Starting /dee2/code/volunteer_pipeline.sh SRR7170849 current disk space = 3087464640512 free memory = 1451514940 SRR7170849 SRAfilesize 664d87f345d1cc0639b354a7ffffc4e8 SRR7170849.sra SRR7170849.sra file validated SRR7170849 is paired end SRR7170849 is conventional basespace SRR7170849 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68775 34.0 33.0 34.0 32.0 34.0 2 33.289 34.0 33.0 34.0 33.0 34.0 3 33.24875 34.0 33.0 34.0 33.0 34.0 4 33.4225 34.0 33.0 34.0 33.0 34.0 5 33.39425 34.0 33.0 34.0 33.0 34.0 6 36.9135 38.0 37.0 38.0 35.0 38.0 7 37.3335 38.0 38.0 38.0 37.0 38.0 8 37.4905 38.0 38.0 38.0 37.0 38.0 9 37.49575 38.0 38.0 38.0 37.0 38.0 10-14 37.519749999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.424299999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.385949999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.34635000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.282799999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.16845 38.0 38.0 38.0 36.6 38.0 40-44 37.119099999999996 38.0 38.0 38.0 36.2 38.0 45-49 36.935700000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.916500000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.82805 38.0 38.0 38.0 35.4 38.0 60-64 36.6875 38.0 38.0 38.0 35.0 38.0 65-69 36.7334 38.0 38.0 38.0 35.2 38.0 70-74 36.6834 38.0 38.0 38.0 34.8 38.0 75-79 36.40644999999999 38.0 38.0 38.0 34.0 38.0 80-84 36.121249999999996 38.0 37.6 38.0 33.6 38.0 85-89 36.08125 38.0 37.4 38.0 33.4 38.0 90-94 35.9358 38.0 37.0 38.0 33.0 38.0 95-99 35.823750000000004 38.0 37.0 38.0 32.2 38.0 100-104 35.6179 38.0 37.0 38.0 30.2 38.0 105-109 35.3532 38.0 36.4 38.0 29.0 38.0 110-114 35.06355 38.0 36.0 38.0 28.6 38.0 115-119 34.837199999999996 38.0 36.0 38.0 28.2 38.0 120-124 34.5557 38.0 35.0 38.0 25.8 38.0 125-129 33.975300000000004 38.0 33.6 38.0 23.0 38.0 130-134 33.57215 38.0 33.0 38.0 21.4 38.0 135-139 32.824400000000004 38.0 33.0 38.0 16.2 38.0 140-144 32.01485 37.8 31.8 38.0 13.0 38.0 145-149 30.6452 36.6 29.0 38.0 8.0 38.0 150-151 24.552999999999997 31.5 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 4.0 10 0.0 11 4.0 12 2.0 13 0.0 14 2.0 15 1.0 16 2.0 17 5.0 18 5.0 19 21.0 20 7.0 21 13.0 22 7.0 23 7.0 24 15.0 25 19.0 26 25.0 27 27.0 28 46.0 29 51.0 30 66.0 31 60.0 32 94.0 33 133.0 34 222.0 35 410.0 36 1031.0 37 1717.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.649526733179844 12.790995139421845 18.700434893834743 38.859043233563575 2 19.8 16.900000000000002 37.175000000000004 26.125 3 18.625 23.400000000000002 28.075 29.9 4 20.525 31.5 23.075000000000003 24.9 5 22.375 34.2 24.725 18.7 6 18.175 37.8 26.0 18.025 7 13.900000000000002 24.349999999999998 43.325 18.425 8 17.299999999999997 26.025 31.05 25.624999999999996 9 18.224999999999998 25.724999999999998 32.550000000000004 23.5 10-14 19.15 30.775000000000002 26.915 23.16 15-19 19.165 29.285 28.549999999999997 23.0 20-24 19.02 29.37 28.144999999999996 23.465 25-29 18.8 29.544999999999998 28.095 23.56 30-34 19.33 29.07 28.189999999999998 23.41 35-39 19.425 29.895 27.38 23.3 40-44 19.325 30.555 26.995 23.125 45-49 19.814999999999998 29.189999999999998 27.955000000000002 23.04 50-54 19.405 29.49 27.495000000000005 23.61 55-59 19.7 29.299999999999997 27.595 23.405 60-64 19.3 29.095 28.035 23.57 65-69 19.09 29.515 28.315 