Starting /dee2/code/volunteer_pipeline.sh SRR7170846 current disk space = 3087352598528 free memory = 1541561632 SRR7170846 SRAfilesize 3e579f27f76a29a9b226b073f565da41 SRR7170846.sra SRR7170846.sra file validated SRR7170846 is paired end SRR7170846 is conventional basespace SRR7170846 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13825 34.0 33.0 34.0 32.0 34.0 2 33.1405 34.0 33.0 34.0 32.0 34.0 3 33.09975 34.0 33.0 34.0 32.0 34.0 4 33.10875 34.0 33.0 34.0 31.0 34.0 5 33.25725 34.0 33.0 34.0 33.0 34.0 6 36.57375 38.0 37.0 38.0 34.0 38.0 7 37.0645 38.0 38.0 38.0 36.0 38.0 8 37.25425 38.0 38.0 38.0 37.0 38.0 9 37.3285 38.0 38.0 38.0 37.0 38.0 10-14 37.3293 38.0 38.0 38.0 36.8 38.0 15-19 37.261199999999995 38.0 38.0 38.0 36.8 38.0 20-24 37.1706 38.0 38.0 38.0 36.2 38.0 25-29 37.2081 38.0 38.0 38.0 36.0 38.0 30-34 37.1048 38.0 38.0 38.0 36.0 38.0 35-39 37.0459 38.0 38.0 38.0 36.0 38.0 40-44 37.0237 38.0 38.0 38.0 36.0 38.0 45-49 36.896550000000005 38.0 38.0 38.0 35.2 38.0 50-54 36.644850000000005 38.0 38.0 38.0 34.6 38.0 55-59 36.5206 38.0 38.0 38.0 34.0 38.0 60-64 36.39775 38.0 38.0 38.0 34.0 38.0 65-69 36.39639999999999 38.0 37.8 38.0 33.8 38.0 70-74 36.31825 38.0 37.4 38.0 33.6 38.0 75-79 36.2959 38.0 37.0 38.0 33.4 38.0 80-84 36.03145 38.0 37.0 38.0 33.0 38.0 85-89 36.00170000000001 38.0 37.0 38.0 32.6 38.0 90-94 35.84715 38.0 37.0 38.0 31.4 38.0 95-99 35.638799999999996 38.0 36.4 38.0 30.6 38.0 100-104 35.1779 38.0 36.0 38.0 28.4 38.0 105-109 34.7442 38.0 35.0 38.0 26.2 38.0 110-114 34.188649999999996 38.0 33.8 38.0 23.8 38.0 115-119 33.91844999999999 38.0 33.4 38.0 22.2 38.0 120-124 33.6025 38.0 33.0 38.0 20.8 38.0 125-129 32.725199999999994 38.0 32.2 38.0 14.4 38.0 130-134 32.2478 37.2 30.8 38.0 14.4 38.0 135-139 31.144949999999994 36.4 28.4 38.0 13.0 38.0 140-144 30.582349999999998 36.0 28.0 38.0 12.2 38.0 145-149 28.6185 35.0 24.0 38.0 2.0 38.0 150-151 21.72375 26.5 2.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 2.0 13 2.0 14 1.0 15 4.0 16 2.0 17 3.0 18 4.0 19 9.0 20 11.0 21 8.0 22 14.0 23 14.0 24 21.0 25 31.0 26 32.0 27 53.0 28 56.0 29 69.0 30 93.0 31 104.0 32 155.0 33 218.0 34 304.0 35 531.0 36 1095.0 37 1162.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.553594601609134 15.520373734752141 10.070075266026473 34.855956397612246 2 21.5 20.424999999999997 35.625 22.45 3 17.667667667667665 26.176176176176174 28.52852852852853 27.627627627627625 4 21.65 34.599999999999994 22.525000000000002 21.224999999999998 5 20.424999999999997 36.275 24.625 18.675 6 16.725 37.375 26.724999999999998 19.175 7 13.850000000000001 21.85 44.55 19.75 8 18.075 23.45 31.05 27.425 9 17.299999999999997 23.225 33.85 25.624999999999996 10-14 20.185 28.865000000000002 26.895000000000003 24.055 15-19 19.564999999999998 29.095 27.72 23.62 20-24 19.775000000000002 29.225 27.42 23.580000000000002 25-29 19.919999999999998 28.939999999999998 28.71 22.43 30-34 19.845 29.080000000000002 27.865000000000002 23.21 35-39 19.5 28.82 28.16 23.52 40-44 20.34 28.825 27.61 23.225 45-49 20.09 28.694999999999997 27.61 23.605 50-54 19.439999999999998 29.195 28.015 23.35 55-59 19.61 28.345 28.17 23.875 60-64 20.04 28.89 27.68 23.39 65-69 20.0 28.575 27.77 23.655 70-74 20.169999999999998 29.18 27.35 23.3 75-79 20.080000000000002 28.54 27.41 23.97 