Starting /dee2/code/volunteer_pipeline.sh SRR7170847 current disk space = 3087726321664 free memory = 1445584220 SRR7170847 SRAfilesize d6a6b0785d67c44c6cb7e4524ccb7f19 SRR7170847.sra SRR7170847.sra file validated SRR7170847 is paired end SRR7170847 is conventional basespace SRR7170847 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84925 34.0 33.0 34.0 32.0 34.0 2 33.28475 34.0 33.0 34.0 32.0 34.0 3 33.24175 34.0 33.0 34.0 33.0 34.0 4 33.409 34.0 33.0 34.0 33.0 34.0 5 33.32325 34.0 33.0 34.0 33.0 34.0 6 36.76525 38.0 37.0 38.0 35.0 38.0 7 37.16825 38.0 38.0 38.0 36.0 38.0 8 37.35675 38.0 38.0 38.0 37.0 38.0 9 37.42825 38.0 38.0 38.0 37.0 38.0 10-14 37.4676 38.0 38.0 38.0 37.0 38.0 15-19 37.3606 38.0 38.0 38.0 37.0 38.0 20-24 37.357299999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.2896 38.0 38.0 38.0 37.0 38.0 30-34 37.254 38.0 38.0 38.0 36.4 38.0 35-39 37.18044999999999 38.0 38.0 38.0 36.2 38.0 40-44 37.03795 38.0 38.0 38.0 36.0 38.0 45-49 36.9842 38.0 38.0 38.0 36.0 38.0 50-54 36.80555 38.0 38.0 38.0 35.0 38.0 55-59 36.77885 38.0 38.0 38.0 34.8 38.0 60-64 36.680949999999996 38.0 38.0 38.0 34.6 38.0 65-69 36.58434999999999 38.0 38.0 38.0 34.2 38.0 70-74 36.54925 38.0 38.0 38.0 34.2 38.0 75-79 36.3951 38.0 38.0 38.0 33.8 38.0 80-84 36.3084 38.0 37.8 38.0 34.0 38.0 85-89 36.028000000000006 38.0 37.0 38.0 32.8 38.0 90-94 35.87205 38.0 37.0 38.0 31.4 38.0 95-99 35.755700000000004 38.0 37.0 38.0 31.0 38.0 100-104 35.107549999999996 38.0 36.2 38.0 27.8 38.0 105-109 35.004149999999996 38.0 35.8 38.0 27.8 38.0 110-114 34.730149999999995 38.0 34.6 38.0 26.0 38.0 115-119 34.3764 38.0 34.2 38.0 25.0 38.0 120-124 33.6996 38.0 33.2 38.0 22.0 38.0 125-129 32.9014 38.0 32.8 38.0 16.0 38.0 130-134 32.29365 38.0 31.4 38.0 13.8 38.0 135-139 31.1264 36.2 28.8 38.0 13.0 38.0 140-144 31.08455 36.6 29.2 38.0 12.4 38.0 145-149 29.48645 36.0 27.6 38.0 3.8 38.0 150-151 22.645249999999997 28.5 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 1.0 13 1.0 14 2.0 15 1.0 16 1.0 17 5.0 18 4.0 19 9.0 20 8.0 21 18.0 22 17.0 23 14.0 24 20.0 25 29.0 26 38.0 27 31.0 28 47.0 29 63.0 30 75.0 31 102.0 32 121.0 33 156.0 34 309.0 35 497.0 36 1058.0 37 1368.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.57157386219171 16.755657259089755 8.339689804220697 30.33307907449784 2 20.825 20.325 36.425000000000004 22.425 3 17.333666833416707 27.388694347173587 29.71485742871436 25.56278139069535 4 22.425 32.675 24.425 20.474999999999998 5 22.1 36.525 24.05 17.325 6 17.474999999999998 35.9 25.624999999999996 21.0 7 13.475000000000001 23.825 43.75 18.95 8 18.3 23.5 30.325000000000003 27.875 9 16.875 22.8 33.125 27.200000000000003 10-14 19.755 29.67 26.419999999999998 24.154999999999998 15-19 20.035 29.17 27.750000000000004 23.044999999999998 20-24 19.72 29.195 27.334999999999997 23.75 25-29 19.86 29.354999999999997 27.639999999999997 23.145 30-34 19.585 29.054999999999996 27.42 23.94 35-39 19.925 28.835 28.03 23.21 40-44 19.71 29.075 27.41 23.805 45-49 19.925 28.625 27.450000000000003 24.0 50-54 19.93 29.775000000000002 26.950000000000003 23.345 55-59 19.43 28.88 28.105000000000004 23.585 60-64 20.05 28.084999999999997 27.85 24.015 65-69 20.015 28.83 27.605 23.549999999999997 70-74 19.939999999999998 29.12 27.200000000000003 23.74 75-79 20.285 28.985 27.565 23.165 80-84 19.89 28.565 28.17 23.375 85-89 20.265 28.349999999999998 27.49 23.895 90-94 20.755000000000003 28.875 27.029999999999998 23.34 95-99 20.25 28.99 27.200000000000003 23.56 100-104 20.580000000000002 28.685 27.755000000000003 22.98 105-109 20.46 28.915000000000003 26.93 23.695 110-114 20.61 28.535 27.445000000000004 23.41 115-119 20.674999999999997 28.610000000000003 26.96 23.755000000000003 120-124 20.630000000000003 28.705000000000002 26.945000000000004 23.72 125-129 20.655 28.33 26.950000000000003 24.065 130-134 20.825 28.645 26.655 23.875 135-139 20.71 28.595 26.479999999999997 24.215 140-144 20.915 28.720000000000002 26.905 23.46 145-149 21.13 28.499999999999996 26.25 24.12 150-151 19.425 28.1875 27.224999999999998 25.