23.080000000000002 70-74 19.470000000000002 29.095 27.839999999999996 23.595 75-79 19.79 29.865000000000002 27.205000000000002 23.14 80-84 20.195 29.385 27.295 23.125 85-89 19.67 28.439999999999998 27.825 24.065 90-94 19.75 28.92 27.065 24.265 95-99 19.935 29.26 27.46 23.345 100-104 19.31 29.04 27.47 24.18 105-109 19.8 28.78 27.825 23.595 110-114 20.155 28.21 27.445000000000004 24.19 115-119 20.200000000000003 28.050000000000004 27.715 24.035 120-124 19.99 28.595 27.71 23.705000000000002 125-129 19.900000000000002 28.244999999999997 27.375 24.48 130-134 19.975 28.38 27.584999999999997 24.060000000000002 135-139 20.375 28.37 27.6 23.655 140-144 20.265 28.515 27.275 23.945 145-149 19.89 28.715000000000003 27.634999999999998 23.76 150-151 21.175 28.7375 26.437500000000004 23.65 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 8.0 1 5.0 2 2.0 3 2.0 4 2.0 5 1.5 6 1.0 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 2.0 19 3.5 20 3.5 21 2.5 22 2.0 23 5.5 24 7.0 25 7.5 26 10.0 27 12.5 28 13.5 29 20.0 30 32.0 31 40.0 32 57.5 33 68.0 34 77.5 35 101.5 36 122.5 37 141.0 38 154.5 39 163.5 40 183.5 41 207.0 42 219.5 43 219.0 44 222.0 45 220.0 46 217.5 47 227.0 48 229.0 49 202.5 50 172.0 51 138.0 52 105.0 53 93.5 54 73.0 55 56.5 56 47.0 57 35.0 58 23.0 59 15.5 60 10.0 61 5.5 62 2.5 63 2.0 64 1.5 65 1.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.75 #Duplication Level Percentage of deduplicated Percentage of total 1 98.69565217391305 96.475 2 1.0997442455242967 2.15 3 0.07672634271099744 0.22499999999999998 4 0.0 0.0 5 0.051150895140664954 0.25 6 0.0 0.0 7 0.025575447570332477 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.051150895140664954 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 17 0.42500000000000004 TruSeq Adapter, Index 6 (97% over 36bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 7 0.17500000000000002 No Hit CACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATC 5 0.125 No Hit TCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.025 0.0 44-45 0.025 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.0875 0.0 0.0 0.025 0.0 80-81 0.1 0.0 0.0 0.025 0.0 82-83 0.1 0.0 0.0 0.025 0.0 84-85 0.1125 0.0 0.0 0.025 0.0 86-87 0.125 0.0 0.0 0.025 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.16249999999999998 0.0 0.0 0.025 0.0 92-93 0.2 0.0 0.0 0.025 0.0 94-95 0.2 0.0 0.0 0.025 0.0 96-97 0.2375 0.0 0.0 0.025 0.0 98-99 0.3125 0.0 0.0 0.025 0.0 100-101 0.3625 0.0 0.0 0.025 0.0 102-103 0.4625 0.0 0.0 0.025 0.0 104-105 0.5375 0.0 0.0 0.025 0.0 106-107 0.5874999999999999 0.0 0.0 0.025 0.0 108-109 0.6125 0.0 0.0 0.025 0.0 110-111 0.65 0.0 0.0 0.025 0.0 112-113 0.675 0.0 0.0 0.025 0.0 114-115 0.75 0.0 0.0 0.025 0.0 116-117 0.7625 0.0 0.0 0.025 0.0 118-119 0.825 0.0 0.0 0.025 0.0 120-121 0.95 0.0 0.0 0.025 0.0 122-123 1.15 0.0 0.0 0.025 0.0 124-125 1.2125 0.0 0.0 0.025 0.0 126-127 1.3125 0.0 0.0 0.025 0.0 128-129 1.5 0.0 0.0 0.025 0.0 130-131 1.5875 0.0 0.0 0.025 0.0 132-133 1.675 0.0 0.0 0.025 0.0 134-135 1.875 0.0 0.0 0.025 0.0 136-137 2.075 0.0 0.0 0.025 0.0 138-139 2.2750000000000004 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170849 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170849_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72675 33.0 33.0 34.0 32.0 34.0 2 32.8565 34.0 33.0 34.0 