Starting /dee2/code/volunteer_pipeline.sh SRR7170843 current disk space = 3087729577984 free memory = 1526767956 SRR7170843 SRAfilesize 150bc7b28d7c64faa818922e31d070a0 SRR7170843.sra SRR7170843.sra file validated SRR7170843 is paired end SRR7170843 is conventional basespace SRR7170843 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170843_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.253 34.0 33.0 34.0 32.0 34.0 2 33.063 34.0 33.0 34.0 32.0 34.0 3 33.042 34.0 33.0 34.0 32.0 34.0 4 33.16725 34.0 33.0 34.0 32.0 34.0 5 33.156 34.0 33.0 34.0 32.0 34.0 6 36.59125 38.0 37.0 38.0 34.0 38.0 7 37.06625 38.0 38.0 38.0 36.0 38.0 8 37.1965 38.0 38.0 38.0 36.0 38.0 9 37.22175 38.0 38.0 38.0 36.0 38.0 10-14 37.28465 38.0 38.0 38.0 36.8 38.0 15-19 37.22295 38.0 38.0 38.0 36.2 38.0 20-24 37.1715 38.0 38.0 38.0 36.0 38.0 25-29 37.0707 38.0 38.0 38.0 36.0 38.0 30-34 37.08725 38.0 38.0 38.0 35.8 38.0 35-39 37.056400000000004 38.0 38.0 38.0 36.0 38.0 40-44 36.90689999999999 38.0 38.0 38.0 35.6 38.0 45-49 36.9135 38.0 38.0 38.0 35.2 38.0 50-54 36.73585 38.0 38.0 38.0 34.6 38.0 55-59 36.66555000000001 38.0 38.0 38.0 34.0 38.0 60-64 36.602399999999996 38.0 38.0 38.0 34.0 38.0 65-69 36.4644 38.0 37.8 38.0 34.0 38.0 70-74 36.42205 38.0 38.0 38.0 34.0 38.0 75-79 36.22435 38.0 37.0 38.0 33.4 38.0 80-84 35.996449999999996 38.0 37.0 38.0 32.6 38.0 85-89 35.974900000000005 38.0 37.0 38.0 32.4 38.0 90-94 35.8168 38.0 36.6 38.0 31.4 38.0 95-99 35.511950000000006 38.0 36.2 38.0 29.8 38.0 100-104 35.331149999999994 38.0 36.0 38.0 29.0 38.0 105-109 35.015150000000006 38.0 35.6 38.0 28.0 38.0 110-114 34.82470000000001 38.0 35.0 38.0 26.6 38.0 115-119 34.433600000000006 38.0 34.4 38.0 24.8 38.0 120-124 33.99055 38.0 33.0 38.0 23.4 38.0 125-129 33.359049999999996 38.0 33.0 38.0 19.6 38.0 130-134 32.763099999999994 37.6 31.8 38.0 16.2 38.0 135-139 31.9923 36.8 30.6 38.0 14.0 38.0 140-144 31.072450000000003 36.0 28.6 38.0 12.8 38.0 145-149 29.46735 36.0 27.6 38.0 3.8 38.0 150-151 23.373875 29.0 11.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 1.0 13 1.0 14 3.0 15 1.0 16 1.0 17 3.0 18 4.0 19 8.0 20 3.0 21 11.0 22 16.0 23 19.0 24 23.0 25 22.0 26 34.0 27 48.0 28 40.0 29 51.0 30 71.0 31 93.0 32 147.0 33 205.0 34 295.0 35 565.0 36 1075.0 37 1258.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.374517374517374 15.881595881595882 10.32175032175032 36.42213642213642 2 20.925 21.224999999999998 36.375 21.475 3 18.375 26.724999999999998 28.199999999999996 26.700000000000003 4 20.925 34.1 23.150000000000002 21.825 5 20.330082520630157 37.259314828707176 24.33108277069267 18.079519879969993 6 18.325 36.375 24.15 21.15 7 14.374999999999998 23.7 43.425000000000004 18.5 8 17.349999999999998 23.75 31.3 27.6 9 17.849999999999998 23.425 33.275 25.45 10-14 19.88 30.099999999999998 26.395000000000003 23.625 15-19 20.06 28.585 27.994999999999997 23.36 20-24 19.79 28.87 27.775 23.565 25-29 20.125 29.085 27.445000000000004 23.345 30-34 19.41 29.09 27.994999999999997 23.505000000000003 35-39 19.32 28.92 28.155 23.605 40-44 19.86 28.915000000000003 28.299999999999997 22.925 45-49 19.615 28.910000000000004 28.194999999999997 23.28 50-54 20.385 28.24 28.449999999999996 22.925 55-59 19.57 29.244999999999997 28.025 23.16 60-64 19.8 28.345 28.075 23.78 65-69 20.075000000000003 28.835 27.384999999999998 23.705000000000002 70-74 20.22 29.13 27.18 23.47 