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.0 21 2.0 22 1.5 23 1.5 24 3.0 25 4.0 26 6.0 27 7.0 28 8.5 29 17.5 30 24.0 31 28.5 32 43.0 33 56.0 34 66.5 35 85.0 36 107.0 37 121.5 38 146.5 39 174.5 40 192.5 41 205.5 42 235.0 43 259.0 44 266.0 45 255.5 46 232.5 47 231.0 48 214.5 49 186.0 50 157.5 51 136.0 52 124.5 53 101.0 54 77.5 55 56.5 56 36.0 57 34.5 58 28.0 59 20.5 60 16.0 61 6.0 62 6.5 63 4.5 64 2.0 65 2.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.675 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5291005291005291 1.05 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGAATTCGTATCTCGTAT 5 0.125 TruSeq Adapter, Index 7 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6124999999999998 0.0 0.0 0.0 0.0 102-103 1.7999999999999998 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.3375000000000004 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.3625 0.0 0.0 0.0 0.0 112-113 3.825 0.0 0.0 0.0 0.0 114-115 4.387499999999999 0.0 0.0 0.0 0.0 116-117 4.85 0.0 0.0 0.0 0.0 118-119 5.4 0.0 0.0 0.0 0.0 120-121 5.675 0.0 0.0 0.0 0.0 122-123 6.2375 0.0 0.0 0.0 0.0 124-125 6.8375 0.0 0.0 0.0 0.0 126-127 7.5375 0.0 0.0 0.0 0.0 128-129 8.1875 0.0 0.0 0.0 0.0 130-131 8.6875 0.0 0.0 0.0 0.0 132-133 9.5125 0.0 0.0 0.0 0.0 134-135 10.35 0.0 0.0 0.0 0.0 136-137 11.175 0.0 0.0 0.0 0.0 138-139 12.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170847 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170847_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00325 33.0 33.0 34.0 32.0 34.0 2 33.054 34.0 33.0 34.0 32.0 34.0 3 33.0805 34.0 33.0 34.0 32.0 34.0 4 33.03575 34.0 33.0 34.0 32.0 34.0 5 32.993 34.0 33.0 34.0 32.0 34.0 6 37.15725 38.0 38.0 38.0 37.0 38.0 7 37.235 38.0 38.0 38.0 37.0 38.0 8 37.2345 38.0 38.0 38.0 37.0 38.0 9 37.2535 38.0 38.0 38.0 37.0 38.0 10-14 37.243849999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.19005 38.0 38.0 38.0 37.0 38.0 20-24 37.171949999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.08605 38.0 38.0 38.0 36.8 38.0 30-34 37.07445 38.0 38.0 38.0 36.8 38.0 35-39 37.0294 38.0 38.0 38.0 36.4 38.0 40-44 37.07615 38.0 38.0 38.0 36.6 38.0 45-49 37.02545 38.0 38.0 38.0 36.4 38.0 50-54 36.9823 38.0 38.0 38.0 36.0 38.0 55-59 36.9205 38.0 38.0 38.0 36.0 38.0 60-64 36.87155 38.0 38.0 38.0 36.0 38.0 65-69 36.82285 38.0 38.0 38.0 35.6 38.0 70-74 36.80155 38.0 38.0 38.0 35.8 38.0 75-79 36.704299999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.4786 38.0 38.0 38.0 34.2 38.0 85-89 36.40260000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.3359 38.0 38.0 38.0 33.8 38.0 95-99 36.23855 38.0 38.0 38.0 34.0 38.0 100-104 36.0948 38.0 37.6 38.0 33.6 38.0 105-109 35.9847 38.0 37.2 38.0 33.0 38.0 110-114 35.76125 38.0 37.0 38.0 31.6 38.0 115-119 35.424099999999996 38.0 36.6 38.0 30.0 38.0 120-124 35.0182 38.0 36.0 38.0 28.4 38.0 125-129 34.58540000000001 38.0 34.8 38.0 26.4 38.0 130-134 33.86055 38.0 33.4 38.0 23.0 38.0 135-139 33.274950000000004 38.0 33.0 38.0 19.6 38.0 140-144 32.248000000000005 38.0 32.6 38.0 13.2 38.0 145-149 30.875 38.0 30.6 38.0 5.8 38.0 150-151 24.9165 31.