32.0 34.0 3 32.887 34.0 33.0 34.0 32.0 34.0 4 32.8355 34.0 33.0 34.0 32.0 34.0 5 32.7255 34.0 33.0 34.0 32.0 34.0 6 36.917 38.0 38.0 38.0 36.0 38.0 7 36.9465 38.0 38.0 38.0 37.0 38.0 8 36.94575 38.0 38.0 38.0 36.0 38.0 9 36.9935 38.0 38.0 38.0 37.0 38.0 10-14 36.996500000000005 38.0 38.0 38.0 36.8 38.0 15-19 36.9543 38.0 38.0 38.0 36.2 38.0 20-24 36.842549999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.764700000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.8132 38.0 38.0 38.0 36.0 38.0 35-39 36.782050000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.78225 38.0 38.0 38.0 36.0 38.0 45-49 36.78475 38.0 38.0 38.0 36.0 38.0 50-54 36.756150000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.7109 38.0 38.0 38.0 35.4 38.0 60-64 36.6651 38.0 38.0 38.0 35.2 38.0 65-69 36.66785 38.0 38.0 38.0 35.0 38.0 70-74 36.5845 38.0 38.0 38.0 34.8 38.0 75-79 36.46855 38.0 38.0 38.0 34.2 38.0 80-84 36.294349999999994 38.0 38.0 38.0 34.0 38.0 85-89 36.224000000000004 38.0 38.0 38.0 33.8 38.0 90-94 36.004599999999996 38.0 38.0 38.0 33.6 38.0 95-99 35.88375 38.0 38.0 38.0 33.2 38.0 100-104 35.73224999999999 38.0 37.0 38.0 32.2 38.0 105-109 35.569750000000006 38.0 37.0 38.0 31.0 38.0 110-114 35.371 38.0 36.8 38.0 30.0 38.0 115-119 35.18169999999999 38.0 36.2 38.0 29.0 38.0 120-124 34.86595 38.0 36.0 38.0 27.8 38.0 125-129 34.499849999999995 38.0 35.2 38.0 25.4 38.0 130-134 33.786950000000004 38.0 33.6 38.0 21.8 38.0 135-139 33.338750000000005 38.0 33.0 38.0 18.0 38.0 140-144 32.5645 38.0 33.0 38.0 13.2 38.0 145-149 31.53775 38.0 31.8 38.0 8.2 38.0 150-151 26.08175 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 3.0 5 1.0 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 1.0 13 3.0 14 4.0 15 4.0 16 3.0 17 3.0 18 10.0 19 16.0 20 24.0 21 18.0 22 13.0 23 20.0 24 10.0 25 24.0 26 22.0 27 31.0 28 35.0 29 38.0 30 57.0 31 65.0 32 70.0 33 106.0 34 158.0 35 321.0 36 751.0 37 2172.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.25 18.525 22.975 29.25 2 26.608260325406757 22.97872340425532 32.29036295369212 18.122653316645806 3 22.658988482724084 25.838758137205808 31.647471206810213 19.854782173259892 4 24.412206103051524 32.016008004002 22.661330665332667 20.910455227613806 5 25.720010017530683 35.08640120210369 21.512647132481845 17.680941647883795 6 21.25 37.35 23.674999999999997 17.724999999999998 7 19.75 20.225 39.800000000000004 20.225 8 22.075 24.875 28.075 24.975 9 22.1 25.35 29.175 23.375 10-14 23.895 28.96 25.779999999999998 21.365000000000002 15-19 23.011150557527877 28.196409820491024 28.176408820441022 20.616030801540077 20-24 23.66564954229403 28.4828172677705 27.117202741233555 20.734330448701915 25-29 23.78497422293408 28.14455177936834 27.62400520546574 20.44646879223184 30-34 23.316658329164582 27.63881940970485 27.883941970985493 21.160580290145074 35-39 23.20812284299505 27.80473165607963 27.974791176911918 21.012354324013405 40-44 23.069609167792624 27.62848421157984 27.878696892358505 21.42320972826903 45-49 23.344337735094037 27.751100440176067 27.77110844337735 21.133453381352542 50-54 23.65182591295648 27.448724362181093 27.883941970985493 21.01550775387694 55-59 23.530588764944223 26.97713971287079 28.1426641988895 21.349607323295483 60-64 23.33466693338668 27.790558111622328 27.415483096619326 21.459291858371675 