Starting /dee2/code/volunteer_pipeline.sh SRR7170848 current disk space = 3087323521024 free memory = 1540825936 SRR7170848 SRAfilesize af1e2bb93696320cca3ae671772b14d6 SRR7170848.sra SRR7170848.sra file validated SRR7170848 is paired end SRR7170848 is conventional basespace SRR7170848 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.96975 34.0 33.0 34.0 32.0 34.0 2 33.2405 34.0 33.0 34.0 32.0 34.0 3 33.20325 34.0 33.0 34.0 31.0 34.0 4 33.197 34.0 33.0 34.0 33.0 34.0 5 33.2305 34.0 33.0 34.0 33.0 34.0 6 36.68475 38.0 37.0 38.0 34.0 38.0 7 37.03075 38.0 38.0 38.0 36.0 38.0 8 37.1565 38.0 38.0 38.0 36.0 38.0 9 37.29325 38.0 38.0 38.0 37.0 38.0 10-14 37.275850000000005 38.0 38.0 38.0 36.6 38.0 15-19 37.20205 38.0 38.0 38.0 36.2 38.0 20-24 37.116200000000006 38.0 38.0 38.0 36.0 38.0 25-29 37.1395 38.0 38.0 38.0 36.0 38.0 30-34 37.05265000000001 38.0 38.0 38.0 36.0 38.0 35-39 37.0223 38.0 38.0 38.0 36.0 38.0 40-44 36.9489 38.0 38.0 38.0 35.8 38.0 45-49 36.81245 38.0 38.0 38.0 35.0 38.0 50-54 36.6719 38.0 38.0 38.0 34.2 38.0 55-59 36.60055 38.0 38.0 38.0 34.0 38.0 60-64 36.6155 38.0 38.0 38.0 34.0 38.0 65-69 36.485499999999995 38.0 38.0 38.0 34.0 38.0 70-74 36.366550000000004 38.0 37.4 38.0 34.0 38.0 75-79 36.282 38.0 37.0 38.0 33.6 38.0 80-84 36.133500000000005 38.0 37.0 38.0 32.6 38.0 85-89 35.993849999999995 38.0 37.0 38.0 32.6 38.0 90-94 35.7702 38.0 37.0 38.0 31.0 38.0 95-99 35.6435 38.0 36.6 38.0 30.6 38.0 100-104 35.4779 38.0 36.0 38.0 29.6 38.0 105-109 35.11874999999999 38.0 35.8 38.0 28.4 38.0 110-114 34.7856 38.0 35.0 38.0 26.8 38.0 115-119 34.361450000000005 38.0 34.4 38.0 24.2 38.0 120-124 33.935199999999995 38.0 33.2 38.0 22.4 38.0 125-129 33.53815 38.0 33.0 38.0 21.0 38.0 130-134 33.02 38.0 32.6 38.0 18.2 38.0 135-139 32.107600000000005 37.2 30.8 38.0 14.0 38.0 140-144 31.056150000000002 36.2 28.4 38.0 13.0 38.0 145-149 29.884249999999998 36.0 27.6 38.0 5.8 38.0 150-151 23.301125 30.0 7.5 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 0.0 14 2.0 15 3.0 16 3.0 17 2.0 18 4.0 19 7.0 20 7.0 21 10.0 22 13.0 23 16.0 24 18.0 25 22.0 26 33.0 27 40.0 28 52.0 29 55.0 30 68.0 31 101.0 32 148.0 33 180.0 34 291.0 35 543.0 36 1033.0 37 1344.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.510209226115453 11.49483236702798 18.704310562137636 41.29064784471893 2 21.375 17.375 34.975 26.275 3 20.5 24.349999999999998 26.8 28.349999999999998 4 21.475 33.425 22.375 22.725 5 21.224999999999998 34.475 25.575 18.725 6 18.45 34.275 27.200000000000003 20.075000000000003 7 14.2 21.349999999999998 44.675 19.775000000000002 8 19.525000000000002 22.925 28.549999999999997 28.999999999999996 9 16.25 24.55 35.525 23.674999999999997 10-14 19.7 29.975 26.88 23.445 15-19 19.36 28.185 28.645 23.810000000000002 20-24 19.335 28.915000000000003 28.08 23.669999999999998 25-29 19.134999999999998 28.67 28.23 23.965 30-34 19.5 29.095 27.715 23.69 35-39 19.655 29.225 28.005000000000003 23.115 40-44 19.52 29.310000000000002 27.415 23.755000000000003 45-49 19.45 29.110000000000003 27.810000000000002 23.630000000000003 50-54 19.845 28.675 27.595 23.885 55-59 20.16 28.12 28.275 23.445 60-64 19.77 29.115000000000002 27.560000000000002 23.555 65-69 19.945 28.685 27.55 23.82 70-74 19.45 28.865000000000002 28.42 23.265 75-79 19.615 29.285 27.400000000000002 23.7 80-84 20.145 28.615000000000002 27.485 23.755000000000003 85-89 19.900000000000002 28.87 27.865000000000002 23.365 90-94 19.595000000000002 28.845 27.62 23.94 95-99 19.919999999999998 28.845 27.889999999999997 23.345 100-104 20.19 28.4 28.175 23.235 105-109 20.285 28.625 27.505000000000003 23.585 110-114 20.62 28.48 27.810000000000002 23.09 115-119 