75-79 19.994999999999997 28.910000000000004 27.595 23.5 80-84 19.744999999999997 28.82 27.67 23.765 85-89 20.015 28.494999999999997 27.605 23.885 90-94 20.244999999999997 28.93 27.22 23.605 95-99 20.205000000000002 28.810000000000002 27.555000000000003 23.43 100-104 20.794999999999998 28.515 27.37 23.32 105-109 20.75 28.439999999999998 27.85 22.96 110-114 20.91 29.349999999999998 26.340000000000003 23.400000000000002 115-119 20.375 28.84 27.11 23.674999999999997 120-124 20.47 28.060000000000002 27.334999999999997 24.135 125-129 21.08 28.24 27.08 23.599999999999998 130-134 20.96 28.475 27.134999999999998 23.43 135-139 21.29 28.725 26.46 23.525 140-144 21.065 28.555000000000003 26.715 23.665 145-149 20.9 28.725 26.805 23.57 150-151 20.6375 27.787499999999998 27.037499999999998 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 1.5 22 1.0 23 1.5 24 4.0 25 6.5 26 7.5 27 10.0 28 10.0 29 12.0 30 20.0 31 29.0 32 33.5 33 48.0 34 78.0 35 89.0 36 106.5 37 135.0 38 152.0 39 169.0 40 186.5 41 222.0 42 256.5 43 266.5 44 267.5 45 255.0 46 254.0 47 242.0 48 208.0 49 186.5 50 159.0 51 130.0 52 101.5 53 80.0 54 67.5 55 47.0 56 35.5 57 39.0 58 30.0 59 18.5 60 13.5 61 8.0 62 3.0 63 1.0 64 0.5 65 0.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52177196073497 98.85000000000001 2 0.4278882456581928 0.8500000000000001 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025169896803423106 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.45 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 2.0250000000000004 0.0 0.0 0.0 0.0 104-105 2.2874999999999996 0.0 0.0 0.0 0.0 106-107 2.7874999999999996 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 3.975 0.0 0.0 0.0 0.0 114-115 4.35 0.0 0.0 0.0 0.0 116-117 4.75 0.0 0.0 0.0 0.0 118-119 5.0875 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.1875 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 7.95 0.0 0.0 0.0 0.0 130-131 8.5625 0.0 0.0 0.0 0.0 132-133 9.125 0.0 0.0 0.0 0.0 134-135 9.524999999999999 0.0 0.0 0.0 0.0 136-137 10.2625 0.0 0.0 0.0 0.0 138-139 10.8875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACTAA 10 0.006832588 144.9875 5 >>END_MODULE SRR7170843 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170843_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65925 33.0 33.0 34.0 32.0 34.0 2 32.8225 33.0 33.0 34.0 32.0 34.0 3 32.86175 33.0 33.0 34.0 32.0 34.0 4 32.9395 33.0 33.0 34.0 32.0 34.0 5 32.86425 34.0 33.0 34.0 32.0 34.0 6 37.074 38.0 38.0 38.0 36.0 38.0 7 37.19875 38.0 38.0 38.0 36.0 38.0 8 36.996 38.0 38.0 38.0 36.0 38.0 9 37.0045 38.0 38.0 38.0 36.0 38.0 10-14 37.10245 38.0 38.0 38.0 36.4 38.0 15-19 37.0974 38.0 38.0 38.0 36.6 38.0 20-24 37.0449 38.0 38.0 38.0 36.4 38.0 25-29 36.96625 38.0 38.0 38.0 36.2 38.0 30-34 36.93475 38.0 38.0 38.0 36.0 38.0 35-39 36.94745 38.0 38.0 38.0 36.0 38.0 40-44 36.9332 38.0 38.0 38.0 36.0 38.0 45-49 36.86285 38.0 38.0 38.0 36.0 38.0 50-54 36.83535 38.0 38.0 38.0 35.8 38.0 55-59 36.7341 38.0 38.0 38.0 35.4 38.0 60-64 36.68845 38.0 38.0 38.0 35.0 38.0 65-69 36.5654 38.0 38.0 38.0 34.6 38.0 70-74 36.573 38.0 38.0 38.0 34.6 38.0 75-79 36.47185 38.0 38.0 38.0 34.0 38.0 80-84 36.2061 38.0 38.0 38.0 33.8 38.0 85-89 36.12325 38.0 38.0 38.0 33.4 38.0 90-94 35.9895 38.0 37.6 38.0 32.8 38.0 95-99 35.8894 38.0 37.0 38.0 33.0 38.0 100-104 35.70705 38.0 37.0 38.0 31.8 38.0 105-109 35.52175 38.0 37.0 38.0 31.0 38.0 110-114 35.2213 38.0 36.4 38.0 29.4 38.0 115-119 34.8884 38.0 35.8 38.0 27.6 38.0 120-124 34.63035 38.0 35.4 38.0 26.4 38.0 125-129 34.24105 38.0 34.8 38.0 24.0 38.0 130-134 33.7857 38.0 33.8 38.0 22.0 38.0 135-139 33.3382 38.0 33.0 38.0 18.6 38.0 140-144 32.2533 38.0 32.6 38.0 13.4 38.0 145-149 30.734099999999994 37.0 29.8 38.0 6.0 38.0 150-151 24.563625000000002 32.0 14.