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 0.0 13 2.0 14 2.0 15 2.0 16 6.0 17 1.0 18 5.0 19 9.0 20 12.0 21 7.0 22 12.0 23 15.0 24 13.0 25 21.0 26 29.0 27 29.0 28 33.0 29 35.0 30 60.0 31 61.0 32 84.0 33 127.0 34 178.0 35 322.0 36 803.0 37 2116.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.05 19.525000000000002 10.35 23.075000000000003 2 24.2 24.975 33.875 16.950000000000003 3 21.55 27.275 33.074999999999996 18.099999999999998 4 24.675 35.575 22.05 17.7 5 24.625 37.1 22.025 16.25 6 19.80495123780945 37.28432108027007 24.281070267566893 18.629657414353588 7 19.80495123780945 20.10502625656414 40.76019004751188 19.32983245811453 8 20.575 24.474999999999998 29.15 25.8 9 21.95 23.674999999999997 30.5 23.875 10-14 23.96218865659698 29.05371611483445 26.357907372211663 20.626187856356907 15-19 23.37051673252964 27.952578660397176 27.882547146215796 20.794357460857384 20-24 23.491745872936466 28.559279639819913 27.648824412206103 20.300150075037518 25-29 23.441720860430216 28.594297148574288 27.698849424712357 20.265132566283143 30-34 23.2216108054027 28.189094547273637 28.209104552276138 20.380190095047524 35-39 22.821410705352676 27.843921960980488 28.69434717358679 20.640320160080037 40-44 23.131565782891446 28.039019509754876 28.534267133566782 20.295147573786892 45-49 23.83191595797899 27.253626813406704 28.534267133566782 20.380190095047524 50-54 22.826413206603302 28.4392196098049 28.204102051025515 20.530265132566285 55-59 23.506753376688344 28.16408204102051 27.6288144072036 20.700350175087546 60-64 23.34667333666833 27.988994497248626 27.55377688844422 21.11055527763882 65-69 23.47673836918459 27.843921960980488 28.574287143571787 20.10505252626313 70-74 23.34667333666833 27.658829414707352 27.51375687843922 21.480740370185092 75-79 23.291645822911455 27.70385192596298 27.978989494747374 21.02551275637819 80-84 23.806903451725862 27.753876938469237 27.593796898449224 20.845422711355678 85-89 23.2016008004002 27.733866933466732 28.3791895947974 20.68534267133567 90-94 24.33216608304152 27.598799399699853 27.978989494747374 20.090045022511255 95-99 24.24712356178089 27.94897448724362 27.6288144072036 20.175087543771888 100-104 23.41670835417709 28.134067033516757 27.813906953476735 20.635317658829415 105-109 23.556778389194598 27.80390195097549 28.46423211605803 20.175087543771888 110-114 24.132066033016507 27.883941970985493 27.688844422211105 20.295147573786892 115-119 24.37718859429715 28.30915457728864 27.538769384692348 19.774887443721862 120-124 24.497248624312157 27.6288144072036 27.123561780890444 20.750375187593797 125-129 25.072536268134066 27.70885442721361 27.34367183591796 19.874937468734366 130-134 25.842921460730366 27.818909454727365 27.148574287143575 19.189594797398698 135-139 25.957978989494745 27.793896948474238 26.898449224612307 19.34967483741871 140-144 26.120672403442065 28.291975185111067 26.340804482689613 19.246547928757256 145-149 26.68334167083542 27.788894447223612 26.513256628314156 19.014507253626814 150-151 27.263631815907953 28.376688344172084 26.550775387693847 17.808904452226113 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 1.5 22 2.0 23 4.5 24 4.0 25 3.5 26 8.0 27 8.0 28 5.0 29 7.5 30 13.5 31 24.0 32 34.0 33 42.5 34 52.5 35 64.0 36 84.0 37 100.5 38 118.0 39 138.5 40 181.0 41 220.5 42 244.5 43 276.0 44 293.5 45 291.5 46 276.5 47 253.0 48 233.0 49 206.5 50 177.5 51 144.5 52 107.0 53 90.0 54 81.5 55 63.5 56 43.5 57 28.5 58 19.5 59 18.5 60 10.0 61 4.5 62 4.5 63 4.0 64 2.5 65 1.0 66 0.5 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.025 