849 0.05% 83 10157 0.06% 84 12079 0.07% 85 12862 0.07% 86 13134 0.08% 87 14117 0.08% 88 14597 0.08% 89 15272 0.09% 90 16629 0.10% 91 18041 0.10% 92 20191 0.12% 93 22423 0.13% 94 23981 0.14% 95 24986 0.14% 96 25493 0.15% 97 26149 0.15% 98 26446 0.15% 99 27765 0.16% 100 29729 0.17% 101 31300 0.18% 102 34750 0.20% 103 37104 0.22% 104 39450 0.23% 105 41150 0.24% 106 42054 0.24% 107 42431 0.25% 108 43211 0.25% 109 43599 0.25% 110 45769 0.27% 111 48299 0.28% 112 50638 0.29% 113 53908 0.31% 114 57476 0.33% 115 59960 0.35% 116 61174 0.35% 117 62238 0.36% 118 63262 0.37% 119 64075 0.37% 120 65525 0.38% 121 68185 0.40% 122 71207 0.41% 123 75670 0.44% 124 80459 0.47% 125 83169 0.48% 126 87011 0.50% 127 88540 0.51% 128 91344 0.53% 129 93925 0.55% 130 97206 0.56% 131 100357 0.58% 132 107118 0.62% 133 114991 0.67% 134 122914 0.71% 135 131802 0.76% 136 140139 0.81% 137 149492 0.87% 138 161147 0.94% 139 172110 1.00% 140 183888 1.07% 141 202522 1.18% 142 227102 1.32% 143 256781 1.49% 144 296026 1.72% 145 351587 2.04% 146 439367 2.55% 147 578958 3.36% 148 833834 4.84% 149 1419649 8.24% 150 4155808 24.11% 151 4823588 27.99% 17233341 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=91.67 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=14 prefix-density=0.79 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=79.40 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.0 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170842 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:45:22 Started mapping on | Feb 13 18:45:23 Finished on | Feb 13 18:47:18 Mapping speed, Million of reads per hour | 539.48 Number of input reads | 17233341 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 16306514 Uniquely mapped reads % | 94.62% Average mapped length | 286.06 Number of splices: Total | 14911267 Number of splices: Annotated (sjdb) | 14546460 Number of splices: GT/AG | 14633249 Number of splices: GC/AG | 215309 Number of splices: AT/AC | 10640 Number of splices: Non-canonical | 52069 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.03% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436390 % of reads mapped to multiple loci | 2.53% Number of reads mapped to too many loci | 115581 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.01% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 516958 516958 516958 N_multimapping 436390 436390 436390 N_noFeature 727748 15903163 905339 N_ambiguous 328999 1717 102085 UnstrandedReadsAssigned:15249767 PositiveStrandReadsAssigned:401634 NegativeStrandReadsAssigned:15299090 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR7170842 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170842-trimmed-pair1.fastq SRR7170842-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,233,341 reads, 15,258,214 reads pseudoaligned [quant] estimated average fragment length: 219.23 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,033 rounds 52401 SRR7170842.ke.tsv 34699 SRR7170842.se.tsv 87100 total ==> SRR7170842.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1799.77 818 22.2315 Potri.005G024800.1.v4.1 1035 816.77 423 25.3322 Potri.004G059700.1.v4.1 961 742.798 15 0.987761 Potri.007G009000.2.v4.1 1416 1197.77 0 0 Potri.003G141000.2.v4.1 2943 2724.77 1037.35 18.622 Potri.016G087400.1.v4.1 270 93.4622 1381.72 723.129 Potri.015G069301.1.v4.1 564 349.576 0 0 Potri.010G195200.1.v4.1 1773 1554.77 290 9.12354 Potri.012G127500.1.v4.1 977 758.784 286 18.4365 ==> SRR7170842.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 540 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 464 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170842 completed mapping pipeline successfully