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 1.0 6 1.0 7 3.0 8 0.0 9 2.0 10 2.0 11 4.0 12 1.0 13 3.0 14 3.0 15 4.0 16 1.0 17 5.0 18 5.0 19 8.0 20 17.0 21 15.0 22 14.0 23 18.0 24 17.0 25 21.0 26 25.0 27 35.0 28 36.0 29 46.0 30 53.0 31 66.0 32 91.0 33 128.0 34 193.0 35 359.0 36 871.0 37 1944.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.15 19.475 12.85 26.525 2 26.025 24.4 34.0 15.575 3 20.205051262815704 27.85696424106027 31.98299574893723 19.954988747186796 4 23.200000000000003 35.475 22.425 18.9 5 23.730932733183295 37.70942735683921 21.73043260815204 16.829207301825456 6 19.875 37.55 24.425 18.15 7 17.849999999999998 19.275000000000002 40.975 21.9 8 21.3 25.924999999999997 27.950000000000003 24.825 9 21.7 24.8 30.85 22.650000000000002 10-14 23.75 28.89 26.135 21.224999999999998 15-19 22.689999999999998 28.075 28.325 20.91 20-24 22.900000000000002 28.685 27.93 20.485 25-29 23.275000000000002 27.925 28.305000000000003 20.495 30-34 22.28 27.615000000000002 29.049999999999997 21.055 35-39 22.665 28.044999999999998 28.58 20.71 40-44 22.665 27.615000000000002 28.720000000000002 21.0 45-49 22.99 27.950000000000003 28.305000000000003 20.755000000000003 50-54 22.875 28.065 28.105000000000004 20.955 55-59 22.505 27.595 28.884999999999998 21.015 60-64 23.01 27.83 28.144999999999996 21.015 65-69 22.78 28.349999999999998 28.1 20.77 70-74 22.95 27.785 28.53 20.735 75-79 22.650000000000002 28.13 28.335 20.885 80-84 23.62 28.375 27.889999999999997 20.115 85-89 23.215 27.845 28.4 20.54 90-94 23.46 28.49 28.265 19.785 95-99 23.59 27.83 28.060000000000002 20.52 100-104 23.95 27.465 28.060000000000002 20.525 105-109 23.685000000000002 28.349999999999998 27.99 19.975 110-114 23.565 28.060000000000002 28.055000000000003 20.32 115-119 24.47 28.01 26.985 20.535 120-124 24.055 28.144999999999996 27.58 20.22 125-129 24.099999999999998 27.939999999999998 27.97 19.99 130-134 24.709999999999997 27.485 27.944999999999997 19.86 135-139 24.95 27.11 28.04 19.900000000000002 140-144 25.515 27.950000000000003 27.0 19.535 145-149 25.56 28.050000000000004 26.86 19.53 150-151 25.0125 28.1 27.250000000000004 19.6375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.5 22 1.5 23 2.0 24 3.0 25 1.5 26 2.5 27 5.5 28 9.0 29 11.5 30 16.5 31 24.5 32 29.5 33 40.5 34 57.5 35 71.5 36 96.0 37 126.5 38 150.5 39 178.0 40 208.0 41 234.5 42 256.0 43 253.5 44 262.5 45 273.5 46 253.0 47 238.0 48 225.5 49 199.0 50 162.5 51 136.5 52 117.5 53 87.0 54 69.0 55 55.0 56 36.0 57 27.5 58 21.0 59 16.5 60 10.5 61 6.5 62 6.0 63 5.0 64 3.0 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24012158054711 97.95 2 0.5065856129685917 1.0 3 0.1519756838905775 0.44999999999999996 4 0.050658561296859174 0.2 5 0.0 0.0 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025329280648429587 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGCCTCTATGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 32bp) CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.7375 