Starting /dee2/code/volunteer_pipeline.sh SRR7170850 current disk space = 3087466688512 free memory = 1405575464 SRR7170850 SRAfilesize faff721436a91f8a33aa883dc59bf702 SRR7170850.sra SRR7170850.sra file validated SRR7170850 is paired end SRR7170850 is conventional basespace SRR7170850 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48225 34.0 33.0 34.0 32.0 34.0 2 33.25075 34.0 33.0 34.0 32.0 34.0 3 33.22825 34.0 33.0 34.0 32.0 34.0 4 33.23375 34.0 33.0 34.0 33.0 34.0 5 33.296 34.0 33.0 34.0 33.0 34.0 6 36.89175 38.0 37.0 38.0 35.0 38.0 7 37.19725 38.0 38.0 38.0 36.0 38.0 8 37.33125 38.0 38.0 38.0 37.0 38.0 9 37.36675 38.0 38.0 38.0 37.0 38.0 10-14 37.36135 38.0 38.0 38.0 37.0 38.0 15-19 37.330200000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.287 38.0 38.0 38.0 36.8 38.0 25-29 37.3447 38.0 38.0 38.0 37.0 38.0 30-34 37.18065 38.0 38.0 38.0 36.4 38.0 35-39 37.16285 38.0 38.0 38.0 36.0 38.0 40-44 37.075649999999996 38.0 38.0 38.0 36.0 38.0 45-49 37.01885 38.0 38.0 38.0 35.6 38.0 50-54 36.825599999999994 38.0 38.0 38.0 35.0 38.0 55-59 36.712 38.0 38.0 38.0 34.8 38.0 60-64 36.55505 38.0 38.0 38.0 34.0 38.0 65-69 36.60075 38.0 38.0 38.0 34.2 38.0 70-74 36.5504 38.0 38.0 38.0 34.2 38.0 75-79 36.27035 38.0 38.0 38.0 34.0 38.0 80-84 35.9671 38.0 37.0 38.0 33.2 38.0 85-89 35.90395 38.0 37.0 38.0 33.0 38.0 90-94 35.77145 38.0 37.0 38.0 31.6 38.0 95-99 35.55145 38.0 37.0 38.0 31.0 38.0 100-104 35.18365 38.0 36.2 38.0 29.2 38.0 105-109 34.8065 38.0 35.6 38.0 27.2 38.0 110-114 34.2949 38.0 34.4 38.0 24.2 38.0 115-119 34.031150000000004 38.0 33.8 38.0 23.0 38.0 120-124 33.763400000000004 38.0 33.4 38.0 22.2 38.0 125-129 32.960300000000004 38.0 33.0 38.0 15.6 38.0 130-134 32.4033 38.0 31.4 38.0 14.2 38.0 135-139 31.56035 37.2 30.0 38.0 13.0 38.0 140-144 31.055999999999994 36.6 29.2 38.0 12.2 38.0 145-149 29.4209 36.0 27.6 38.0 2.0 38.0 150-151 22.55475 28.5 7.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 2.0 13 2.0 14 2.0 15 3.0 16 7.0 17 3.0 18 13.0 19 24.0 20 13.0 21 6.0 22 15.0 23 24.0 24 20.0 25 28.0 26 21.0 27 44.0 28 51.0 29 58.0 30 79.0 31 83.0 32 109.0 33 163.0 34 291.0 35 463.0 36 1077.0 37 1398.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.75160379779317 17.757249166025147 10.264305876315115 28.226841159866563 2 22.5 18.875 34.225 24.4 3 17.49249249249249 28.07807807807808 29.929929929929934 24.4994994994995 4 21.25 32.025 24.325 22.400000000000002 5 23.3 35.6 23.325000000000003 17.775 6 20.175 35.099999999999994 24.025 20.7 7 15.45 24.349999999999998 41.199999999999996 19.0 8 18.925 22.400000000000002 28.225 30.45 9 18.925 23.799999999999997 30.45 26.825 10-14 21.14 28.65 25.66 24.55 15-19 20.93 28.189999999999998 26.779999999999998 24.099999999999998 20-24 20.669999999999998 28.53 26.640000000000004 24.16 25-29 20.68 28.804999999999996 26.584999999999997 23.93 30-34 20.21 28.634999999999998 26.955000000000002 24.2 35-39 21.15 28.735 26.08 24.035 40-44 20.880000000000003 28.34 27.22 23.56 45-49 21.465 28.49 26.529999999999998 23.515 50-54 21.385 27.815 26.745 24.055 55-59 20.48 28.48 26.75 24.29 60-64 21.26 27.584999999999997 26.924999999999997 24.23 65-69 21.465 28.720000000000002 26.290000000000003 23.525 70-74 21.02 28.970000000000002 26.265 23.745 75-79 21.075 28.53 25.900000000000002 24.495 80-84 20.66 28.544999999999998 26.619999999999997 24.175 85-89 21.085 28.37 26.965 23.580000000000002 90-94 21.349999999999998 28.15 26.284999999999997 24.215 95-99 21.9 28.615000000000002 25.895000000000003 