20.74 28.199999999999996 27.91 23.150000000000002 120-124 20.235 28.875 27.32 23.57 125-129 20.65 28.815 27.575 22.96 130-134 20.455000000000002 28.615000000000002 27.495000000000005 23.435 135-139 20.335 28.804999999999996 27.794999999999998 23.064999999999998 140-144 20.54 28.42 27.534999999999997 23.505000000000003 145-149 20.335 28.33 27.384999999999998 23.95 150-151 20.1125 28.6875 27.500000000000004 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.5 21 1.0 22 2.0 23 2.0 24 1.5 25 5.0 26 9.5 27 11.5 28 12.0 29 12.0 30 20.5 31 36.0 32 44.5 33 48.0 34 63.0 35 90.0 36 112.5 37 131.0 38 147.5 39 168.5 40 191.0 41 212.5 42 233.0 43 249.0 44 259.5 45 268.0 46 265.0 47 240.0 48 225.5 49 197.5 50 161.5 51 140.0 52 109.0 53 81.0 54 61.0 55 47.5 56 34.5 57 25.0 58 20.5 59 13.0 60 9.5 61 9.5 62 7.0 63 3.0 64 2.0 65 3.5 66 3.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34459289135367 98.52499999999999 2 0.5545752457776657 1.0999999999999999 3 0.050415931434333254 0.15 4 0.025207965717166627 0.1 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGCGAAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0125 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.037500000000000006 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.05 0.0 0.0 0.025 0.0 92-93 0.075 0.0 0.0 0.025 0.0 94-95 0.075 0.0 0.0 0.025 0.0 96-97 0.1125 0.0 0.0 0.025 0.0 98-99 0.15 0.0 0.0 0.025 0.0 100-101 0.15 0.0 0.0 0.025 0.0 102-103 0.15 0.0 0.0 0.025 0.0 104-105 0.16249999999999998 0.0 0.0 0.025 0.0 106-107 0.175 0.0 0.0 0.025 0.0 108-109 0.225 0.0 0.0 0.025 0.0 110-111 0.3 0.0 0.0 0.025 0.0 112-113 0.35 0.0 0.0 0.025 0.0 114-115 0.35 0.0 0.0 0.025 0.0 116-117 0.475 0.0 0.0 0.025 0.0 118-119 0.5875 0.0 0.0 0.025 0.0 120-121 0.65 0.0 0.0 0.025 0.0 122-123 0.675 0.0 0.0 0.025 0.0 124-125 0.75 0.0 0.0 0.025 0.0 126-127 0.8375 0.0 0.0 0.025 0.0 128-129 0.95 0.0 0.0 0.025 0.0 130-131 1.1 0.0 0.0 0.025 0.0 132-133 1.2125 0.0 0.0 0.025 0.0 134-135 1.2875 0.0 0.0 0.025 0.0 136-137 1.3625 0.0 0.0 0.025 0.0 138-139 1.4500000000000002 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170848 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170848_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.621 33.0 33.0 34.0 32.0 34.0 2 32.78275 33.0 33.0 34.0 32.0 34.0 3 32.8585 34.0 33.0 34.0 32.0 34.0 4 32.793 34.0 33.0 34.0 32.0 34.0 5 32.8655 34.0 33.0 34.0 32.0 34.0 6 36.97025 38.0 38.0 38.0 36.0 38.0 7 37.064 38.0 38.0 38.0 36.0 38.0 8 36.94075 38.0 38.0 38.0 36.0 38.0 9 37.102 38.0 38.0 38.0 36.0 38.0 10-14 36.939949999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.901300000000006 38.0 38.0 38.0 36.0 38.0 20-24 36.83845 38.0 38.0 38.0 36.0 38.0 25-29 36.79365 38.0 38.0 38.0 35.8 38.0 30-34 36.736599999999996 38.0 38.0 38.0 35.6 38.0 35-39 36.6922 38.0 38.0 38.0 35.2 38.0 40-44 36.7583 38.0 38.0 38.0 36.0 38.0 45-49 36.688300000000005 38.0 38.0 38.0 35.0 38.0 50-54 36.668 38.0 38.0 38.0 35.0 38.0 55-59 36.56849999999999 38.0 38.0 38.0 34.4 38.0 60-64 36.4855 38.0 38.0 38.0 34.0 38.0 65-69 36.411950000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.3874 38.0 38.0 38.0 34.0 38.0 75-79 36.199850000000005 38.0 38.0 38.0 33.8 38.0 80-84 36.0993 38.0 38.0 38.0 33.6 38.0 85-89 35.936350000000004 38.0 37.4 38.0 33.0 38.0 90-94 35.732200000000006 38.0 37.0 38.0 30.6 38.0 95-99 35.76225000000001 38.0 37.0 38.0 31.8 38.0 100-104 35.46810000000001 38.0 36.8 38.0 29.8 38.0 105-109 35.2749 38.0 37.0 38.0 28.8 38.0 110-114 35.144549999999995 38.0 36.0 38.0 28.4 38.0 115-119 34.802499999999995 38.0 36.0 38.0 27.0 38.0 120-124 34.5235 38.0 35.4 38.0 25.2 38.0 125-129 34.123900000000006 38.0 34.8 38.0 23.4 38.0 130-134 33.55475 38.0 33.4 38.0 20.2 38.0 135-139 32.778749999999995 38.0 33.0 38.0 15.6 38.0 140-144 32.095299999999995 38.0 32.2 38.0 12.8 38.0 145-149 30.762999999999998 38.0 30.4 38.0 4.0 38.0 150-151 25.585375 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 6.0 4 1.0 5 1.0 6 1.0 7 2.0 8 3.0 9 1.0 10 1.0 11 1.0 12 3.0 13 5.0 14 4.0 15 8.0 16 8.0 17 5.0 18 6.0 19 8.0 20 13.0 21 17.0 22 15.0 23 22.0 24 21.0 25 31.0 26 30.0 27 24.0 28 61.0 29 54.0 30 63.0 31 53.0 32 95.0 33 135.0 34 193.0 35 339.0 36 738.0 37 2029.