Starting /dee2/code/volunteer_pipeline.sh SRR7170844 current disk space = 3087704989696 free memory = 1567912496 SRR7170844 SRAfilesize ba1c77ad7e61c232a5e03a10a42e88a9 SRR7170844.sra SRR7170844.sra file validated SRR7170844 is paired end SRR7170844 is conventional basespace SRR7170844 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170844_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.7485 34.0 33.0 34.0 32.0 34.0 2 33.04125 34.0 33.0 34.0 32.0 34.0 3 33.06625 34.0 33.0 34.0 31.0 34.0 4 33.26475 34.0 33.0 34.0 32.0 34.0 5 33.23925 34.0 33.0 34.0 33.0 34.0 6 36.91625 38.0 37.0 38.0 35.0 38.0 7 37.20025 38.0 38.0 38.0 36.0 38.0 8 37.461 38.0 38.0 38.0 37.0 38.0 9 37.55475 38.0 38.0 38.0 38.0 38.0 10-14 37.48180000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.428700000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.362700000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.361149999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.321600000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.2513 38.0 38.0 38.0 36.8 38.0 40-44 37.18105 38.0 38.0 38.0 36.4 38.0 45-49 37.08290000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.01965 38.0 38.0 38.0 36.0 38.0 55-59 37.08175 38.0 38.0 38.0 36.0 38.0 60-64 37.06555 38.0 38.0 38.0 36.0 38.0 65-69 36.95005 38.0 38.0 38.0 35.8 38.0 70-74 36.884550000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.68585 38.0 38.0 38.0 34.8 38.0 80-84 36.49355 38.0 38.0 38.0 34.0 38.0 85-89 36.3866 38.0 37.8 38.0 33.8 38.0 90-94 36.433299999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.3572 38.0 38.0 38.0 34.0 38.0 100-104 36.035849999999996 38.0 37.0 38.0 32.4 38.0 105-109 35.9067 38.0 37.0 38.0 32.6 38.0 110-114 35.739349999999995 38.0 37.0 38.0 31.4 38.0 115-119 35.466499999999996 38.0 36.0 38.0 30.6 38.0 120-124 35.0797 38.0 35.6 38.0 27.8 38.0 125-129 34.9203 38.0 35.2 38.0 27.2 38.0 130-134 34.49675 38.0 34.6 38.0 26.2 38.0 135-139 34.227399999999996 38.0 34.0 38.0 24.6 38.0 140-144 33.72115 38.0 33.4 38.0 22.8 38.0 145-149 32.6839 38.0 33.0 38.0 13.8 38.0 150-151 27.657375000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 2.0 11 1.0 12 1.0 13 1.0 14 0.0 15 2.0 16 3.0 17 2.0 18 2.0 19 1.0 20 2.0 21 6.0 22 5.0 23 14.0 24 8.0 25 10.0 26 25.0 27 30.0 28 34.0 29 42.0 30 59.0 31 68.0 32 87.0 33 112.0 34 177.0 35 360.0 36 821.0 37 2124.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.13677012098895 15.570752235665438 9.389794844818516 34.90268279852709 2 20.25 20.150000000000002 37.75 21.85 3 17.150000000000002 27.125 28.299999999999997 27.425 4 21.8 34.35 23.075000000000003 20.775 5 21.9 37.3 23.225 17.575 6 16.925 38.800000000000004 24.9 19.375 7 14.000000000000002 22.6 43.775 19.625 8 17.349999999999998 23.65 30.375000000000004 28.625 9 17.525 22.075 33.5 26.900000000000002 10-14 19.46 28.994999999999997 27.229999999999997 24.315 15-19 19.595000000000002 28.389999999999997 28.225 23.79 20-24 20.225 28.585 27.994999999999997 23.195 25-29 19.919999999999998 28.605000000000004 28.395 23.080000000000002 30-34 19.63 28.67 28.375 23.325000000000003 35-39 20.02 28.904999999999998 27.445000000000004 23.630000000000003 40-44 19.96 28.87 27.785 23.385 45-49 19.59 28.860000000000003 27.735 23.815 50-54 20.19 28.994999999999997 27.425 23.39 55-59 19.91 29.265 27.88 22.945 60-64 19.865 29.075 27.52 23.54 65-69 19.950000000000003 29.165000000000003 27.685 23.200000000000003 70-74 20.05 28.16 28.425 23.365 75-79 19.470000000000002 29.049999999999997 27.334999999999997 24.145 80-84 20.035 28.499999999999996 27.63 23.835 85-89 20.169999999999998 29.025000000000002 27.400000000000002 23.405 90-94 19.994999999999997 29.28 27.189999999999998 23.535 95-99 20.505000000000003 