80-84 19.955000000000002 28.53 27.755000000000003 23.76 85-89 20.185 28.88 27.345000000000002 23.59 90-94 19.950000000000003 29.015 27.639999999999997 23.395 95-99 20.150000000000002 28.92 27.565 23.365 100-104 20.325 28.48 27.675 23.52 105-109 20.200000000000003 29.595 27.029999999999998 23.175 110-114 20.919999999999998 28.305000000000003 27.52 23.255 115-119 20.41 28.689999999999998 27.275 23.625 120-124 20.435 28.835 27.325 23.405 125-129 20.8 28.315 27.01 23.875 130-134 21.245 28.485 27.1 23.169999999999998 135-139 20.495 27.93 27.005000000000003 24.57 140-144 20.28 29.25 27.065 23.405 145-149 20.405 28.7 26.889999999999997 24.005000000000003 150-151 22.025 27.212500000000002 27.1125 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.5 21 2.5 22 1.5 23 1.5 24 4.5 25 5.5 26 7.5 27 10.0 28 11.0 29 18.5 30 23.5 31 28.5 32 35.0 33 47.0 34 68.5 35 84.0 36 90.0 37 106.5 38 152.0 39 194.0 40 207.0 41 225.5 42 250.0 43 252.5 44 259.0 45 264.0 46 247.0 47 234.5 48 238.0 49 203.5 50 165.0 51 138.0 52 96.5 53 77.5 54 62.5 55 49.0 56 39.0 57 29.5 58 20.5 59 13.5 60 11.0 61 10.0 62 6.5 63 2.0 64 1.0 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.675 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.1875 0.0 0.0 0.0 0.0 98-99 1.4125 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.825 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.75 0.0 0.0 0.0 0.0 110-111 3.1375 0.0 0.0 0.0 0.0 112-113 3.375 0.0 0.0 0.0 0.0 114-115 3.825 0.0 0.0 0.0 0.0 116-117 4.1625 0.0 0.0 0.0 0.0 118-119 4.625 0.0 0.0 0.0 0.0 120-121 5.1875 0.0 0.0 0.0 0.0 122-123 5.8 0.0 0.0 0.0 0.0 124-125 6.3375 0.0 0.0 0.0 0.0 126-127 6.8875 0.0 0.0 0.0 0.0 128-129 7.512499999999999 0.0 0.0 0.0 0.0 130-131 8.1 0.0 0.0 0.0 0.0 132-133 8.7875 0.0 0.0 0.0 0.0 134-135 9.5 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 10.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCACC 30 0.0017991947 72.48125 7 ATTTCAC 40 0.005627093 54.360935 6 >>END_MODULE SRR7170846 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170846_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90675 33.0 33.0 34.0 32.0 34.0 2 32.91175 33.0 33.0 34.0 32.0 34.0 3 33.00775 34.0 33.0 34.0 32.0 34.0 4 32.9785 34.0 33.0 34.0 32.0 34.0 5 33.102 34.0 33.0 34.0 32.0 34.0 6 37.22175 38.0 38.0 38.0 37.0 38.0 7 37.26825 38.0 38.0 38.0 37.0 38.0 8 37.227 38.0 38.0 38.0 37.0 38.0 9 37.1895 38.0 38.0 38.0 37.0 38.0 10-14 37.1661 38.0 38.0 38.0 37.0 38.0 15-19 37.1631 38.0 38.0 38.0 36.8 38.0 20-24 37.0614 38.0 38.0 38.0 36.8 38.0 25-29 37.071600000000004 38.0 38.0 38.0 36.6 38.0 30-34 36.98375 38.0 38.0 38.0 36.2 38.0 35-39 37.00775 38.0 38.0 38.0 36.0 38.0 40-44 36.96175 38.0 38.0 38.0 36.2 38.0 45-49 36.986650000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.915949999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.88115 38.0 38.0 38.0 36.0 38.0 60-64 36.891149999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.75695 38.0 38.0 38.0 35.6 38.0 70-74 36.608549999999994 38.0 38.0 38.0 35.0 38.0 75-79 36.58895 38.0 38.0 38.0 34.8 38.0 80-84 36.48805 38.0 38.0 38.0 34.6 38.0 85-89 36.38615 38.0 38.0 38.0 34.0 38.0 90-94 36.2809 38.0 38.0 38.0 34.0 38.0 95-99 36.01604999999999 38.0 38.0 38.0 32.8 38.0 100-104 35.98825000000001 38.0 37.6 38.0 32.8 38.0 105-109 