23.59 100-104 21.385 28.694999999999997 26.474999999999998 23.445 105-109 21.709999999999997 28.04 26.72 23.53 110-114 22.285 27.800000000000004 25.935000000000002 23.98 115-119 22.509999999999998 28.139999999999997 25.47 23.880000000000003 120-124 22.400000000000002 28.715000000000003 25.055 23.830000000000002 125-129 22.31 27.994999999999997 25.825 23.87 130-134 22.259999999999998 28.34 26.035000000000004 23.365 135-139 22.485 27.950000000000003 25.455 24.11 140-144 22.27 28.01 25.724999999999998 23.995 145-149 21.545 28.425 25.515 24.515 150-151 23.35 27.1375 25.3 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 2.5 26 4.5 27 10.0 28 9.5 29 12.0 30 22.0 31 25.0 32 30.0 33 42.5 34 53.5 35 65.5 36 87.5 37 106.5 38 114.0 39 138.0 40 162.0 41 168.0 42 185.5 43 218.5 44 232.0 45 224.5 46 237.5 47 244.5 48 238.5 49 228.0 50 201.5 51 168.5 52 146.5 53 130.5 54 102.0 55 85.0 56 71.0 57 56.0 58 44.5 59 36.5 60 29.5 61 17.5 62 14.5 63 10.5 64 5.5 65 4.0 66 2.5 67 2.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.5749999999999997 2 0.0 3 0.1 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.64241803278688 96.275 2 1.0502049180327868 2.0500000000000003 3 0.20491803278688525 0.6 4 0.05122950819672131 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025614754098360656 0.2 9 0.0 0.0 >10 0.025614754098360656 0.675 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTAT 27 0.675 TruSeq Adapter, Index 19 (97% over 38bp) ATCGGAAGAGCACACGTCTGAACTCCAGTCACCTGAAGCTATCTCGTATG 8 0.2 TruSeq Adapter, Index 19 (97% over 37bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.075 0.0 0.0 0.0 0.0 96-97 1.3875 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.125 0.0 0.0 0.0 0.0 102-103 2.4375 0.0 0.0 0.0 0.0 104-105 2.7750000000000004 0.0 0.0 0.0 0.0 106-107 3.1875 0.0 0.0 0.0 0.0 108-109 3.625 0.0 0.0 0.0 0.0 110-111 4.0125 0.0 0.0 0.0 0.0 112-113 4.4625 0.0 0.0 0.0 0.0 114-115 5.025 0.0 0.0 0.0 0.0 116-117 5.5375 0.0 0.0 0.0 0.0 118-119 5.9625 0.0 0.0 0.0 0.0 120-121 6.475 0.0 0.0 0.0 0.0 122-123 7.0625 0.0 0.0 0.0 0.0 124-125 7.65 0.0 0.0 0.0 0.0 126-127 8.3625 0.0 0.0 0.0 0.0 128-129 9.2 0.0 0.0 0.0 0.0 130-131 9.975 0.0 0.0 0.0 0.0 132-133 10.912500000000001 0.0 0.0 0.0 0.0 134-135 11.65 0.0 0.0 0.0 0.0 136-137 12.225000000000001 0.0 0.0 0.0 0.0 138-139 13.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCTCC 10 0.0068378756 144.95 5 CTAGTTT 10 0.0068378756 144.95 8 >>END_MODULE SRR7170850 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170850_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87625 33.0 33.0 34.0 32.0 34.0 2 32.86225 33.0 33.0 34.0 32.0 34.0 3 32.91575 34.0 33.0 34.0 32.0 34.0 4 32.86175 34.0 33.0 34.0 32.0 34.0 5 32.90125 34.0 33.0 34.0 32.0 34.0 6 37.0165 38.0 38.0 38.0 37.0 38.0 7 37.06025 38.0 38.0 38.0 37.0 38.0 8 37.1305 38.0 38.0 38.0 37.0 38.0 9 37.10075 38.0 38.0 38.0 37.0 38.0 10-14 36.9526 38.0 38.0 38.0 36.2 38.0 15-19 36.9793 38.0 38.0 38.0 36.8 38.0 20-24 36.9524 38.0 38.0 38.0 36.0 38.0 25-29 36.8689 38.0 38.0 38.0 36.2 38.0 30-34 36.857350000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.873 38.0 38.0 38.0 36.0 38.0 40-44 36.851400000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.882549999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.774 38.0 38.0 38.0 36.0 38.0 55-59 36.69645 38.0 38.0 38.0 35.6 38.0 60-64 36.679100000000005 38.0 38.0 38.0 35.6 38.0 65-69 36.6366 38.0 38.0 38.0 35.0 38.0 70-74 36.56185000000001 38.0 38.0 38.0 34.8 38.0 75-79 36.45219999999999 