65-69 23.410852713178297 27.616904226056516 28.3520880220055 20.62015503875969 70-74 23.44586146536634 27.866966741685424 27.596899224806204 21.090272568142034 75-79 23.154630926185238 28.200640128025604 27.025405081016203 21.619323864772955 80-84 23.26698009402821 28.663599079723916 27.033109932979894 21.03631089326798 85-89 23.726186309315466 28.366418320916047 27.281364068203413 20.626031301565078 90-94 23.529705941188237 28.49569913982797 27.290458091618326 20.684136827365474 95-99 23.845 28.42 26.895000000000003 20.84 100-104 24.58745874587459 27.302730273027304 27.83278327832783 20.27702770277028 105-109 23.529705941188237 28.370674134826967 27.580516103220642 20.519103820764155 110-114 24.282428242824285 27.787778777877786 27.562756275627564 20.367036703670365 115-119 24.16104026006502 28.257064266066518 27.481870467616904 20.100025006251563 120-124 22.996899069720918 28.053416024807444 28.293488046413923 20.65619685905772 125-129 23.865966491622906 27.966991747936987 27.646911727931982 20.520130032508128 130-134 24.51490298059612 27.595519103820763 27.770554110822165 20.119023804760953 135-139 23.88477695539108 27.750550110022004 27.800560112022403 20.56411282256451 140-144 24.173626043906584 27.959193879081862 27.874181127169074 19.992998949842477 145-149 24.202260678203462 28.0334100230069 27.34320296088827 20.42112633790137 150-151 24.1125 26.6625 29.3875 19.8375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.5 25 2.5 26 4.5 27 5.5 28 6.5 29 11.5 30 12.5 31 14.5 32 25.5 33 30.5 34 38.5 35 61.0 36 82.5 37 93.0 38 115.5 39 153.5 40 180.5 41 219.0 42 248.0 43 265.5 44 294.5 45 299.0 46 267.0 47 245.5 48 230.5 49 204.0 50 171.5 51 140.0 52 121.0 53 107.0 54 90.0 55 70.5 56 46.5 57 33.0 58 29.0 59 20.0 60 19.0 61 11.5 62 7.5 63 5.5 64 2.0 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.15 4 0.05 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.045 25-29 0.105 30-34 0.05 35-39 0.034999999999999996 40-44 0.08499999999999999 45-49 0.04 50-54 0.05 55-59 0.045 60-64 0.02 65-69 0.025 70-74 0.025 75-79 0.02 80-84 0.03 85-89 0.005 90-94 0.02 95-99 0.0 100-104 0.01 105-109 0.02 110-114 0.01 115-119 0.025 120-124 0.03 125-129 0.025 130-134 0.02 135-139 0.02 140-144 0.015 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.64102564102564 96.175 2 0.9230769230769231 1.7999999999999998 3 0.20512820512820512 0.6 4 0.07692307692307693 0.3 5 0.07692307692307693 0.375 6 0.0 0.0 7 0.05128205128205128 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.02564102564102564 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 16 0.4 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit TTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACC 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.5874999999999999 0.0 0.0 0.0 0.0 110-111 0.625 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.725 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.8999999999999999 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.4375 0.0 0.0 0.0 0.0 130-131 1.5375 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.85 0.0 0.0 0.0 0.0 136-137 2.05 0.0 0.0 0.0 0.0 138-139 2.