35.76904999999999 38.0 37.0 38.0 32.2 38.0 110-114 35.577349999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.354749999999996 38.0 36.8 38.0 29.0 38.0 120-124 34.9006 38.0 36.0 38.0 27.2 38.0 125-129 34.4614 38.0 34.6 38.0 25.0 38.0 130-134 33.99515 38.0 33.8 38.0 23.2 38.0 135-139 33.4672 38.0 33.0 38.0 20.6 38.0 140-144 32.787099999999995 38.0 33.0 38.0 15.4 38.0 145-149 31.61975 38.0 32.2 38.0 8.4 38.0 150-151 25.62875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 2.0 5 1.0 6 3.0 7 1.0 8 0.0 9 2.0 10 0.0 11 3.0 12 0.0 13 1.0 14 3.0 15 3.0 16 4.0 17 1.0 18 4.0 19 5.0 20 9.0 21 13.0 22 12.0 23 14.0 24 15.0 25 26.0 26 37.0 27 31.0 28 31.0 29 38.0 30 53.0 31 72.0 32 86.0 33 125.0 34 165.0 35 291.0 36 724.0 37 2217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.699999999999996 18.625 12.675 27.0 2 25.374999999999996 23.95 33.7 16.975 3 20.200000000000003 28.449999999999996 32.025 19.325 4 22.825 35.75 23.275000000000002 18.15 5 24.75 37.0 21.9 16.35 6 19.775000000000002 39.2 23.65 17.375 7 19.125 18.275 41.5 21.099999999999998 8 18.8 25.25 29.825000000000003 26.125 9 22.7 22.925 30.275000000000002 24.099999999999998 10-14 23.325000000000003 28.244999999999997 27.01 21.42 15-19 22.59 28.634999999999998 28.110000000000003 20.665 20-24 22.634999999999998 28.785 28.46 20.119999999999997 25-29 22.805 27.91 28.43 20.855 30-34 22.58 28.01 28.854999999999997 20.555 35-39 22.57 27.91 28.51 21.01 40-44 22.955000000000002 28.310000000000002 28.53 20.205000000000002 45-49 22.365 28.03 28.775000000000002 20.830000000000002 50-54 22.68 28.285 28.52 20.515 55-59 23.18 27.865000000000002 28.33 20.625 60-64 22.88 27.950000000000003 28.71 20.46 65-69 22.875 27.865000000000002 28.32 20.94 70-74 23.185 28.15 28.08 20.585 75-79 23.29 28.115000000000002 28.01 20.585 80-84 23.65 27.76 28.89 19.7 85-89 23.21 27.939999999999998 28.355000000000004 20.495 90-94 23.21 27.92 28.155 20.715 95-99 23.465 27.405 28.43 20.7 100-104 23.48 28.225 27.584999999999997 20.71 105-109 23.375 27.98 28.125 20.52 110-114 24.224999999999998 27.98 27.555000000000003 20.24 115-119 24.455 28.470000000000002 27.334999999999997 19.74 120-124 24.775 27.93 27.744999999999997 19.55 125-129 24.43 28.13 27.615000000000002 19.825 130-134 24.75 27.985 27.48 19.785 135-139 25.490000000000002 27.205000000000002 28.065 19.24 140-144 25.47 27.875 27.705000000000002 18.95 145-149 25.53 28.04 27.365000000000002 19.064999999999998 150-151 26.0375 27.525 27.737499999999997 18.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 2.0 23 3.0 24 5.5 25 5.5 26 4.5 27 8.0 28 13.5 29 14.5 30 18.5 31 24.5 32 27.5 33 42.0 34 56.0 35 77.0 36 96.0 37 115.5 38 149.5 39 191.0 40 214.0 41 231.5 42 251.5 43 260.0 44 274.0 45 285.5 46 274.0 47 226.0 48 196.5 49 188.0 50 160.5 51 121.5 52 96.5 53 91.0 54 70.0 55 49.5 56 43.5 57 34.0 58 24.0 59 14.0 60 10.5 61 8.0 62 6.5 63 6.0 64 3.0 65 2.