38.0 38.0 38.0 34.6 38.0 80-84 36.138 38.0 38.0 38.0 34.0 38.0 85-89 35.989999999999995 38.0 38.0 38.0 34.0 38.0 90-94 35.90155 38.0 38.0 38.0 33.4 38.0 95-99 35.7369 38.0 37.8 38.0 33.0 38.0 100-104 35.59439999999999 38.0 37.2 38.0 31.8 38.0 105-109 35.42125 38.0 37.0 38.0 31.0 38.0 110-114 35.2461 38.0 37.0 38.0 29.8 38.0 115-119 34.95975 38.0 36.0 38.0 28.0 38.0 120-124 34.636199999999995 38.0 35.4 38.0 26.4 38.0 125-129 34.1185 38.0 34.6 38.0 23.4 38.0 130-134 33.6571 38.0 33.4 38.0 21.8 38.0 135-139 33.128400000000006 38.0 33.0 38.0 18.2 38.0 140-144 32.280649999999994 38.0 33.0 38.0 13.0 38.0 145-149 31.09545 37.6 31.2 38.0 5.8 38.0 150-151 25.061625 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 6.0 5 2.0 6 1.0 7 0.0 8 2.0 9 1.0 10 1.0 11 2.0 12 2.0 13 8.0 14 9.0 15 3.0 16 6.0 17 2.0 18 8.0 19 14.0 20 31.0 21 10.0 22 8.0 23 6.0 24 14.0 25 21.0 26 32.0 27 26.0 28 39.0 29 44.0 30 46.0 31 70.0 32 75.0 33 106.0 34 144.0 35 319.0 36 768.0 37 2158.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.125 19.975 12.950000000000001 23.95 2 26.85 24.099999999999998 30.7 18.35 3 21.7 27.05 33.0 18.25 4 23.549999999999997 33.2 22.575 20.674999999999997 5 25.35 35.699999999999996 21.0 17.95 6 20.525 37.075 21.9 20.5 7 18.975 20.525 38.550000000000004 21.95 8 21.6 24.125 26.25 28.025 9 22.1 23.525 28.475 25.900000000000002 10-14 23.34 27.939999999999998 25.990000000000002 22.73 15-19 24.065 26.66 27.71 21.565 20-24 23.425 28.439999999999998 26.615 21.52 25-29 23.549999999999997 28.005000000000003 27.365000000000002 21.08 30-34 23.23 27.255000000000003 28.08 21.435000000000002 35-39 23.155 26.985 27.71 22.15 40-44 23.45 26.795 27.66 22.095000000000002 45-49 23.185 26.85 27.705000000000002 22.259999999999998 50-54 23.565 25.965 28.055000000000003 22.415 55-59 23.405 26.605 27.389999999999997 22.6 60-64 23.095 26.965 27.6 22.34 65-69 23.415 26.415 27.29 22.88 70-74 22.745 27.505000000000003 27.18 22.57 75-79 23.275000000000002 27.355 27.18 22.189999999999998 80-84 23.400000000000002 27.415 27.084999999999997 22.1 85-89 24.385 26.950000000000003 27.055 21.61 90-94 23.82 27.034999999999997 27.32 21.825 95-99 23.59 28.144999999999996 26.650000000000002 21.615000000000002 100-104 24.065 27.32 27.245 21.37 105-109 24.64 26.895000000000003 27.12 21.345 110-114 24.349999999999998 27.215 26.884999999999998 21.55 115-119 24.91 27.189999999999998 26.72 21.18 120-124 25.124999999999996 27.98 25.955000000000002 20.94 125-129 25.629999999999995 27.375 26.295 20.7 130-134 25.765 26.875 26.979999999999997 20.380000000000003 135-139 26.25 27.77 25.919999999999998 20.06 140-144 26.27 27.37 26.174999999999997 20.185 145-149 26.85 27.215 26.14 19.794999999999998 150-151 27.175 27.037499999999998 26.400000000000002 19.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.0 24 1.5 25 1.0 26 2.5 27 4.0 28 6.5 29 10.0 30 14.0 31 16.5 32 23.0 33 31.5 34 37.0 35 54.0 36 68.0 37 83.5 38 108.5 39 141.5 40 171.5 41 183.0 42 195.0 43 219.5 44 241.0 45 254.5 46 257.0 47 236.0 48 222.5 49 216.0 50 201.5 51 182.5 52 150.0 53 130.0 54 113.0 55 85.0 56 83.5 57 73.0 58 43.0 59 33.0 60 28.0 61 18.0 62 16.5 63 15.5 64 9.5 65 4.5 66 0.5 67 0.5 68 2.0 69 1.