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.4375 0.0 0.0 0.0 0.0 100-101 1.7625000000000002 0.0 0.0 0.0 0.0 102-103 2.075 0.0 0.0 0.0 0.0 104-105 2.325 0.0 0.0 0.0 0.0 106-107 2.775 0.0 0.0 0.0 0.0 108-109 3.0250000000000004 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 3.9250000000000003 0.0 0.0 0.0 0.0 114-115 4.3 0.0 0.0 0.0 0.0 116-117 4.7 0.0 0.0 0.0 0.0 118-119 5.05 0.0 0.0 0.0 0.0 120-121 5.55 0.0 0.0 0.0 0.0 122-123 6.125 0.0 0.0 0.0 0.0 124-125 6.7125 0.0 0.0 0.0 0.0 126-127 7.262499999999999 0.0 0.0 0.0 0.0 128-129 7.887499999999999 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 9.1 0.0 0.0 0.0 0.0 134-135 9.55 0.0 0.0 0.0 0.0 136-137 10.275 0.0 0.0 0.0 0.0 138-139 10.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 100-104 >>END_MODULE Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra Read 909016 spots for SRR7170843.sra Written 909016 spots for SRR7170843.sra Read 909011 spots for SRR7170843.sra Written 909011 spots for SRR7170843.sra SRR ids: ['SRR7170843.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xsq9am9w SRR7170843.sra spots: 18180225 blocks: [[1, 909011], [909012, 1818022], [1818023, 2727033], [2727034, 3636044], [3636045, 4545055], [4545056, 5454066], [5454067, 6363077], [6363078, 7272088], [7272089, 8181099], [8181100, 9090110], [9090111, 9999121], [9999122, 10908132], [10908133, 11817143], [11817144, 12726154], [12726155, 13635165], [13635166, 14544176], [14544177, 15453187], [15453188, 16362198], [16362199, 17271209], [17271210, 18180225]] SRR7170843 file size 6138981 SRR7170843 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170843 SRR7170843_1.fastq SRR7170843_2.fastq Input file: SRR7170843_1.fastq Paired file: SRR7170843_2.fastq trimmed: SRR7170843-trimmed-pair1.fastq, SRR7170843-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:48:11 2025 >> started Thu Feb 13 18:48:30 2025 >> done (19.244s) 18180225 read pairs processed; of these: 22723 ( 0.12%) short read pairs filtered out after trimming by size control 60930 ( 0.34%) empty read pairs filtered out after trimming by size control 18096572 (99.54%) read pairs available; of these: 12705845 (70.21%) trimmed read pairs available after processing 5390727 (29.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 13 0.00% 20 8 0.00% 21 9 0.00% 22 8 0.00% 23 12 0.00% 24 18 0.00% 25 15 0.00% 26 24 0.00% 27 13 0.00% 28 26 0.00% 29 20 0.00% 30 12 0.00% 31 22 0.00% 32 18 0.00% 33 25 0.00% 34 21 0.00% 35 22 0.00% 36 36 0.00% 37 33 0.00% 38 29 0.00% 39 33 0.00% 40 60 0.00% 41 39 0.00% 42 59 0.00% 43 53 0.00% 44 53 0.00% 45 76 0.00% 46 92 0.00% 47 106 0.00% 48 125 0.00% 49 153 0.00% 50 177 0.00% 51 186 0.00% 52 209 0.00% 53 238 0.00% 54 268 0.00% 55 276 0.00% 56 300 0.00% 57 339 0.00% 58 421 0.00% 59 480 0.00% 60 553 0.00% 61 660 0.00% 62 705 0.00% 63 769 0.00% 64 897 0.00% 65 900 0.00% 66 1026 0.01% 67 1110 0.01% 68 1353 0.01% 69 1530 0.01% 70 1807 0.01% 71 2050 0.01% 72 2512 0.01% 73 2764 0.02% 74 3144 0.02% 75 3877 0.02% 76 6071 0.03% 77 5894 0.03% 78 4643 0.03% 79 4920 0.03% 80 5529 0.03% 81 6192 0.03% 82 7304 0.04% 83 8220 0.05% 84 10049 0.06% 85 10082 0.06% 86 10855 0.06% 87 11538 0.06% 88 12280 0.07% 89 13052 0.07% 90 14048 0.08% 91 15379 0.08% 92 16908 0.09% 93 18280 0.10% 94 19707 0.11% 95 21026 0.12% 96 21942 0.12% 97 23042 0.13% 98 23841 0.13% 99 25076 0.14% 100 26764 0.15% 101 28102 0.16% 102 30381 0.17% 103 32236 