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAGGTA 10 0.006843168 144.91249 4 GAAAAAC 10 0.006843168 144.91249 1 TCAAAAG 10 0.006843168 144.91249 5 GGTAGTT 10 0.006843168 144.91249 2 AAAAACT 10 0.006843168 144.91249 2 GTAGTTG 10 0.006843168 144.91249 3 CTCAAAA 10 0.006843168 144.91249 4 >>END_MODULE Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534674 spots for SRR7170849.sra Written 534674 spots for SRR7170849.sra Read 534675 spots for SRR7170849.sra Written 534675 spots for SRR7170849.sra SRR ids: ['SRR7170849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3h_3x7yi SRR7170849.sra spots: 10693481 blocks: [[1, 534674], [534675, 1069348], [1069349, 1604022], [1604023, 2138696], [2138697, 2673370], [2673371, 3208044], [3208045, 3742718], [3742719, 4277392], [4277393, 4812066], [4812067, 5346740], [5346741, 5881414], [5881415, 6416088], [6416089, 6950762], [6950763, 7485436], [7485437, 8020110], [8020111, 8554784], [8554785, 9089458], [9089459, 9624132], [9624133, 10158806], [10158807, 10693481]] SRR7170849 file size 3601969 SRR7170849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170849 SRR7170849_1.fastq SRR7170849_2.fastq Input file: SRR7170849_1.fastq Paired file: SRR7170849_2.fastq trimmed: SRR7170849-trimmed-pair1.fastq, SRR7170849-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:06:01 2025 >> started Thu Feb 13 19:06:12 2025 >> done (11.640s) 10693481 read pairs processed; of these: 23771 ( 0.22%) short read pairs filtered out after trimming by size control 64694 ( 0.60%) empty read pairs filtered out after trimming by size control 10605016 (99.17%) read pairs available; of these: 6779475 (63.93%) trimmed read pairs available after processing 3825541 (36.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 14 0.00% 20 11 0.00% 21 13 0.00% 22 23 0.00% 23 22 0.00% 24 34 0.00% 25 24 0.00% 26 40 0.00% 27 47 0.00% 28 42 0.00% 29 42 0.00% 30 49 0.00% 31 76 0.00% 32 70 0.00% 33 62 0.00% 34 58 0.00% 35 57 0.00% 36 63 0.00% 37 61 0.00% 38 70 0.00% 39 119 0.00% 40 59 0.00% 41 77 0.00% 42 76 0.00% 43 66 0.00% 44 68 0.00% 45 68 0.00% 46 65 0.00% 47 94 0.00% 48 103 0.00% 49 97 0.00% 50 96 0.00% 51 125 0.00% 52 151 0.00% 53 155 0.00% 54 192 0.00% 55 192 0.00% 56 183 0.00% 57 259 0.00% 58 256 0.00% 59 302 0.00% 60 309 0.00% 61 407 0.00% 62 345 0.00% 63 480 0.00% 64 419 0.00% 65 408 0.00% 66 473 0.00% 67 533 0.01% 68 560 0.01% 69 629 0.01% 70 717 0.01% 71 733 0.01% 72 847 0.01% 73 887 0.01% 74 1083 0.01% 75 1271 0.01% 76 2510 0.02% 77 3110 0.03% 78 2060 0.02% 79 1704 0.02% 80 1749 0.02% 81 1817 0.02% 82 1956 0.02% 83 2731 0.03% 84 4080 0.04% 85 3450 0.03% 86 3867 0.04% 87 4491 0.04% 88 4875 0.05% 89 5073 0.05% 90 5131 0.05% 91 5311 0.05% 92 5288 0.05% 93 5363 0.05% 94 5445 0.05% 95 5403 0.05% 96 5294 0.05% 97 5445 0.05% 98 5668 0.05% 99 5803 0.05% 100 5862 0.06% 101 6162 0.06% 102 6493 0.06% 103 6684 0.06% 104 6996 0.07% 105 7337 0.07% 106 7892 0.07% 107 8123 0.08% 108 8572 0.08% 109 8879 0.08% 110 9292 0.09% 111 9812 0.09% 112 10307 0.10% 113 11001 0.10% 114 11619 0.11% 115 12218 0.12% 116 12760 0.12% 117 13746 0.13% 118 14596 0.14% 119 15295 0.14% 120 16428 0.15% 121 17311 0.16% 122 18682 0.18% 123 19921 0.19% 124 21422 0.20% 125 22830 0.22% 126 24676 0.23% 127 26273 0.25% 128 28501 0.27% 129 30315 0.29% 130 32730 0.31% 131 34806 0.33% 132 37830 0.36% 133 40962 0.39% 134 45176 0.43% 135 48855 0.46% 136 54284 0.51% 137 59778 0.56% 138 65826 0.62% 139 73569 0.69% 140 82096 0.77% 141 93427 