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.325 15.4 27.0 30.275000000000002 2 26.531632908227053 22.13053263315829 33.25831457864466 18.079519879969993 3 20.43010752688172 26.25656414103526 31.207801950487625 22.1055263815954 4 23.53088272068017 33.30832708177044 23.905976494123532 19.254813703425857 5 24.131032758189548 34.28357089272318 23.50587646911728 18.079519879969993 6 18.504626156539132 36.809202300575144 24.706176544136035 19.979994998749685 7 18.3295823955989 17.22930732683171 44.28607151787947 20.155038759689923 8 21.75543885971493 23.830957739434858 27.131782945736433 27.28182045511378 9 21.930482620655166 25.10627656914228 29.307326831707925 23.655913978494624 10-14 22.20555138784696 28.272068017004255 27.251812953238307 22.27056764191048 15-19 21.639327865573115 27.850570114022805 29.265853170634127 21.244248849769953 20-24 21.810452613153288 28.55213803450863 28.75218804701175 20.885221305326333 25-29 22.003801520608242 28.546418567426972 28.53641456582633 20.913365346138455 30-34 21.743697478991596 28.13625450180072 29.13165266106443 20.988395358143258 35-39 21.79589794897449 28.114057028514257 28.729364682341167 21.360680340170084 40-44 22.391195597798898 27.70885442721361 28.999499749874936 20.900450225112557 45-49 21.975987993997 28.224112056028016 28.139069534767387 21.660830415207606 50-54 22.446223111555778 28.129064532266135 28.289144572286144 21.135567783891947 55-59 23.081540770385192 27.32366183091546 28.844422211105552 20.750375187593797 60-64 23.001500750375186 27.983991995997997 27.94897448724362 21.065532766383193 65-69 22.456228114057026 27.208604302151073 28.574287143571787 21.76088044022011 70-74 22.34617308654327 28.289144572286144 28.264132066033014 21.100550275137568 75-79 22.771385692846422 27.953976988494244 28.194097048524263 21.080540270135067 80-84 22.491245622811405 28.119059529764883 28.149074537268636 21.24062031015508 85-89 22.726363181590795 28.159079539769884 27.91895947973987 21.19559779889945 90-94 22.736368184092047 28.224112056028016 27.893946973486745 21.145572786393195 95-99 22.0360180090045 28.854427213606805 28.179089544772385 20.930465232616307 100-104 22.63631815907954 28.119059529764883 28.279139569784896 20.965482741370685 105-109 22.716358179089543 28.25912956478239 28.139069534767387 20.885442721360683 110-114 23.141570785392695 28.039019509754876 28.044022011005502 20.775387693846923 115-119 23.47173586793397 28.569284642321165 27.668834417208604 20.290145072536266 120-124 22.836418209104554 27.938969484742373 28.3791895947974 20.845422711355678 125-129 22.7663831915958 28.289144572286144 27.958979489744873 20.985492746373186 130-134 22.84142071035518 28.0040020010005 28.534267133566782 20.62031015507754 135-139 22.746373186593296 28.204102051025515 27.85892946473237 21.190595297648823 140-144 23.36168084042021 28.52426213106553 27.893946973486745 20.22011005502751 145-149 23.599439775910362 28.26130452180872 27.796118447378955 20.34313725490196 150-151 23.261630815407706 27.5887943971986 28.51425712856428 20.635317658829415 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 2.0 22 2.5 23 3.5 24 2.5 25 2.5 26 10.0 27 13.5 28 16.0 29 25.5 30 24.5 31 24.5 32 40.0 33 52.5 34 61.5 35 80.0 36 95.5 37 114.0 38 149.5 39 181.5 40 195.0 41 211.0 42 229.0 43 264.0 44 279.0 45 260.0 46 257.5 47 233.0 48 202.5 49 189.0 50 157.5 51 124.5 52 103.5 53 83.5 54 71.5 55 63.5 56 43.5 57 29.0 58 24.0 59 18.5 60 12.5 61 10.5 62 10.0 63 7.0 64 6.0 65 3.