28.7 27.735 23.06 100-104 20.525 28.58 27.565 23.330000000000002 105-109 20.615 28.544999999999998 27.505000000000003 23.335 110-114 20.205000000000002 28.615000000000002 27.500000000000004 23.68 115-119 20.830000000000002 28.694999999999997 26.26 24.215 120-124 20.794999999999998 28.389999999999997 27.405 23.41 125-129 20.515 28.405 27.295 23.785 130-134 21.255 28.475 26.865 23.405 135-139 21.224999999999998 28.95 25.679999999999996 24.145 140-144 20.695 28.634999999999998 26.72 23.95 145-149 20.84 28.54 26.305 24.315 150-151 21.1875 27.975 26.5875 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 2.0 22 4.0 23 3.0 24 2.0 25 6.5 26 8.5 27 8.5 28 16.0 29 19.0 30 18.0 31 26.5 32 36.5 33 50.5 34 68.0 35 74.0 36 98.0 37 135.5 38 149.0 39 164.5 40 196.0 41 234.5 42 251.5 43 260.0 44 276.0 45 269.0 46 257.5 47 231.5 48 200.5 49 179.0 50 154.0 51 124.0 52 105.0 53 89.5 54 70.0 55 53.0 56 44.5 57 38.0 58 21.5 59 14.5 60 10.0 61 6.5 62 4.5 63 3.5 64 2.5 65 2.0 66 2.5 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42080080584236 98.7 2 0.4784688995215311 0.95 3 0.07554772097708386 0.22499999999999998 4 0.0 0.0 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.5375 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.3625 0.0 0.0 0.0 0.0 110-111 3.775 0.0 0.0 0.0 0.0 112-113 4.2625 0.0 0.0 0.0 0.0 114-115 4.65 0.0 0.0 0.0 0.0 116-117 5.1625 0.0 0.0 0.0 0.0 118-119 5.5625 0.0 0.0 0.0 0.0 120-121 6.2125 0.0 0.0 0.0 0.0 122-123 6.8125 0.0 0.0 0.0 0.0 124-125 7.3375 0.0 0.0 0.0 0.0 126-127 7.9375 0.0 0.0 0.0 0.0 128-129 8.825 0.0 0.0 0.0 0.0 130-131 9.475 0.0 0.0 0.0 0.0 132-133 9.95 0.0 0.0 0.0 0.0 134-135 10.6125 0.0 0.0 0.0 0.0 136-137 11.25 0.0 0.0 0.0 0.0 138-139 12.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTAAAT 10 0.0060887975 150.61038 1 AATCCCA 10 0.006836113 144.9625 5 TCCAACA 10 0.006836113 144.9625 7 TTTTTTT 35 0.0035419178 20.70893 65-69 >>END_MODULE SRR7170844 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170844_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97425 33.0 33.0 34.0 32.0 34.0 2 33.06725 34.0 33.0 34.0 32.0 34.0 3 33.14575 34.0 33.0 34.0 33.0 34.0 4 33.043 34.0 33.0 34.0 33.0 34.0 5 33.088 34.0 33.0 34.0 32.0 34.0 6 37.26825 38.0 38.0 38.0 37.0 38.0 7 37.29325 38.0 38.0 38.0 37.0 38.0 8 37.2645 38.0 38.0 38.0 37.0 38.0 9 37.27025 38.0 38.0 38.0 37.0 38.0 10-14 37.205349999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.186449999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.09590000000001 38.0 38.0 38.0 36.8 38.0 25-29 37.10295 38.0 38.0 38.0 36.8 38.0 30-34 37.150400000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.14085 38.0 38.0 38.0 36.8 38.0 40-44 37.148649999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.0688 38.0 38.0 38.0 36.6 38.0 50-54 37.06 38.0 38.0 38.0 36.0 38.0 55-59 36.93895 38.0 38.0 38.0 36.0 38.0 60-64 36.91010000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.830499999999994 38.0 38.0 38.0 35.8 38.0 70-74 36.7701 38.0 38.0 38.0 35.8 38.0 75-79 36.6923 38.0 38.0 38.0 35.0 38.0 80-84 36.5982 38.0 38.0 38.0 34.8 38.0 85-89 36.49115 38.0 38.0 38.0 34.2 38.0 90-94 36.4415 38.0 38.0 38.0 34.0 38.0 95-99 36.403099999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.1572 38.0 38.0 38.0 33.8 38.0 105-109 36.0399 38.0 37.6 38.0 33.0 38.0 110-114 35.70775 38.0 37.0 38.0 31.2 38.0 115-119 35.483349999999994 38.0 36.6 38.0 30.2 38.0 120-124 35.0927 38.0 36.2 38.0 28.6 38.0 125-129 34.738350000000004 38.0 35.6 38.0 26.4 38.0 130-134 34.59654999999999 38.0 35.2 38.0 26.8 38.0 135-139 33.93065 38.0 34.2 38.0 23.0 38.0 140-144 33.4491 38.0 33.0 38.0 20.8 38.0 145-149 32.4005 38.0 33.0 38.0 12.8 38.0 150-151 27.08475 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 3.0 4 4.0 5 2.0 6 0.0 7 1.0 8 0.0 9 3.