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.27364081422314 95.35 2 1.2883277505797475 2.5 3 0.2576655501159495 0.75 4 0.07729966503478485 0.3 5 0.0515331100231899 0.25 6 0.02576655501159495 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02576655501159495 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 28 0.7000000000000001 Illumina Single End PCR Primer 1 (97% over 34bp) AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 6 0.15 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.0999999999999996 0.0 0.0 0.0 0.0 102-103 2.4125 0.0 0.0 0.0 0.0 104-105 2.7750000000000004 0.0 0.0 0.0 0.0 106-107 3.2125 0.0 0.0 0.0 0.0 108-109 3.6375 0.0 0.0 0.0 0.0 110-111 4.012499999999999 0.0 0.0 0.0 0.0 112-113 4.425 0.0 0.0 0.0 0.0 114-115 5.0 0.0 0.0 0.0 0.0 116-117 5.4625 0.0 0.0 0.0 0.0 118-119 5.8625 0.0 0.0 0.0 0.0 120-121 6.325 0.0 0.0 0.0 0.0 122-123 6.887499999999999 0.0 0.0 0.0 0.0 124-125 7.3875 0.0 0.0 0.0 0.0 126-127 8.125 0.0 0.0 0.0 0.0 128-129 8.925 0.0 0.0 0.0 0.0 130-131 9.75 0.0 0.0 0.0 0.0 132-133 10.675 0.0 0.0 0.0 0.0 134-135 11.4125 0.0 0.0 0.0 0.0 136-137 11.9625 0.0 0.0 0.0 0.0 138-139 12.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCCTCA 10 0.006830828 145.0 8 GGGGGGG 35 0.0035366106 20.714287 9 AAAAAAA 150 2.0670056E-4 9.666667 70-74 >>END_MODULE Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710582 spots for SRR7170850.sra Written 710582 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra Read 710581 spots for SRR7170850.sra Written 710581 spots for SRR7170850.sra SRR ids: ['SRR7170850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i95dv4oh SRR7170850.sra spots: 14211621 blocks: [[1, 710581], [710582, 1421162], [1421163, 2131743], [2131744, 2842324], [2842325, 3552905], [3552906, 4263486], [4263487, 4974067], [4974068, 5684648], [5684649, 6395229], [6395230, 7105810], [7105811, 7816391], [7816392, 8526972], [8526973, 9237553], [9237554, 9948134], [9948135, 10658715], [10658716, 11369296], [11369297, 12079877], [12079878, 12790458], [12790459, 13501039], [13501040, 14211621]] SRR7170850 file size 4794151 SRR7170850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170850 SRR7170850_1.fastq SRR7170850_2.fastq Input file: SRR7170850_1.fastq Paired file: SRR7170850_2.fastq trimmed: SRR7170850-trimmed-pair1.fastq, SRR7170850-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 19:07:48 2025 >> started Thu Feb 13 19:08:07 2025 >> done (18.614s) 14211621 read pairs processed; of these: 33299 ( 0.23%) short read pairs filtered out after trimming by size control 154136 ( 1.08%) empty read pairs filtered out after trimming by size control 14024186 (98.68%) read pairs available; of these: 9867621 (70.36%) trimmed read pairs available after processing 4156565 (29.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 28 0.00% 19 26 0.00% 20 41 0.00% 21 25 0.00% 22 45 0.00% 23 35 0.00% 24 44 0.00% 25 29 0.00% 26 49 0.00% 27 60 0.00% 28 52 0.00% 29 44 0.00% 30 54 0.00% 31 62 0.00% 32 60 0.00% 33 58 0.00% 34 58 0.00% 35 59 0.00% 36 62 0.00% 37 66 0.00% 38 82 0.00% 39 91 0.00% 40 96 0.00% 41 129 0.00% 42 103 0.00% 43 109 0.00% 44 141 0.00% 45 192 0.00% 46 209 0.00% 47 219 0.00% 48 268 0.00% 49 282 0.00% 50 343 0.00% 51 423 0.00% 52 464 0.00% 53 459 0.00% 54 545 0.00% 55 518 0.00% 56 534 0.00% 57 618 0.00% 58 747 0.01% 59 711 0.01% 60 900 0.01% 61 1010 0.01% 62 1155 0.01% 63 1390 0.01% 64 1417 0.01% 65 1412 0.01% 66 1457 0.01% 67 1579 0.01% 68 1743 0.01% 69 2066 0.01% 70 2407 0.02% 71 2892 0.02% 72 3979 0.03% 73 4200 0.03% 74 5265 0.04% 75 6807 0.05% 76 16189 0.12% 77 12927 0.09% 78 6512 0.05% 79 6241 0.04% 80 6838 0.05% 81 7995 0.06% 82 9016 0.06% 83 10163 0.07% 84 11965 0.09% 85 12433 0.09% 86 12591 0.09% 87 13020 0.09% 88 13802 0.10% 89 14066 0.10% 90 15369 0.11% 91 16821 0.12% 92 19003 