0.88% 142 107312 1.01% 143 126222 1.19% 144 151018 1.42% 145 184310 1.74% 146 237062 2.24% 147 324879 3.06% 148 499721 4.71% 149 948013 8.94% 150 3000181 28.29% 151 3825541 36.07% 10605016 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=17 prefix-density=0.83 prefix-fanout=2.5 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=91.73 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.6 sequence=CCATTCCCAAGTTCATTTATTTTAATTAAATATTACACAATATAAGTAGGGTAAATTCTTATTAGGATTTGAACCCAAGATTTTCTAGTGAAAATCTAAAATCATACTCCACAACGCTACAGGTGCTTTATGAACCCCGAAGCTATGCACAGCGTTCTTCCAATAAGATGACTTAGGCTGTCATCTTTGCTTTCGATTAATTAATTACCGTAGAGAGCATGTATGCCATCAATATCATCCTGGGCGAGATTCCTTTTCTTAGTTCCAGCTGCAATCGATGGATACATAACGGCATTGGAATCACTACTGTGAGCAAGCCCAAGTAGATGTCCTATTTCATGAACAGCCACGGATTCCAAGTCAATTTGGTCCATTGCGGGGTTAGTACTCCACTTCTCGTCAGCATCATAATGGAAACGGCCATTTTCTGGACTAAAAGCATGGGCTAGTATTTTCCCAGGTCCATCAAAAGGATAACCATCCCCATGATCACCGCGGTAGAATGCAATAA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=22 prefix-density=0.68 prefix-fanout=2.1 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=28.94 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=1.5 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGA SRR7170849 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:06:55 Started mapping on | Feb 13 19:06:55 Finished on | Feb 13 19:08:41 Mapping speed, Million of reads per hour | 360.17 Number of input reads | 10605016 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 9713356 Uniquely mapped reads % | 91.59% Average mapped length | 293.58 Number of splices: Total | 9117309 Number of splices: Annotated (sjdb) | 8925533 Number of splices: GT/AG | 8946937 Number of splices: GC/AG | 134904 Number of splices: AT/AC | 6952 Number of splices: Non-canonical | 28516 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.05 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274098 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 10763 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.64% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 643711 643711 643711 N_multimapping 274098 274098 274098 N_noFeature 263097 9474055 303742 N_ambiguous 272141 715 73264 UnstrandedReadsAssigned:9178118 PositiveStrandReadsAssigned:238586 NegativeStrandReadsAssigned:9336350 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170849 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170849-trimmed-pair1.fastq SRR7170849-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,605,016 reads, 9,298,464 reads pseudoaligned [quant] estimated average fragment length: 280.071 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR7170849.ke.tsv 34699 SRR7170849.se.tsv 87100 total ==> SRR7170849.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.93 240 9.05305 Potri.005G024800.1.v4.1 1035 755.929 161 13.9705 Potri.004G059700.1.v4.1 961 681.944 19 1.82756 Potri.007G009000.2.v4.1 1416 1136.93 0 0 Potri.003G141000.2.v4.1 2943 2663.93 489 12.0407 Potri.016G087400.1.v4.1 270 64.1964 966 987.034 Potri.015G069301.1.v4.1 564 291.075 0 0 Potri.010G195200.1.v4.1 1773 1493.93 45 1.97582 Potri.012G127500.1.v4.1 977 697.944 32 3.00743 ==> SRR7170849.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 336 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7170849 completed mapping pipeline successfully