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.02 20-24 0.025 25-29 0.04 30-34 0.04 35-39 0.05 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.05 70-74 0.05 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.05 140-144 0.05 145-149 0.04 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26786165109822 98.3 2 0.5806614491290077 1.15 3 0.07573844988639232 0.22499999999999998 4 0.050492299924261554 0.2 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5875 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.675 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0750000000000002 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.275 0.0 0.0 0.0 0.0 136-137 1.3625 0.0 0.0 0.0 0.0 138-139 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATGT 10 0.006830828 145.0 3 AAAATCA 10 0.006830828 145.0 2 CTTTGCA 10 0.006830828 145.0 2 AAATGTC 10 0.006830828 145.0 4 >>END_MODULE Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688048 spots for SRR7170848.sra Written 688048 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra Read 688029 spots for SRR7170848.sra Written 688029 spots for SRR7170848.sra SRR ids: ['SRR7170848.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1lhu5ocj SRR7170848.sra spots: 13760599 blocks: [[1, 688029], [688030, 1376058], [1376059, 2064087], [2064088, 2752116], [2752117, 3440145], [3440146, 4128174], [4128175, 4816203], [4816204, 5504232], [5504233, 6192261], [6192262, 6880290], [6880291, 7568319], [7568320, 8256348], [8256349, 8944377], [8944378, 9632406], [9632407, 10320435], [10320436, 11008464], [11008465, 11696493], [11696494, 12384522], [12384523, 13072551], [13072552, 13760599]] SRR7170848 file size 4641315 SRR7170848 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170848 SRR7170848_1.fastq SRR7170848_2.fastq Input file: SRR7170848_1.fastq Paired file: SRR7170848_2.fastq trimmed: SRR7170848-trimmed-pair1.fastq, SRR7170848-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:23:57 2025 >> started Thu Feb 13 19:24:14 2025 >> done (17.460s) 13760599 read pairs processed; of these: 21367 ( 0.16%) short read pairs filtered out after trimming by size control 48230 ( 0.35%) empty read pairs filtered out after trimming by size control 13691002 (99.49%) read pairs available; of these: 9452090 (69.04%) trimmed read pairs available after processing 4238912 (30.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 6 0.00% 22 10 0.00% 23 5 0.00% 24 4 0.00% 25 8 0.00% 26 4 0.00% 27 12 0.00% 28 8 0.00% 29 5 0.00% 30 12 0.00% 31 12 0.00% 32 16 0.00% 33 9 0.00% 34 8 0.00% 35 13 0.00% 36 14 0.00% 37 14 0.00% 38 26 0.00% 39 22 0.00% 40 24 0.00% 41 27 0.00% 42 26 0.00% 43 28 0.00% 44 31 0.00% 45 33 0.00% 46 49 0.00% 47 59 0.00% 48 47 0.00% 49 52 0.00% 50 61 0.00% 51 69 0.00% 52 109 0.00% 53 89 0.00% 54 101 0.00% 55 92 0.00% 56 106 0.00% 57 136 0.00% 58 130 0.00% 59 133 0.00% 60 176 0.00% 61 196 0.00% 62 213 0.00% 63 230 0.00% 64 237 0.00% 65 255 0.00% 66 266 0.00% 67 350 0.00% 68 383 0.00% 69 397 0.00% 70 520 0.00% 71 545 0.00% 72 711 0.01% 73 757 0.01% 74 912 0.01% 75 1323 0.01% 76 2926 0.02% 77 2981 0.02% 78 1560 0.01% 79 1372 0.01% 80 1495 0.01% 81 1567 0.01% 82 1843 0.01% 83 2420 0.02% 84 3640 0.03% 85 3051 0.02% 86 3075 0.02% 87 3335 0.02% 88 3298 0.02% 89 3337 0.02% 90 3342 0.02% 91 