0.14% 93 20915 0.15% 94 22376 0.16% 95 23390 0.17% 96 23425 0.17% 97 23426 0.17% 98 23249 0.17% 99 24184 0.17% 100 25741 0.18% 101 27004 0.19% 102 30538 0.22% 103 32953 0.23% 104 34614 0.25% 105 35963 0.26% 106 36170 0.26% 107 35536 0.25% 108 35866 0.26% 109 35888 0.26% 110 37082 0.26% 111 39255 0.28% 112 42271 0.30% 113 45397 0.32% 114 48178 0.34% 115 49867 0.36% 116 51142 0.36% 117 50387 0.36% 118 50343 0.36% 119 50524 0.36% 120 51025 0.36% 121 54021 0.39% 122 56906 0.41% 123 61446 0.44% 124 65140 0.46% 125 68324 0.49% 126 70786 0.50% 127 71089 0.51% 128 71157 0.51% 129 72835 0.52% 130 74176 0.53% 131 77562 0.55% 132 81800 0.58% 133 88496 0.63% 134 94393 0.67% 135 101830 0.73% 136 107575 0.77% 137 114090 0.81% 138 119692 0.85% 139 126759 0.90% 140 134899 0.96% 141 146280 1.04% 142 162957 1.16% 143 184865 1.32% 144 217211 1.55% 145 256539 1.83% 146 316432 2.26% 147 417946 2.98% 148 610105 4.35% 149 1109611 7.91% 150 3473120 24.77% 151 4156565 29.64% 14024186 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.73 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=29.69 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=1.11 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=50.09 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=1.5 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCT SRR7170850 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 19:09:01 Started mapping on | Feb 13 19:09:01 Finished on | Feb 13 19:11:46 Mapping speed, Million of reads per hour | 305.98 Number of input reads | 14024186 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 12711809 Uniquely mapped reads % | 90.64% Average mapped length | 286.25 Number of splices: Total | 11666072 Number of splices: Annotated (sjdb) | 11400624 Number of splices: GT/AG | 11436965 Number of splices: GC/AG | 181187 Number of splices: AT/AC | 6153 Number of splices: Non-canonical | 41767 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 364663 % of reads mapped to multiple loci | 2.60% Number of reads mapped to too many loci | 162843 % of reads mapped to too many loci | 1.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.38% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 968526 968526 968526 N_multimapping 364663 364663 364663 N_noFeature 454830 12421989 582036 N_ambiguous 236842 1278 73249 UnstrandedReadsAssigned:12020137 PositiveStrandReadsAssigned:288542 NegativeStrandReadsAssigned:12056524 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=140 echo kmer=135 SRR7170850 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170850-trimmed-pair1.fastq SRR7170850-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,024,186 reads, 12,086,121 reads pseudoaligned [quant] estimated average fragment length: 225.436 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR7170850.ke.tsv 34699 SRR7170850.se.tsv 87100 total ==> SRR7170850.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1793.56 331 11.8984 Potri.005G024800.1.v4.1 1035 810.564 180 14.3174 Potri.004G059700.1.v4.1 961 736.599 2 0.175056 Potri.007G009000.2.v4.1 1416 1191.56 0 0 Potri.003G141000.2.v4.1 2943 2718.56 799 18.949 Potri.016G087400.1.v4.1 270 94.9754 1082 734.505 Potri.015G069301.1.v4.1 564 345.644 0 0 Potri.010G195200.1.v4.1 1773 1548.56 17 0.70778 Potri.012G127500.1.v4.1 977 752.579 240 20.5607 ==> SRR7170850.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 184 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170850 completed mapping pipeline successfully