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31852599697123 98.375 2 0.5552751135790005 1.0999999999999999 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0757193336698637 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.4500000000000002 0.0 0.0 0.0 0.0 100-101 1.7 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.1625 0.0 0.0 0.0 0.0 106-107 2.5125 0.0 0.0 0.0 0.0 108-109 2.8375 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.5250000000000004 0.0 0.0 0.0 0.0 114-115 3.9625 0.0 0.0 0.0 0.0 116-117 4.2875 0.0 0.0 0.0 0.0 118-119 4.7875 0.0 0.0 0.0 0.0 120-121 5.3625 0.0 0.0 0.0 0.0 122-123 5.975 0.0 0.0 0.0 0.0 124-125 6.512499999999999 0.0 0.0 0.0 0.0 126-127 7.0625 0.0 0.0 0.0 0.0 128-129 7.6625 0.0 0.0 0.0 0.0 130-131 8.2625 0.0 0.0 0.0 0.0 132-133 8.9125 0.0 0.0 0.0 0.0 134-135 9.649999999999999 0.0 0.0 0.0 0.0 136-137 10.275 0.0 0.0 0.0 0.0 138-139 10.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGTT 10 0.006830828 145.0 5 >>END_MODULE Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra Read 790673 spots for SRR7170846.sra Written 790673 spots for SRR7170846.sra Read 790672 spots for SRR7170846.sra Written 790672 spots for SRR7170846.sra SRR ids: ['SRR7170846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nz2f2_5b SRR7170846.sra spots: 15813441 blocks: [[1, 790672], [790673, 1581344], [1581345, 2372016], [2372017, 3162688], [3162689, 3953360], [3953361, 4744032], [4744033, 5534704], [5534705, 6325376], [6325377, 7116048], [7116049, 7906720], [7906721, 8697392], [8697393, 9488064], [9488065, 10278736], [10278737, 11069408], [11069409, 11860080], [11860081, 12650752], [12650753, 13441424], [13441425, 14232096], [14232097, 15022768], [15022769, 15813441]] SRR7170846 file size 5336955 SRR7170846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170846 SRR7170846_1.fastq SRR7170846_2.fastq Input file: SRR7170846_1.fastq Paired file: SRR7170846_2.fastq trimmed: SRR7170846-trimmed-pair1.fastq, SRR7170846-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:21:02 2025 >> started Thu Feb 13 19:21:20 2025 >> done (18.059s) 15813441 read pairs processed; of these: 17728 ( 0.11%) short read pairs filtered out after trimming by size control 22512 ( 0.14%) empty read pairs filtered out after trimming by size control 15773201 (99.75%) read pairs available; of these: 11114584 (70.46%) trimmed read pairs available after processing 4658617 (29.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 15 0.00% 20 19 0.00% 21 13 0.00% 22 8 0.00% 23 17 0.00% 24 23 0.00% 25 17 0.00% 26 17 0.00% 27 15 0.00% 28 21 0.00% 29 17 0.00% 30 15 0.00% 31 18 0.00% 32 17 0.00% 33 24 0.00% 34 33 0.00% 35 21 0.00% 36 26 0.00% 37 37 0.00% 38 34 0.00% 39 47 0.00% 40 32 0.00% 41 55 0.00% 42 49 0.00% 43 73 0.00% 44 50 0.00% 45 60 0.00% 46 78 0.00% 47 94 0.00% 48 98 0.00% 49 106 0.00% 50 155 0.00% 51 161 0.00% 52 171 0.00% 53 198 0.00% 54 221 0.00% 55 245 0.00% 56 242 0.00% 57 302 0.00% 58 357 0.00% 59 425 0.00% 60 480 0.00% 61 583 0.00% 62 603 0.00% 63 694 0.00% 64 780 0.00% 65 824 0.01% 66 874 0.01% 67 1083 0.01% 68 1201 0.01% 69 1355 0.01% 70 1650 0.01% 71 1793 0.01% 72 2209 0.01% 73 2403 0.02% 74 2812 0.02% 75 2986 0.02% 76 3540 0.02% 77 3794 0.02% 78 3901 0.02% 79 4430 0.03% 80 4871 0.03% 81 5628 0.04% 82 6264 0.04% 83 7050 0.04% 84 8421 0.05% 85 8686 0.06% 86 9478 0.06% 87 10020 0.06% 88 10766 0.07% 89 11127 0.07% 90 12411 0.08% 91 13497 0.09% 92 14823 0.09% 93 15926 0.10% 94 17183 0.11% 95 18289 0.12% 96 19036 0.12% 97 19826 0.13% 98 20507 0.13% 99 21442 0.14% 100 23130 0.15% 101 24407 0.15% 102 26241 0.17% 103 27759 0.18% 104 29449 0.19% 105 31105 0.20% 106 31830 0.20% 107 32963 0.21% 108 33731 0.21% 109 35319 