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 2.0 17 2.0 18 5.0 19 6.0 20 2.0 21 4.0 22 7.0 23 12.0 24 21.0 25 14.0 26 24.0 27 28.0 28 41.0 29 40.0 30 51.0 31 63.0 32 79.0 33 104.0 34 146.0 35 305.0 36 689.0 37 2331.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.5 18.05 12.875 26.575 2 25.525 23.7 34.65 16.125 3 19.6 26.35 33.85 20.200000000000003 4 24.2 34.725 22.75 18.325 5 24.45 37.85 20.549999999999997 17.150000000000002 6 20.075000000000003 38.625 22.5 18.8 7 19.125 18.95 42.0 19.925 8 20.9 24.925 27.474999999999998 26.700000000000003 9 21.725 24.6 30.425 23.25 10-14 23.552065619685905 28.518555566670003 26.74302290687206 21.186355906772032 15-19 23.28582145536384 27.551887971993 28.33708427106777 20.825206301575395 20-24 22.461230615307652 28.299149574787393 28.43421710855428 20.805402701350676 25-29 22.648589153492097 28.29697818691215 28.80228136882129 20.252151290774464 30-34 22.26113056528264 28.68934467233617 28.38919459729865 20.66033016508254 35-39 22.653592155293175 28.722233340004 28.23694216529918 20.387232339403642 40-44 22.757516634148782 28.13547451098104 28.425634098754315 20.681374756115865 45-49 23.080002001300844 27.6329614249262 28.873767949166957 20.413268624605994 50-54 23.051525762881443 27.818909454727365 28.649324662331168 20.48024012006003 55-59 22.554660529344073 27.963176064441885 29.163956571771653 20.318206834442385 60-64 23.033820292175307 27.281368821292773 28.457074244546725 21.22773664198519 65-69 22.747511131122117 27.69022962629446 28.50567812296763 21.05658111961579 70-74 23.39637746422496 27.234063844691285 28.73011107775443 20.63944761332933 75-79 22.654725571621555 28.328413468754693 28.068244358833244 20.948616600790515 80-84 23.626538577003902 28.189732812969076 27.36915841088762 20.8145701991394 85-89 23.48526542252464 28.143293140541353 28.183319157452345 20.188122279481664 90-94 23.162371778834125 28.261195896922693 28.3112334250688 20.26519889917438 95-99 23.348678943154525 27.692153722978386 28.397718174539634 20.56144915932746 100-104 23.133506805444355 27.88230584467574 28.442754203362693 20.541433146517214 105-109 24.016614953458113 27.82003803423081 27.759983985587027 20.40336302672405 110-114 24.594594594594597 28.20820820820821 27.237237237237238 19.95995995995996 115-119 24.092706612604495 28.317565199979978 27.4115232517395 20.17820493567603 120-124 24.26304989740253 28.086682348230816 27.816425604324106 19.833842150042543 125-129 25.178955799169046 28.497772438304047 26.560544626320272 19.762727136206635 130-134 24.70217238962859 28.065872459705677 27.865652217439184 19.36630293322655 135-139 25.10386944986735 27.70686289232617 27.816989537968663 19.372278119837812 140-144 25.856978431666917 27.62347995796427 26.69268878546765 19.826852824901167 145-149 26.193574216795117 27.900110099089183 26.704033630267244 19.202282053848464 150-151 26.7017017017017 28.553553553553552 26.076076076076077 18.66866866866867 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 2.5 20 3.0 21 2.5 22 3.0 23 3.0 24 2.5 25 4.0 26 5.0 27 8.5 28 11.0 29 12.0 30 18.0 31 21.0 32 31.5 33 46.0 34 56.5 35 71.5 36 92.5 37 113.5 38 136.0 39 163.0 40 186.0 41 226.5 42 279.0 43 293.5 44 280.5 45 270.5 46 269.5 47 243.0 48 208.0 49 192.5 50 153.0 51 112.0 52 96.5 53 87.5 54 83.0 55 67.0 56 42.0 57 33.0 58 25.0 59 15.0 60 9.5 61 6.5 62 4.5 63 2.0 64 1.0 65 2.