0.18% 104 33945 0.19% 105 35915 0.20% 106 37092 0.20% 107 38364 0.21% 108 39518 0.22% 109 40641 0.22% 110 42389 0.23% 111 44004 0.24% 112 46200 0.26% 113 48740 0.27% 114 51180 0.28% 115 53789 0.30% 116 55706 0.31% 117 57134 0.32% 118 58453 0.32% 119 60302 0.33% 120 61770 0.34% 121 64480 0.36% 122 67216 0.37% 123 71037 0.39% 124 74721 0.41% 125 78247 0.43% 126 81075 0.45% 127 84330 0.47% 128 87199 0.48% 129 90801 0.50% 130 94526 0.52% 131 98533 0.54% 132 104397 0.58% 133 111687 0.62% 134 119483 0.66% 135 128364 0.71% 136 136715 0.76% 137 147747 0.82% 138 159176 0.88% 139 171580 0.95% 140 185799 1.03% 141 205447 1.14% 142 228837 1.26% 143 260970 1.44% 144 301856 1.67% 145 357895 1.98% 146 447949 2.48% 147 596257 3.29% 148 867069 4.79% 149 1500347 8.29% 150 4513811 24.94% 151 5390727 29.79% 18096572 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=15 prefix-density=0.45 prefix-fanout=2.0 sequence=TACGCTTGTAAGGATT criterion=fanout-score sequence-density=0.17 sequence-density-rank=22 fanout-score=13.18 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=2.2 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.48 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=37.94 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.5 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7170843 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:49:15 Started mapping on | Feb 13 18:49:15 Finished on | Feb 13 18:51:14 Mapping speed, Million of reads per hour | 547.46 Number of input reads | 18096572 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 17104456 Uniquely mapped reads % | 94.52% Average mapped length | 287.75 Number of splices: Total | 16322791 Number of splices: Annotated (sjdb) | 15905542 Number of splices: GT/AG | 16014856 Number of splices: GC/AG | 232567 Number of splices: AT/AC | 11124 Number of splices: Non-canonical | 64244 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 501083 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 24431 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 506782 506782 506782 N_multimapping 501083 501083 501083 N_noFeature 707874 16750042 861202 N_ambiguous 326706 1242 124917 UnstrandedReadsAssigned:16069876 PositiveStrandReadsAssigned:353172 NegativeStrandReadsAssigned:16118337 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170843 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170843-trimmed-pair1.fastq SRR7170843-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,096,572 reads, 16,009,626 reads pseudoaligned [quant] estimated average fragment length: 228.883 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR7170843.ke.tsv 34699 SRR7170843.se.tsv 87100 total ==> SRR7170843.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.12 960 27.651 Potri.005G024800.1.v4.1 1035 807.117 418 26.703 Potri.004G059700.1.v4.1 961 733.177 13 0.91423 Potri.007G009000.2.v4.1 1416 1188.12 0 0 Potri.003G141000.2.v4.1 2943 2715.12 966.783 18.3595 Potri.016G087400.1.v4.1 270 90.7753 1009 573.119 Potri.015G069301.1.v4.1 564 341.409 0 0 Potri.010G195200.1.v4.1 1773 1545.12 126 4.20465 Potri.012G127500.1.v4.1 977 749.152 183 12.5951 ==> SRR7170843.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 813 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 493 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7170843 completed mapping pipeline successfully