3526 0.03% 92 3811 0.03% 93 3993 0.03% 94 4149 0.03% 95 4214 0.03% 96 4577 0.03% 97 4892 0.04% 98 5091 0.04% 99 5284 0.04% 100 5796 0.04% 101 6031 0.04% 102 6383 0.05% 103 6944 0.05% 104 7326 0.05% 105 7806 0.06% 106 8370 0.06% 107 8880 0.06% 108 9563 0.07% 109 10176 0.07% 110 10867 0.08% 111 11584 0.08% 112 12309 0.09% 113 13137 0.10% 114 14288 0.10% 115 15362 0.11% 116 16135 0.12% 117 17705 0.13% 118 18774 0.14% 119 20024 0.15% 120 21736 0.16% 121 23536 0.17% 122 25108 0.18% 123 27394 0.20% 124 29476 0.22% 125 31918 0.23% 126 34751 0.25% 127 37374 0.27% 128 40917 0.30% 129 44322 0.32% 130 48661 0.36% 131 52733 0.39% 132 57668 0.42% 133 63188 0.46% 134 70047 0.51% 135 76728 0.56% 136 85256 0.62% 137 94739 0.69% 138 106221 0.78% 139 118344 0.86% 140 131589 0.96% 141 150124 1.10% 142 173888 1.27% 143 203441 1.49% 144 241120 1.76% 145 293198 2.14% 146 374349 2.73% 147 506323 3.70% 148 758581 5.54% 149 1357976 9.92% 150 3856048 28.16% 151 4238912 30.96% 13691002 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=35 prefix-density=0.40 prefix-fanout=1.9 sequence=GCGAAGAAGGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=24.60 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.1 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=36 prefix-density=0.50 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=125.81 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.9 sequence=AAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGG SRR7170848 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:24:57 Started mapping on | Feb 13 19:24:57 Finished on | Feb 13 19:28:21 Mapping speed, Million of reads per hour | 241.61 Number of input reads | 13691002 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12834068 Uniquely mapped reads % | 93.74% Average mapped length | 293.11 Number of splices: Total | 12374001 Number of splices: Annotated (sjdb) | 12059323 Number of splices: GT/AG | 12145430 Number of splices: GC/AG | 181776 Number of splices: AT/AC | 7449 Number of splices: Non-canonical | 39346 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321097 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 83324 % of reads mapped to too many loci | 0.61% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.16% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554355 554355 554355 N_multimapping 321097 321097 321097 N_noFeature 625235 12650139 679006 N_ambiguous 235805 929 105079 UnstrandedReadsAssigned:11973028 PositiveStrandReadsAssigned:183000 NegativeStrandReadsAssigned:12049983 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170848 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170848-trimmed-pair1.fastq SRR7170848-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,691,002 reads, 12,064,099 reads pseudoaligned [quant] estimated average fragment length: 313.55 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 987 rounds 52401 SRR7170848.ke.tsv 34699 SRR7170848.se.tsv 87100 total ==> SRR7170848.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1705.45 670 29.3636 Potri.005G024800.1.v4.1 1035 722.45 204 21.1055 Potri.004G059700.1.v4.1 961 648.517 13 1.49829 Potri.007G009000.2.v4.1 1416 1103.45 0 0 Potri.003G141000.2.v4.1 2943 2630.45 450.892 12.812 Potri.016G087400.1.v4.1 270 58.674 713 908.274 Potri.015G069301.1.v4.1 564 263.205 0 0 Potri.010G195200.1.v4.1 1773 1460.45 32 1.63771 Potri.012G127500.1.v4.1 977 664.49 80 8.9986 ==> SRR7170848.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 878 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 22 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170848 completed mapping pipeline successfully