8 0.0 9 0.0 10-14 0.03 15-19 0.045 20-24 0.05 25-29 0.05 30-34 0.05 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.05 140-144 0.06 145-149 0.05 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0628166160081 97.775 2 0.7598784194528876 1.5 3 0.07598784194528875 0.22499999999999998 4 0.025329280648429587 0.1 5 0.050658561296859174 0.25 6 0.025329280648429587 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.2 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6375000000000002 0.0 0.0 0.0 0.0 102-103 1.8250000000000002 0.0 0.0 0.0 0.0 104-105 2.0999999999999996 0.0 0.0 0.0 0.0 106-107 2.325 0.0 0.0 0.0 0.0 108-109 2.9 0.0 0.0 0.0 0.0 110-111 3.2750000000000004 0.0 0.0 0.0 0.0 112-113 3.725 0.0 0.0 0.0 0.0 114-115 4.262499999999999 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 5.2875 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.1375 0.0 0.0 0.0 0.0 124-125 6.7875 0.0 0.0 0.0 0.0 126-127 7.475 0.0 0.0 0.0 0.0 128-129 8.1375 0.0 0.0 0.0 0.0 130-131 8.675 0.0 0.0 0.0 0.0 132-133 9.5125 0.0 0.0 0.0 0.0 134-135 10.3875 0.0 0.0 0.0 0.0 136-137 11.225000000000001 0.0 0.0 0.0 0.0 138-139 12.037500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra Read 641717 spots for SRR7170847.sra Written 641717 spots for SRR7170847.sra Read 641707 spots for SRR7170847.sra Written 641707 spots for SRR7170847.sra SRR ids: ['SRR7170847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rrfvjqry SRR7170847.sra spots: 12834150 blocks: [[1, 641707], [641708, 1283414], [1283415, 1925121], [1925122, 2566828], [2566829, 3208535], [3208536, 3850242], [3850243, 4491949], [4491950, 5133656], [5133657, 5775363], [5775364, 6417070], [6417071, 7058777], [7058778, 7700484], [7700485, 8342191], [8342192, 8983898], [8983899, 9625605], [9625606, 10267312], [10267313, 10909019], [10909020, 11550726], [11550727, 12192433], [12192434, 12834150]] SRR7170847 file size 4327371 SRR7170847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170847 SRR7170847_1.fastq SRR7170847_2.fastq Input file: SRR7170847_1.fastq Paired file: SRR7170847_2.fastq trimmed: SRR7170847-trimmed-pair1.fastq, SRR7170847-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 18:47:48 2025 >> started Thu Feb 13 18:48:08 2025 >> done (20.482s) 12834150 read pairs processed; of these: 16120 ( 0.13%) short read pairs filtered out after trimming by size control 42903 ( 0.33%) empty read pairs filtered out after trimming by size control 12775127 (99.54%) read pairs available; of these: 8882782 (69.53%) trimmed read pairs available after processing 3892345 (30.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 9 0.00% 20 12 0.00% 21 8 0.00% 22 15 0.00% 23 13 0.00% 24 32 0.00% 25 17 0.00% 26 33 0.00% 27 21 0.00% 28 26 0.00% 29 23 0.00% 30 28 0.00% 31 39 0.00% 32 24 0.00% 33 40 0.00% 34 35 0.00% 35 30 0.00% 36 37 0.00% 37 47 0.00% 38 51 0.00% 39 60 0.00% 40 57 0.00% 41 73 0.00% 42 67 0.00% 43 61 0.00% 44 77 0.00% 45 78 0.00% 46 85 0.00% 47 113 0.00% 48 150 0.00% 49 145 0.00% 50 157 0.00% 51 204 0.00% 52 240 0.00% 53 249 0.00% 54 255 0.00% 55 261 0.00% 56 293 0.00% 57 390 0.00% 58 416 0.00% 59 430 0.00% 60 569 0.00% 61 664 0.01% 62 708 0.01% 63 825 0.01% 64 869 0.01% 65 948 0.01% 66 1049 0.01% 67 1120 0.01% 68 1226 0.01% 69 1417 0.01% 70 1638 0.01% 71 1984 0.02% 72 2292 0.02% 73 2604 0.02% 74 2842 0.02% 75 3219 0.03% 76 4323 0.03% 77 3967 0.03% 78 3788 0.03% 79 4304 0.03% 80 4828 0.04% 81 5440 0.04% 82 6541 0.05% 83 7599 0.06% 84 8848 0.07% 85 9128 0.07% 86 9749 0.08% 87 10223 0.08% 88 10498 0.08% 89 11089 0.09% 90 12222 0.10% 91 13271 