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.03 15-19 0.025 20-24 0.05 25-29 0.06 30-34 0.05 35-39 0.06 40-44 0.055 45-49 0.065 50-54 0.05 55-59 0.065 60-64 0.06 65-69 0.055 70-74 0.06999999999999999 75-79 0.065 80-84 0.06999999999999999 85-89 0.065 90-94 0.075 95-99 0.08 100-104 0.08 105-109 0.09 110-114 0.1 115-119 0.11499999999999999 120-124 0.095 125-129 0.11499999999999999 130-134 0.11 135-139 0.11499999999999999 140-144 0.08499999999999999 145-149 0.09 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.41963159222811 98.5 2 0.40373454453696694 0.8 3 0.10093363613424174 0.3 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.05046681806712087 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.1875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.7625 0.0 0.0 0.0 0.0 92-93 0.8500000000000001 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1625 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.5375 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.5375 0.0 0.0 0.0 0.0 106-107 2.8375000000000004 0.0 0.0 0.0 0.0 108-109 3.3499999999999996 0.0 0.0 0.0 0.0 110-111 3.75 0.0 0.0 0.0 0.0 112-113 4.2625 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.1375 0.0 0.0 0.0 0.0 118-119 5.5625 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.7625 0.0 0.0 0.0 0.0 124-125 7.275 0.0 0.0 0.0 0.0 126-127 7.8875 0.0 0.0 0.0 0.0 128-129 8.774999999999999 0.0 0.0 0.0 0.0 130-131 9.45 0.0 0.0 0.0 0.0 132-133 10.0125 0.0 0.0 0.0 0.0 134-135 10.65 0.0 0.0 0.0 0.0 136-137 11.274999999999999 0.0 0.0 0.0 0.0 138-139 12.100000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852208 spots for SRR7170844.sra Written 1852208 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra Read 1852189 spots for SRR7170844.sra Written 1852189 spots for SRR7170844.sra SRR ids: ['SRR7170844.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_11gbd0pv SRR7170844.sra spots: 37043799 blocks: [[1, 1852189], [1852190, 3704378], [3704379, 5556567], [5556568, 7408756], [7408757, 9260945], [9260946, 11113134], [11113135, 12965323], [12965324, 14817512], [14817513, 16669701], [16669702, 18521890], [18521891, 20374079], [20374080, 22226268], [22226269, 24078457], [24078458, 25930646], [25930647, 27782835], [27782836, 29635024], [29635025, 31487213], [31487214, 33339402], [33339403, 35191591], [35191592, 37043799]] SRR7170844 file size 12531227 SRR7170844 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170844 SRR7170844_1.fastq SRR7170844_2.fastq Input file: SRR7170844_1.fastq Paired file: SRR7170844_2.fastq trimmed: SRR7170844-trimmed-pair1.fastq, SRR7170844-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:53:31 2025 >> started Thu Feb 13 18:54:11 2025 >> done (39.837s) 37043799 read pairs processed; of these: 33382 ( 0.09%) short read pairs filtered out after trimming by size control 53926 ( 0.15%) empty read pairs filtered out after trimming by size control 36956491 (99.76%) read pairs available; of these: 23966403 (64.85%) trimmed read pairs available after processing 12990088 (35.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 19 0.00% 20 22 0.00% 21 25 0.00% 22 32 0.00% 23 32 0.00% 24 38 0.00% 25 31 0.00% 26 44 0.00% 27 39 0.00% 28 34 0.00% 29 38 0.00% 30 44 0.00% 31 40 0.00% 32 47 0.00% 33 49 0.00% 34 47 0.00% 35 76 0.00% 36 76 0.00% 37 59 0.00% 38 95 0.00% 39 94 0.00% 40 94 0.00% 41 87 0.00% 42 122 0.00% 43 148 0.00% 44 131 0.00% 45 159 0.00% 46 185 0.00% 47 195 0.00% 48 308 0.00% 49 317 0.00% 50 402 0.00% 51 436 0.00% 52 489 0.00% 53 552 0.00% 54 574 0.00% 55 622 0.00% 56 688 0.00% 57 855 0.00% 58 929 0.00% 59 1097 0.00% 60 1308 0.00% 61 1525 0.00% 62 1660 0.00% 63 1769 0.00% 64 2071 0.01% 65 2190 0.01% 66 2428 0.01% 67 2873 0.01% 68 3133 0.01% 69 3592 0.01% 70 4064 0.01% 71 4878 0.01% 72 5526 0.01% 73 6178 0.02% 74 6791 0.02% 75 7547 0.02% 76 8684 0.02% 77 9731 0.03% 78 10245 0.03% 79 11342 0.03% 80 12794 0.03% 81 14563 0.04% 82 16623 0.04% 83 18882 0.05% 84 23259 0.06% 85 24198 0.07% 86 24073 0.07% 87 25254 