0.22% 110 36400 0.23% 111 38065 0.24% 112 40109 0.25% 113 42081 0.27% 114 44479 0.28% 115 46006 0.29% 116 46998 0.30% 117 48750 0.31% 118 49989 0.32% 119 51211 0.32% 120 53211 0.34% 121 55805 0.35% 122 57851 0.37% 123 60670 0.38% 124 63974 0.41% 125 67004 0.42% 126 69780 0.44% 127 72387 0.46% 128 75525 0.48% 129 78207 0.50% 130 81183 0.51% 131 85578 0.54% 132 90499 0.57% 133 96818 0.61% 134 102544 0.65% 135 110127 0.70% 136 117904 0.75% 137 126441 0.80% 138 136488 0.87% 139 147679 0.94% 140 159597 1.01% 141 175305 1.11% 142 195682 1.24% 143 222451 1.41% 144 260497 1.65% 145 308594 1.96% 146 380859 2.41% 147 505348 3.20% 148 738581 4.68% 149 1331405 8.44% 150 4049685 25.67% 151 4658617 29.54% 15773201 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=18 prefix-density=0.33 prefix-fanout=2.1 sequence=TTAGCCTTTCTGGT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=30.93 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=11 prefix-density=0.57 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.19 sequence-density-rank=13 fanout-score=11.55 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=6.1 sequence=AAGAAAGCTTACCCTAAC SRR7170846 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:22:04 Started mapping on | Feb 13 19:22:07 Finished on | Feb 13 19:23:46 Mapping speed, Million of reads per hour | 573.57 Number of input reads | 15773201 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14925044 Uniquely mapped reads % | 94.62% Average mapped length | 287.84 Number of splices: Total | 14186513 Number of splices: Annotated (sjdb) | 13809868 Number of splices: GT/AG | 13916861 Number of splices: GC/AG | 204388 Number of splices: AT/AC | 8840 Number of splices: Non-canonical | 56424 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430343 % of reads mapped to multiple loci | 2.73% Number of reads mapped to too many loci | 39047 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.33% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 430307 430307 430307 N_multimapping 430343 430343 430343 N_noFeature 654530 14604939 819366 N_ambiguous 276329 1453 120066 UnstrandedReadsAssigned:13994185 PositiveStrandReadsAssigned:318652 NegativeStrandReadsAssigned:13985612 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=141 echo kmer=137 SRR7170846 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170846-trimmed-pair1.fastq SRR7170846-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,773,201 reads, 13,905,527 reads pseudoaligned [quant] estimated average fragment length: 231.433 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR7170846.ke.tsv 34699 SRR7170846.se.tsv 87100 total ==> SRR7170846.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.57 893 32.3323 Potri.005G024800.1.v4.1 1035 804.567 297 23.8914 Potri.004G059700.1.v4.1 961 730.638 5 0.442909 Potri.007G009000.2.v4.1 1416 1185.57 0 0 Potri.003G141000.2.v4.1 2943 2712.57 1057.41 25.2297 Potri.016G087400.1.v4.1 270 90.3416 951 681.302 Potri.015G069301.1.v4.1 564 340.517 0 0 Potri.010G195200.1.v4.1 1773 1542.57 394.89 16.5683 Potri.012G127500.1.v4.1 977 746.598 64 5.54805 ==> SRR7170846.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 370 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR7170846 completed mapping pipeline successfully