0.10% 92 14820 0.12% 93 16313 0.13% 94 17960 0.14% 95 18597 0.15% 96 18935 0.15% 97 19752 0.15% 98 19988 0.16% 99 20563 0.16% 100 22187 0.17% 101 23236 0.18% 102 25525 0.20% 103 27252 0.21% 104 28997 0.23% 105 30512 0.24% 106 31035 0.24% 107 31532 0.25% 108 32083 0.25% 109 32870 0.26% 110 33946 0.27% 111 35624 0.28% 112 37475 0.29% 113 39738 0.31% 114 41799 0.33% 115 44174 0.35% 116 44987 0.35% 117 45898 0.36% 118 45917 0.36% 119 46711 0.37% 120 47988 0.38% 121 49789 0.39% 122 51371 0.40% 123 54485 0.43% 124 58264 0.46% 125 59998 0.47% 126 62909 0.49% 127 64471 0.50% 128 65240 0.51% 129 67249 0.53% 130 69550 0.54% 131 72265 0.57% 132 75546 0.59% 133 80618 0.63% 134 85903 0.67% 135 91665 0.72% 136 96238 0.75% 137 102042 0.80% 138 107297 0.84% 139 113593 0.89% 140 121718 0.95% 141 131104 1.03% 142 145722 1.14% 143 164577 1.29% 144 190065 1.49% 145 226321 1.77% 146 279883 2.19% 147 370334 2.90% 148 545813 4.27% 149 1006798 7.88% 150 3221334 25.22% 151 3892345 30.47% 12775127 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=2.1 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=25 fanout-score=18.23 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=5.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=1.01 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=7.81 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATAC SRR7170847 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 18:48:55 Started mapping on | Feb 13 18:48:55 Finished on | Feb 13 18:50:12 Mapping speed, Million of reads per hour | 597.28 Number of input reads | 12775127 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 12156402 Uniquely mapped reads % | 95.16% Average mapped length | 286.62 Number of splices: Total | 10966299 Number of splices: Annotated (sjdb) | 10710180 Number of splices: GT/AG | 10758577 Number of splices: GC/AG | 162181 Number of splices: AT/AC | 6977 Number of splices: Non-canonical | 38564 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311186 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 25935 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.15% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 321828 321828 321828 N_multimapping 311186 311186 311186 N_noFeature 473399 11874784 606708 N_ambiguous 225750 1018 76839 UnstrandedReadsAssigned:11457253 PositiveStrandReadsAssigned:280600 NegativeStrandReadsAssigned:11472855 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7170847 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170847-trimmed-pair1.fastq SRR7170847-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,775,127 reads, 11,410,462 reads pseudoaligned [quant] estimated average fragment length: 221.688 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,030 rounds 52401 SRR7170847.ke.tsv 34699 SRR7170847.se.tsv 87100 total ==> SRR7170847.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.31 514 20.9982 Potri.005G024800.1.v4.1 1035 814.312 316 28.4931 Potri.004G059700.1.v4.1 961 740.331 8 0.793427 Potri.007G009000.2.v4.1 1416 1195.31 0 0 Potri.003G141000.2.v4.1 2943 2722.31 782 21.0917 Potri.016G087400.1.v4.1 270 94.0794 666.369 520.072 Potri.015G069301.1.v4.1 564 347.977 0 0 Potri.010G195200.1.v4.1 1773 1552.31 87 4.11513 Potri.012G127500.1.v4.1 977 756.326 320 31.0659 ==> SRR7170847.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 594 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 274 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 65 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR7170847 completed mapping pipeline successfully