0.07% 88 27088 0.07% 89 28584 0.08% 90 31038 0.08% 91 34477 0.09% 92 37171 0.10% 93 41235 0.11% 94 43664 0.12% 95 46660 0.13% 96 48251 0.13% 97 50683 0.14% 98 52738 0.14% 99 55039 0.15% 100 58398 0.16% 101 61457 0.17% 102 66075 0.18% 103 70062 0.19% 104 73587 0.20% 105 77166 0.21% 106 79758 0.22% 107 82228 0.22% 108 84223 0.23% 109 87068 0.24% 110 90151 0.24% 111 94192 0.25% 112 98650 0.27% 113 102768 0.28% 114 107638 0.29% 115 111652 0.30% 116 114570 0.31% 117 117346 0.32% 118 120267 0.33% 119 122487 0.33% 120 126883 0.34% 121 131700 0.36% 122 135108 0.37% 123 142602 0.39% 124 148323 0.40% 125 152488 0.41% 126 159791 0.43% 127 163106 0.44% 128 167302 0.45% 129 172629 0.47% 130 178838 0.48% 131 184589 0.50% 132 192931 0.52% 133 205079 0.55% 134 215594 0.58% 135 228224 0.62% 136 241073 0.65% 137 254825 0.69% 138 270930 0.73% 139 289756 0.78% 140 312965 0.85% 141 342497 0.93% 142 381282 1.03% 143 429871 1.16% 144 499541 1.35% 145 596621 1.61% 146 749854 2.03% 147 993705 2.69% 148 1456808 3.94% 149 2658428 7.19% 150 9200109 24.89% 151 12990088 35.15% 36956491 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=2.3 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=36.47 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=20 prefix-density=0.33 prefix-fanout=2.6 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=32.86 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.4 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACC SRR7170844 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:54:52 Started mapping on | Feb 13 18:54:52 Finished on | Feb 13 18:58:13 Mapping speed, Million of reads per hour | 661.91 Number of input reads | 36956491 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 35223878 Uniquely mapped reads % | 95.31% Average mapped length | 288.14 Number of splices: Total | 33394802 Number of splices: Annotated (sjdb) | 32544356 Number of splices: GT/AG | 32765424 Number of splices: GC/AG | 472146 Number of splices: AT/AC | 21185 Number of splices: Non-canonical | 136047 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 989837 % of reads mapped to multiple loci | 2.68% Number of reads mapped to too many loci | 106500 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.65% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 767510 767510 767510 N_multimapping 989837 989837 989837 N_noFeature 1602567 34460260 1994863 N_ambiguous 622956 3354 249321 UnstrandedReadsAssigned:32998355 PositiveStrandReadsAssigned:760264 NegativeStrandReadsAssigned:32979694 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR7170844 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170844-trimmed-pair1.fastq SRR7170844-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 36,956,491 reads, 32,896,321 reads pseudoaligned [quant] estimated average fragment length: 226.926 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52401 SRR7170844.ke.tsv 34699 SRR7170844.se.tsv 87100 total ==> SRR7170844.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1792.07 1571 24.0457 Potri.005G024800.1.v4.1 1035 809.074 387 13.1202 Potri.004G059700.1.v4.1 961 735.124 9 0.335814 Potri.007G009000.2.v4.1 1416 1190.07 0 0 Potri.003G141000.2.v4.1 2943 2717.07 2429.52 24.5265 Potri.016G087400.1.v4.1 270 92.3315 2433.24 722.857 Potri.015G069301.1.v4.1 564 344.24 0 0 Potri.010G195200.1.v4.1 1773 1547.07 206.922 3.6687 Potri.012G127500.1.v4.1 977 751.08 384 14.0237 ==> SRR7170844.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1217 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 649 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 30 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 16 SRR7170844 completed mapping pipeline successfully